Jeffrey L. Stock

Bio: Jeffrey L. Stock is an academic researcher from University of Cincinnati Academic Health Center. The author has contributed to research in topics: Hox gene & Enhancer. The author has an hindex of 4, co-authored 4 publications receiving 360 citations.

Gsh-1: a novel murine homeobox gene expressed in the central nervous system

Abstract: We report the characterization of Gsh-1, a novel murine homeobox gene. Northern blot analysis revealed a transcript of approximately 2 kb in size present at embryonic days 10.5, 11.5, and 12.5 of development. The cDNA sequence encoded a proline rich motif, a polyalanine tract, and a homeodomain with strong homology to those encoded by the clustered Hox genes. The Gsh-1 expression pattern was determined for days E8.5 to E13.5 by whole mount and serial section in situ hybridizations. Gsh-1 transcription was restricted to the central nervous system. Expression is present in the neural tube and hindbrain as two continuous, bilaterally symmetrical stripes within neural epithelial tissue. In the mesencephalon, expression is seen as a band across the most anterior portion. There is also diencephalon expression in the anlagen of the thalamus and the hypothalamus as well as in the optic stalk, optic recess, and the ganglionic eminence. Moreover, through the use of fusion proteins containing the Gsh-1 homeodomain, we have determined the consensus DNA ninding site of the Gsh-1 homeoprotein to be GCT/CA/CATTAG/A. ©1995 Wiley-Liss, Inc.

Evidence for a complex regulatory array in the first intron of the human adenosine deaminase gene.

Abstract: Adenosine deaminase (ADA) is expressed ubiquitously by diverse mammalian cells and tissues but at levels that vary according to tissue and species. In humans, the thymus exhibits levels of the enzyme up to 100-fold higher than most other tissues. Using transgenic mice, we identified human ADA gene regulatory domains. Up to 3.7 kb of 5'-flanking and first exon DNA from the human ADA gene failed to promote the expression of a chloramphenicol acetyl transferase (CAT) reporter gene in an efficient, reproducible, or tissue-appropriate manner in transgenic mice. However, when 12.8 kb of DNA from the first intron of the human ADA gene was placed 3' of CAT-coding and -processing sequences, transgenic mice reproducibly expressed CAT activity in most tissues, with profoundly high levels in the thymus. DNase I hypersensitivity studies demonstrated that among transgenic mouse tissues, human thymus, and a variety of human cell lines, a region of the intron 4-10 kb downstream of the first exon exhibited an array of hypersensitive sites that varied according to tissue and cell type. Deletion of this region from the gene construction eliminated high-level expression in transgenic mice. In transfection-transient expression assays, the 12.8-kb intron fragment exhibited enhancer activity in several cell types. A 1.3-kb fragment encompassing two of the hypersensitive sites exhibited some of these activities. The results of these studies suggest that the diverse pattern of human ADA gene expression is determined, in part, by a cluster of cis-regulatory elements contained within its large first intron.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

Abstract: We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Dominant mutation of the murine Hox-2.2 gene results in developmental abnormalities

Abstract: Genes carrying the homeobox were originally identified in Drosophila, in which they are now known to play key roles in establishing segmentation patterns and in determining segment identities. A number of genes with striking homology to the Drosophila homeobox genes have now been found in the mouse genome, and mutational analysis is beginning to shed light on their function in mammalian development. To understand better the developmental significance of the murine Hox-2.2 gene, we have generated gain of function mutants by using the chicken beta-actin promoter to drive ubiquitous expression in transgenic mice. The resulting Hox-2.2 misexpression produces early postnatal lethality as well as craniofacial and axial skeletal perturbations that include open eyes at birth, cleft palate, micrognathia, microtia, skull bone deficiencies, and structural and positional alterations in the vertebral column. We repeatedly observe complete or partial absence of the supraoccipital bone and malformations of the exoccipital and the basioccipital bones. These results suggests a role for the Hox-2.2 gene in specifying positional identity along the anterior-posterior axis.

Transcriptional Regulatory Elements in the Human Genome

Abstract: The faithful execution of biological processes requires a precise and carefully orchestrated set of steps that depend on the proper spatial and temporal expression of genes. Here we review the various classes of transcriptional regulatory elements (core promoters, proximal promoters, distal enhancers, silencers, insulators/boundary elements, and locus control regions) and the molecular machinery (general transcription factors, activators, and coactivators) that interacts with the regulatory elements to mediate precisely controlled patterns of gene expression. The biological importance of transcriptional regulation is highlighted by examples of how alterations in these transcriptional components can lead to disease. Finally, we discuss the methods currently used to identify transcriptional regulatory elements, and the ability of these methods to be scaled up for the purpose of annotating the entire human genome.

Gsh2 and Pax6 play complementary roles in dorsoventral patterning of the mammalian telencephalon

Abstract: The telencephalon has two major subdivisions, the pallium and subpallium. The pallium, which primarily consists of glutamatergic cortical structures, expresses dorsal molecular markers, whereas the subpallium, which primarily consists of the GABAergic basal ganglia, expresses ventral molecular markers. Here, we present evidence that the progenitor and postmitotic cells flanking the pallial/subpallial boundary (PSB) in the embryonic mouse can be subdivided into multiple regions that express unique combinations of transcription factors. The domains that immediately flank the PSB are the ventral pallium (VP) and the dorsal lateral ganglionic eminence (dLGE). The early expression of the Pax6 and Gsh2 homeobox transcription factors overlaps in the region of the dLGE. Analyses of mice that lack functional alleles of either Gsh2 or Pax6 demonstrate that these genes have complementary roles in patterning the primordia flanking the PSB. In the Gsh2 mutants, the dLGE is respecified into a VP-like structure, whereas in the Pax6 mutants the VP is respecified into a dLGE-like structure. The role of Pax6 in dorsalizing the telencephalon is similar to its role in the spinal cord, supporting the hypothesis that some dorsoventral patterning mechanisms are used at all axial levels of the central nervous system.

Genetic control of dorsal-ventral identity in the telencephalon: opposing roles for Pax6 and Gsh2.

Abstract: We have examined the genetic mechanisms that regulate dorsal-ventral identity in the embryonic mouse telencephalon and, in particular, the specification of progenitors in the cerebral cortex and striatum. The respective roles of Pax6 and Gsh2 in cortical and striatal development were studied in single and double loss-of-function mouse mutants. Gsh2 gene function was found to be essential to maintain the molecular identity of early striatal progenitors and in its absence the ventral telencephalic regulatory genes Mash1 and Dlx are lost from most of the striatal germinal zone. In their place, the dorsal regulators, Pax6, neurogenin 1 and neurogenin 2 are found ectopically. Conversely, Pax6 is required to maintain the correct molecular identity of cortical progenitors. In its absence, neurogenins are lost from the cortical germinal zone and Gsh2, Mash1 and Dlx genes are found ectopically. These reciprocal alterations in cortical and striatal progenitor specification lead to the abnormal development of the cortex and striatum observed in Pax6 (small eye) and Gsh2 mutants, respectively. In support of this, double homozygous mutants for Pax6 and Gsh2 exhibit significant improvements in both cortical and striatal development compared with their respective single mutants. Taken together, these results demonstrate that Pax6 and Gsh2 govern cortical and striatal development by regulating genetically opposing programs that control the expression of each other as well as the regionally expressed developmental regulators Mash1, the neurogenins and Dlx genes in telencephalic progenitors.