Showing papers by "Paris Descartes University published in 1998"

Transforming Growth Factor β1, in the Presence of Granulocyte/Macrophage Colony-stimulating Factor and Interleukin 4, Induces Differentiation of Human Peripheral Blood Monocytes into Dendritic Langerhans Cells

Abstract: Langerhans cells (LCs) are dendritic cells (DCs) that are present in the epidermis, bronchi, and mucosae. Although LCs originate in bone marrow, little is known about their lineage of origin. In this study, we demonstrate that in vitro LCs may originate from monocytes. Adult peripheral blood CD14+ monocytes differentiate into LCs (CD1a+, E-cadherin+, cutaneous lymphocyte-associated antigen+, Birbeck granules+, Lag+) in the presence of granulocyte/macrophage colony-stimulating factor, interleukin 4, and transforming growth factor β1 (TGF-β1). This process occurs with virtually no cell proliferation and is not impaired by 30 Gy irradiation. Selection of monocyte subpopulations is ruled out since monocyte-derived DCs can further differentiate into LCs. Our data suggest that in vivo LC differentiation may be induced peripherally, from a nonproliferating myeloid precursor, i.e., the monocyte, in response to a TGF-β1–rich microenvironment, as found in the skin and epithelia. Therefore, the monocyte may represent a circulating precursor critical to the immune response in vivo.

Software and database for the analysis of mutations in the VHL gene

Abstract: VHL is a tumor suppressor gene localized on chromosome 3p25-26. Mutations of the VHL gene were described at first in the heritable von Hippel-Lindau disease and in the sporadic Renal Cell Carcinoma (RCC). More recently, VHL has also been shown to harbor mutations in mesothelioma and small cell lung carcinoma. To date more than 500 mutations have been identified. These mutations are mainly private with only one hot spot at codon 167 associated with pheochromocytoma. The germline mutations are essentially missense while somatic mutations include deletions, insertions and nonsense. To standardize the collection of these informations, facilitate the mutational analysis of the VHL gene and promote the genotype-phenotype analysis, a software package along with a computerized database have been created. The current database and the analysis software are accessible via the internet and world wide web interface at the URL:http://www.umd.necker.fr

Accumulation of the p53 Protein Allows Recognition by Human CTL of a Wild-Type p53 Epitope Presented by Breast Carcinomas and Melanomas

Abstract: The p53 protein is accumulated in tumor cells of many human cancers and can elicit in vivo humoral and proliferative responses. Rare reports about p53-mediated tumor recognition by CTLs have remained questioned. We therefore studied a panel of breast tumor and melanoma cell lines that we assayed for the presence of accumulated p53 and surface HLA-A2 and for the presentation of p53 epitopes. From PBMC of a healthy donor, we have generated a CTL line, D5/L9V, directed against HLA-A2-restricted peptide 264–272 from wild-type p53. It efficiently lysed breast adenocarcinomas MCF-7, MCF7/RA1, and MDA-MB-231, and melanoma M8, which all accumulate the p53 protein. Using competition assays, we made sure that tumor lysis by D5/L9V was due to recognition of endogenously produced p53 peptide 264–272 associated with the HLA-A2.1 molecule on the surface of these tumor cells. Cells with undetectable levels of wild-type p53, such as lymphoblastoid cells and melanoma M74, were not recognized by D5/L9V. Neither were breast tumor cell line MCF7/ADR nor melanoma line M44 because of HLA loss. This study therefore shows that it is possible to obtain in vitro CTL lines that specifically recognize a p53 epitope spontaneously presented by a variety of HLA-A2+ transformed cell lines provided they display abnormal patterns of p53 expression. This work points out that breast tumors and melanomas share a p53 epitope, and raises hopes for future immunotherapeutic approaches.

Marfan Database (third edition): New mutations and new routines for the software

Abstract: The Marfan database is a software that contains routines for the analysis of mutations identified in the FBN1 gene that encodes fibrillin-1. Mutations in this gene are associated not only with Marfan syndrome but also with a spectrum of overlapping disorders. The third version of the Marfan database contains 137 entries. The software has been modified to accommodate four new routines and is now accessible on the World Wide Web at http://www.umd.necker.fr

LDLR Database (second edition): New additions to the database and the software, and results of the first molecular analysis

Abstract: Mutations in the LDL receptor gene (LDLR) cause familial hypercholesterolemia (FH), a common autosomal dominant disorder. The LDLR database is a computerized tool that has been developed to provide tools to analyse the numerous mutations that have been identified in the LDLR gene. The second version of the LDLR database contains 140 new entries and the software has been modified to accommodate four new routines. The analysis of the updated data (350 mutations) gives the following informations: (i) 63% of the mutations are missense, and only 20% occur in CpG dinucleotides; (ii) although the mutations are widely distributed throughout the gene, there is an excess of mutations in exons 4 and 9, and a deficit in exons 13 and 15; (iii) the analysis of the distribution of mutations located within the ligand-binding domain shows that 74% of the mutations in this domain affect a conserved amino-acid, and that they are mostly confined in the C-terminal region of the repeats. Conversely, the same analysis in the EGF-like domain shows that 64% of the mutations in this domain affect a non-conserved amino-acid, and, that they are mostly confined in the N-terminal half of the repeats. The database is now accessible on the World Wide Web at http://www.umd.necker.fr

Dopamine D3 receptor gene variants and substance abuse in schizophrenia.

