Julian L. Huppert

Bio: Julian L. Huppert is an academic researcher from University of Cambridge. The author has contributed to research in topics: DNA & G-quadruplex. The author has an hindex of 22, co-authored 30 publications receiving 10907 citations. Previous affiliations of Julian L. Huppert include Wellcome Trust Sanger Institute & University of Nice Sophia Antipolis.

Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project

Abstract: We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses. Together, our results advance the collective knowledge about human genome function in several major areas. First, our studies provide convincing evidence that the genome is pervasively transcribed, such that the majority of its bases can be found in primary transcripts, including non-protein-coding transcripts, and those that extensively overlap one another. Second, systematic examination of transcriptional regulation has yielded new understanding about transcription start sites, including their relationship to specific regulatory sequences and features of chromatin accessibility and histone modification. Third, a more sophisticated view of chromatin structure has emerged, including its inter-relationship with DNA replication and transcriptional regulation. Finally, integration of these new sources of information, in particular with respect to mammalian evolution based on inter- and intra-species sequence comparisons, has yielded new mechanistic and evolutionary insights concerning the functional landscape of the human genome. Together, these studies are defining a path for pursuit of a more comprehensive characterization of human genome function.

Prevalence of quadruplexes in the human genome

Abstract: Guanine-rich DNA sequences of a particular form have the ability to fold into four-stranded structures called G-quadruplexes. In this paper, we present a working rule to predict which primary sequences can form this structure, and describe a search algorithm to identify such sequences in genomic DNA. We count the number of quadruplexes found in the human genome and compare that with the figure predicted by modelling DNA as a Bernoulli stream or as a Markov chain, using windows of various sizes. We demonstrate that the distribution of loop lengths is significantly different from what would be expected in a random case, providing an indication of the number of potentially relevant quadruplex-forming sequences. In particular, we show that there is a significant repression of quadruplexes in the coding strand of exonic regions, which suggests that quadruplex-forming patterns are disfavoured in sequences that will form RNA.

G-quadruplexes in promoters throughout the human genome

Abstract: Certain G-rich DNA sequences readily form four-stranded structures called G-quadruplexes. These sequence motifs are located in telomeres as a repeated unit, and elsewhere in the genome, where their function is currently unknown. It has been proposed that G-quadruplexes may be directly involved in gene regulation at the level of transcription. In support of this hypothesis, we show that the promoter regions (1 kb upstream of the transcription start site TSS) of genes are significantly enriched in quadruplex motifs relative to the rest of the genome, with >40% of human gene promoters containing one or more quadruplex motif. Furthermore, these promoter quadruplexes strongly associate with nuclease hypersensitive sites identified throughout the genome via biochemical measurement. Regions of the human genome that are both nuclease hypersensitive and within promoters show a remarkable (230-fold) enrichment of quadruplex elements, compared to the rest of the genome. These quadruplex motifs identified in promoter regions also show an interesting structural bias towards more stable forms. These observations support the proposal that promoter G-quadruplexes are directly involved in the regulation of gene expression.

An RNA G-quadruplex in the 5' UTR of the NRAS proto-oncogene modulates translation

Abstract: Guanine-rich nucleic acid sequences can adopt noncanonical four-stranded secondary structures called guanine (G)-quadruplexes1. Bioinformatics analysis suggests that G-quadruplex motifs are prevalent in genomes2, which raises the need to elucidate their function. There is now evidence for the existence of DNA G-quadruplexes at telomeres with associated biological function3. A recent hypothesis supports the notion that gene promoter elements contain DNA G-quadruplex motifs that control gene expression at the transcriptional level4. We discovered a highly conserved, thermodynamically stable RNA G-quadruplex in the 5′ untranslated region (UTR) of the gene transcript of the human NRAS proto-oncogene. Using a cell-free translation system coupled to a reporter gene assay, we have demonstrated that this NRAS RNA G-quadruplex modulates translation. This is the first example of translational repression by an RNA G-quadruplex. Bioinformatics analysis has revealed 2,922 other 5′ UTR RNA G-quadruplex elements in the human genome. We propose that RNA G-quadruplexes in the 5′ UTR modulate gene expression at the translational level.

Putative DNA Quadruplex Formation within the Human c-kit Oncogene

Abstract: The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

An integrated encyclopedia of DNA elements in the human genome

Abstract: The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

Induced Pluripotent Stem Cell Lines Derived from Human Somatic Cells

Abstract: Somatic cell nuclear transfer allows trans-acting factors present in the mammalian oocyte to reprogram somatic cell nuclei to an undifferentiated state. We show that four factors (OCT4, SOX2, NANOG, and LIN28) are sufficient to reprogram human somatic cells to pluripotent stem cells that exhibit the essential characteristics of embryonic stem (ES) cells. These induced pluripotent human stem cells have normal karyotypes, express telomerase activity, express cell surface markers and genes that characterize human ES cells, and maintain the developmental potential to differentiate into advanced derivatives of all three primary germ layers. Such induced pluripotent human cell lines should be useful in the production of new disease models and in drug development, as well as for applications in transplantation medicine, once technical limitations (for example, mutation through viral integration) are eliminated.

Tissue-based map of the human proteome

Abstract: Resolving the molecular details of proteome variation in the different tissues and organs of the human body will greatly increase our knowledge of human biology and disease. Here, we present a map of the human tissue proteome based on an integrated omics approach that involves quantitative transcriptomics at the tissue and organ level, combined with tissue microarray-based immunohistochemistry, to achieve spatial localization of proteins down to the single-cell level. Our tissue-based analysis detected more than 90% of the putative protein-coding genes. We used this approach to explore the human secretome, the membrane proteome, the druggable proteome, the cancer proteome, and the metabolic functions in 32 different tissues and organs. All the data are integrated in an interactive Web-based database that allows exploration of individual proteins, as well as navigation of global expression patterns, in all major tissues and organs in the human body.

An integrated encyclopedia of DNA elements in the human genome.

Abstract: The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.