Anthony P. Reszka

Bio: Anthony P. Reszka is an academic researcher from University of London. The author has contributed to research in topics: G-quadruplex & Telomerase. The author has an hindex of 28, co-authored 38 publications receiving 4277 citations. Previous affiliations of Anthony P. Reszka include University of Cambridge & Institute of Cancer Research.

Putative DNA Quadruplex Formation within the Human c-kit Oncogene

Abstract: The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

The G-quadruplex-interactive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function.

Abstract: Interference with telomerase and telomere maintenance is emerging as an attractive target for anticancer therapies. Ligand-induced stabilization of G-quadruplex formation by the telomeric DNA single-stranded 3' overhang inhibits telomerase from catalyzing telomeric DNA synthesis and from capping telomeric ends. We report here the effects of a 3,6,9-trisubstituted acridine compound, BRACO-19, on telomerase function in vitro and in vivo. The biological activity of BRACO-19 was evaluated in the human uterus carcinoma cell line UXF1138L, which has very short telomeres (2.7 kb). In vitro, nuclear human telomerase reverse transcriptase (hTERT) expression was drastically decreased after 24 hours, induction of cellular senescence and complete cessation of growth was seen after 15 days, paralleled by telomere shortening of ca. 0.4 kb. In vivo, BRACO-19 was highly active as a single agent against early-stage (68 mm(3)) tumors in a s.c. growing xenograft model established from UXF1138L cells, if given chronically at 2 mg per kg per day i.p. BRACO-19 produced growth inhibition of 96% compared with controls accompanied by partial regressions (P < 0.018). Immunostaining of xenograft tissues showed that this response was paralleled by loss of nuclear hTERT protein expression and an increase in atypical mitoses indicative of telomere dysfunction. Cytoplasmic hTERT expression and its colocalization with ubiquitin was observed suggesting that hTERT is bound to ubiquitin and targeted for enhanced degradation upon BRACO-19 treatment. This is in accord with a model of induced displacement of telomerase from the telomere. The in vitro and in vivo data presented here is consistent with the G-quadruplex binding ligand BRACO-19 producing an anticancer effect by inhibiting the capping and catalytic functions of telomerase.

Structure-based design of selective and potent G quadruplex-mediated telomerase inhibitors

Abstract: The telomerase enzyme is a potential therapeutic target in many human cancers. A series of potent inhibitors has been designed by computer modeling, which exploit the unique structural features of quadruplex DNA. These 3,6,9-trisubstituted acridine inhibitors are predicted to interact selectively with the human DNA quadruplex structure, as a means of specifically inhibiting the action of human telomerase in extending the length of single-stranded telomeric DNA. The anilino substituent at the 9-position of the acridine chromophore is predicted to lie in a third groove of the quadruplex. Calculated relative binding energies predict enhanced selectivity compared with earlier 3,6-disubstituted compounds, as a result of this substituent. The ranking order of energies is in accord with equilibrium binding constants for quadruplex measured by surface plasmon resonance techniques, which also show reduced duplex binding compared with the disubstituted compounds. The 3,6,9-trisubstututed acridines have potent in vitro inhibitory activity against human telomerase, with EC50 values of up to 60 nM.

A Conserved Quadruplex Motif Located in a Transcription Activation Site of the Human c-kit Oncogene

Abstract: The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. Mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small varia...

Structural Basis of DNA Quadruplex Recognition by an Acridine Drug

Abstract: The crystal structure of a complex between the bimolecular human telomeric quadruplex d(TAGGGTTAGGGT)2 and the experimental anticancer drug BRACO-19, has been determined, to 2.5 A resolution. The binding site for the BRACO-19 molecule is at the interface of two parallel-folded quadruplexes, sandwiched between a G-tetrad surface and a TATA tetrad, and held in the site by networks of water molecules. The structure rationalizes the existing structure-activity data and provides a starting-point for the structure-based design of quadruplex-binding ligands

Quadruplex DNA: sequence, topology and structure

Abstract: G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes.

Crystal structure of parallel quadruplexes from human telomeric DNA.

Abstract: Telomeric ends of chromosomes, which comprise noncoding repeat sequences of guanine-rich DNA, are fundamental in protecting the cell from recombination and degradation. Disruption of telomere maintenance leads to eventual cell death, which can be exploited for therapeutic intervention in cancer. Telomeric DNA sequences can form four-stranded (quadruplex) structures, which may be involved in the structure of telomere ends. Here we describe the crystal structure of a quadruplex formed from four consecutive human telomeric DNA repeats and grown at a K(+) concentration that approximates its intracellular concentration. K(+) ions are observed in the structure. The folding and appearance of the DNA in this intramolecular quadruplex is fundamentally different from the published Na(+)-containing quadruplex structures. All four DNA strands are parallel, with the three linking trinucleotide loops positioned on the exterior of the quadruplex core, in a propeller-like arrangement. The adenine in each TTA linking trinucleotide loop is swung back so that it intercalates between the two thymines. This DNA structure suggests a straightforward path for telomere folding and unfolding, as well as ways in which it can recognize telomere-associated proteins.

Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?

Abstract: G-quadruplexes are four-stranded DNA structures that are over-represented in gene promoter regions and are viewed as emerging therapeutic targets in oncology, as transcriptional repression of oncogenes through stabilization of these structures could be a novel anticancer strategy. Many gene promoter G-quadruplexes have physicochemical properties and structural characteristics that might make them druggable, and their structural diversity suggests that a high degree of selectivity might be possible. Here, we describe the evidence for G-quadruplexes in gene promoters and discuss their potential as therapeutic targets, as well as progress in the development of strategies to harness this potential through intervention with small-molecule ligands.

DNA secondary structures: stability and function of G-quadruplex structures

Abstract: In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription.

G-quadruplexes in promoters throughout the human genome

Abstract: Certain G-rich DNA sequences readily form four-stranded structures called G-quadruplexes. These sequence motifs are located in telomeres as a repeated unit, and elsewhere in the genome, where their function is currently unknown. It has been proposed that G-quadruplexes may be directly involved in gene regulation at the level of transcription. In support of this hypothesis, we show that the promoter regions (1 kb upstream of the transcription start site TSS) of genes are significantly enriched in quadruplex motifs relative to the rest of the genome, with >40% of human gene promoters containing one or more quadruplex motif. Furthermore, these promoter quadruplexes strongly associate with nuclease hypersensitive sites identified throughout the genome via biochemical measurement. Regions of the human genome that are both nuclease hypersensitive and within promoters show a remarkable (230-fold) enrichment of quadruplex elements, compared to the rest of the genome. These quadruplex motifs identified in promoter regions also show an interesting structural bias towards more stable forms. These observations support the proposal that promoter G-quadruplexes are directly involved in the regulation of gene expression.