Abstract: In an association study of the Bal I polymorphism in the dopamine D3 receptor (DRD3) gene in a French Caucasian population, global comparison of patients with schizophrenia (n = 89, DSM-III-R criteria) and controls (n = 52) led to non-significant differences. However, the homozygosity was significantly more frequent in schizophrenic patients with lifetime substance abuse comorbidity (n = 36) as compared to patients with no history of substance abuse (P = 0.010) or to controls (P = 0.047) and in neuroleptic responder patients as compared to treatment-refractory patients (n = 19; P = 0.037). The combined characteristics treatment response and lifetime substance abuse were strongly associated with homozygosity. We propose that homozygosity for the Bal I polymorphism DRD3 gene is associated with predisposition to substance abuse and/or the pharmacosensitive characteristic of schizophrenia rather than with schizophrenia itself, an hypothesis in agreement with the positive association of this polymorphism with opiate dependence (see companion article by Duaux et al) and the involvement of DRD3 in both pharmacodependence mechanisms and antipsychotic effects of neuroleptics.

Occipital Remodeling and Suboccipital Decompression in Severe Craniosynostosis Associated with Tonsillar Herniation

Abstract: Objective The goal was to describe a surgical technique allowing occipital vault remodeling and suboccipital decompression in patients affected by multiple-suture synostosis presenting severe occipital flattening and chronic tonsillar herniation (CTH). Methods Four patients (two with Crouzon's syndrome, one with Kleeblattschadel, and one with complex craniosynostosis) presenting multiple-suture synostosis with severe occipital flattening, posterior fingerprint impressions, and CTH were operated on in the prone position. For three patients, occipital vault remodeling and suboccipital decompression without dural opening were performed; for one patient affected by Kleeblattschadel, an upper cervical laminectomy and dural opening were performed. All patients were studied with magnetic resonance imaging pre- and postoperatively. Results No complications were observed. In all cases, postoperative magnetic resonance imaging revealed good decompression of the craniocervical junction, with resolution of brain stem displacement. In one case, CTH recurred 15 months after surgery, although in a less severe form. Conclusion In selected cases of complex or syndromic craniosynostosis with predominant posterior deformity and CTH, this technique was safe and useful in the management of cranial reconstruction, allowing posterior vault remodeling and prophylactic suboccipital decompression. After validation with a larger number of patients, it could prove to be a useful option in all cases of complex craniosynostosis with CTH in which a staged repair of the craniosynostosis is to be considered.

Oxidation of guaiacol by myeloperoxidase: a two-electron-oxidized guaiacol transient species as a mediator of NADPH oxidation

Abstract: The present study was first aimed at a complete steady-state kinetic analysis of the reaction between guaiacol (2-methoxyphenol) and the myeloperoxidase (MPO)/H2O2 system, including a description of the isolation and purification of MPO from human polymorphonuclear neutrophil cells. Secondly, the overall reaction of the oxidation of NADPH, mediated by the reactive intermediates formed from the oxidation of guaiacol in the MPO/H2O2 system, was analysed kinetically. The presence of guaiacol stimulates the oxidation of NADPH by the MPO/H2O2 system in a concentration-dependent manner. Concomitantly, the accumulation of biphenoquinone (BQ), the final steady-state product of guaiacol oxidation, is lowered, and even inhibited completely, at high concentrations of NADPH. Under these conditions, the stoichiometry of NADPH:H2O2 is 1, and the oxidation rate of NADPH approximates to that of the rate of guaiacol oxidation by MPO. The effects of the presence of superoxide dismutase, catalase and of anaerobic conditions on the overall oxidation of NADPH have also been examined, and the data indicated that superoxide formation did not occur. The final product of NADPH oxidation was shown to be enzymically active NADP+, while guaiacol was generated continuously from the reaction between NADPH and oxidized guaiacol product. In contrast, similar experiments performed on the indirect, tyrosine-mediated oxidation of NADPH by MPO showed that a propagation of the free radical chain was occurring, with generation of both O2(-.) and H2O2. BQ, in itself, was able to spontaneously oxidize NADPH, but neither the rate nor the stoichiometry of the reaction could account for the NADPH-oxidation process involved in the steady-state peroxidation cycle. These results provide evidence that the oxidation of NADPH does not involve a free nucleotide radical intermediate, but that this is probably due to a direct electron-transfer reaction between NADPH and a two-electron-oxidized guaiacol intermediate.

Creativity across Time and Place: life span and cross‐cultural perspectives

Abstract: Creativity varies across time and place. With regard to variations across time, age‐related changes in the quantity, quality, and form of creative performance are examined. These changes are traced to a combination of cognitive, conative, and environmental variables. With regard to variations across place, the effect of cultural environment on creativity is examined. Culture is shown to influence the definition and expression of creativity, channeling creativity into certain task domains or social groups. The quantity of creative activity can be further affected by cultural features such as the value placed on conformity. Life span and cross‐cultural perspectives on creativity, it is argued, are integral to a comprehensive understanding of creativity.

Adenovirus-Mediated Transfer of the Acid α-Glucosidase Gene into Fibroblasts, Myoblasts and Myotubes from Patients with Glycogen Storage Disease Type II Leads to High Level Expression of Enzyme and Corrects Glycogen Accumulation

Abstract: Glycogen storage disease type II (GSD II) is an autosomal recessive disorder caused by defects in the lysosomal acid alpha-glucosidase (GAA) gene. We investigated the feasibility of using a recombinant adenovirus containing the human GAA gene under the control of the cytomegalovirus promoter (AdCMV-GAA) to correct the enzyme deficiency in different cultured cells from patients with the infantile form of GSD II. In GAA-deficient fibroblasts infected with AdCMV-GAA, transduction and transcription of the human transgene resulted in de novo synthesis of GAA protein. The GAA enzyme activity was corrected from the deficient level to 12 times the activity of normal cells. The transduced cells overexpressed the 110 kDa precursor form of GAA, which was secreted into the culture medium and was taken up by recipient cells. The recombinant GAA protein was correctly processed and was active on both an artificial substrate 4-methylumbelliferyl-alpha-D-glucopyranoside (4MUG) and glycogen. In GAA-deficient muscle cells, a significant increase in cellular enzyme level, approximately 20-fold higher than in normal cells, was also observed after viral treatment. The transduced muscle cells were also able to efficiently secrete the recombinant GAA. Moreover, transfer of the human transgene resulted in normalization of cellular glycogen content with clearance of glycogen from lysosomes, as assessed by electron microscopy, in differentiated myotubes. These results demonstrate phenotypic correction of cultured skeletal muscle from a patient with infantile-onset GSD II using a recombinant adenovirus. We conclude that adenovirus-mediated gene transfer might be a suitable model system for further in vivo studies on delivering GAA to GSD II muscle, not only by direct cell targeting but also by a combination of secretion and uptake mechanisms.

Retinoid Receptors Expression in Human Term Placenta: Involvement of RXRα in Retinoid Induced-hCG Secretion

Abstract: To investigate the role of retinoids on human placental development and functions, we characterized the spatial distribution of retinoid receptors in human term chorionic villi. In situ hybridization with 35S labeled sense and antisense probes for the RARs, α, β, γ and RXRs, α, β, γ, specifically detected only RARα and RXRα. Both RARα and RXRα mRNA were preferentially expressed in the trophoblast cell layer. This syncytiotrophoblast expression was confirmed by immunohistochemical analyses using anti-RARα and RXRα antibodies. Using trophoblast cells in culture, we then studied the effect on hCG secretion of 0.1μ M RA physiological forms and of selective RARα and RXRα synthetic agonists. Only RXRα specific ligands such as physiological 9-cis RA and synthetic Ro 25-7386 stimulated hCG secretion (doubled). These results suggest an important role for RXRα in human placental development and function.

Continuous quantitative monitoring of spontaneous opiate withdrawal : Locomotor activity and sleep disorders

Abstract: The time course of drug abstinence is not readily amenable to examination using intermittent observations, because abstinence is known to interfere with circadian rhythms of general activity Accordingly, we propose a model for continuous assessment of spontaneous withdrawal without any intervention by the investigator This model is based on the automatic recording of locomotor activity Experiments were performed in rectangular activity cages equiped with two infrared photoelectric cells In a parallel experiment, to confirm the locomotor activity effects, continuous monitoring of EEG activities was achieved from two cortical and one reference electrodes Morphine dependence was induced by intraperitoneal injections of increasing doses of morphine twice daily for 10 days (from 5 up to 90 mg/kg) Behavioral and EEG activities were recorded for 8 to 10 days following the last injection of morphine Although control rats displayed a typical locomotor activity pattern characterized by nocturnal hyperactivity that was markedly reduced during the light phase, opiate abstinent rats developed a constant motor activity during the first 3 or 4 postinjection days and that was associated with a drastic reduction of overall rapid eye movment sleep (REM) and non-REM sleep and with an increase of waking (W) Although morphine-abstinent rats slowly resumed a normal circadian cycle after the fourth day in terms of horizontal activity, REMS, NREMS and W, long-term effects were revealed by the permanent motor instability recorded during both the light and the dark phases when the total amount of photocell counts was considered, and by the perturbation of the circadian rhythm of the ratio of REM sleep to total sleep time Automatic continuous recording of total motor behavior appears to be a useful index with which to follow, over an extended period of time, the acute and long-term consequences of opiate abstinence Therefore, long-term withdrawal-induced changes in activity could be a suitable model for the validation of antiabstinence therapies

10 Spondylarthropathy treatment: progress in medical treatment, physical therapy and rehabilitation

Abstract: The monitoring and treatment of the diseases belonging to the concept of spondylarthropathy are related more to their clinical presentation, for example axial versus peripheral involvement, than to the precise diagnosis, for example, ankylosing spondylitis versus psoriatic arthritis. For each clinical presentation the treatment comprises local and systemic routes of administration but also drug and non-drug therapies.

Conformational analysis of ketolide, conformations of RU 004 in solution and bound to bacterial ribosomes.

Abstract: A new structurally distinct class of 14-membered-ring macrolides is characterized by a keto-function instead of the cladinose sugar, well-known for its fragility even in weakly acidic media. This n...

GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides

Abstract: The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH3)2(H2O)2]2+, and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k5‘ = 18 ± 2 and k3‘ = 15 ± 1 M-1 s-1), roughly twice as fast as the AG guanine of II (k3‘ = 9 ± 1 M-1 s-1). Platination of the AG adenine of II was also observed to a minor extent (k5‘ = 1.5 ± 0.3 M-1 s-1), whereas no other adenine of I or II was platinated to a detectable extent. The overall platination rate of I is approximately three times larger than that of II. The 3‘-monoadduct of I undergoes chelation to the GG intrastrand adduct with a rate 10.5 times larger than the 5‘-monoadduct (k3‘c = (1.9 ± 0.1) × 10-3 s-1 and k5‘c = (0.18 ± 0.05) × 10-3 s-1). For...

Long-lasting enhanced expression in the rat hippocampus of NMDAR1 splice variants in a kainate model of epilepsy

Abstract: Chronic epilepsy is associated with increased excitability which may result from abnormal glutamatergic synaptic transmission involving altered properties of N-methyl-d-aspartate (NMDA) receptors. To date two gene families encoding NMDA receptor subunits have been cloned, NR1 and NR2. Eight NR1 mRNAs are generated by alternative splicing of exons 5, 21 and 22; the NR1–1 to NR1–4 C-terminal variants exist in the a or b version depending on the presence or absence of the domain encoded by exon 5. Epilepsy was induced in rats by unilateral intra-amygdalar injection of kainate and animals were killed from 6 h to 4 months following the injection. Increased NR1 mRNA levels were observed during status epilepticus (6–24 h after the injection), both ipsilateral and contralateral, while a second wave of NMDAR1 mRNA increase occurred in chronic epileptic animals, between 21 days and 4 months following kainate injection. Our data show: (i) a permanent increase of the NR1–2a and NR1–2b mRNA species (containing exon 22) in all hippocampal fields, both ipsilateral and contralateral, and (ii) an increase of the NR1–3 (a and b) mRNAs (containing exon 21) in the ipsilateral CA1, and NR1–3a mRNA in the ipsilateral dentate gyrus. No long-term changes were observed for the NR1–1 and NR1–4 splice variants. In the ipsilateral CA3 area a globally decreased mRNA expression was associated with neuronal loss. A possible contribution to the maintenance of the epileptic state by an increased expression of NMDA receptors is discussed.

Identification of novel PAX6 mutations in two families with bilateral aniridia. Mutations in brief no. 167. Online.

Abstract: We report two novel PAX6 mutations in aniridia patients of two Swiss pedigrees (We, Sc) which give rise to different phenotypes. An SSCP analysis of the PAX6 14 exons reveals electrophoretic mobility shifts exclusively in exons 5 and 12 of aniridia patients. As determined by bidirectional sequencing and restriction digest analysis, these shifts are caused by mono-allelic base transitions in exon 5 (c.547C-->T; R44X; We) and intron 12 (IVS12+5G-->A; Sc). Each mutation co-segregates with the trait in the affected family with complete penetrance. The Sc mutation in the splicing donor site of intron 12 may result in either intron inclusion or exon skipping, both giving rise to a truncated PAX6 protein which may retain a residual transactivating activity. In contrast, the We genetic alteration is a loss-of-function mutation leading to a more severe phenotype than that observed in the Sc pedigree.