Showing papers by "University of Antwerp published in 1981"
••
TL;DR: The logical consistency of market share models has received considerable attention in the recent marketing literature as mentioned in this paper, and the reports suggest that, at least theoretically, attraction-type specifications are a...
Abstract: Logical consistency of market share models has received considerable attention in the recent marketing literature. The reports suggest that, at least theoretically, attraction-type specifications a...
118 citations
•
TL;DR: The different responses in forearm and calf vessels can be explained by a central component which triggers a vasodilator pathway (possibly cholinergic) which is distributed to forearm but not to calf vessels.
Abstract: Experiments were conducted in normal human volunteers to compare the response of the forearm and calf vessels to contralateral isometric exercise, mental stress, resisted breathing, coughing, and the Valsalva maneuver. Blood flows were measured by means of strain-gauge plethysmography, arterial blood pressure by auscultation, and heart rate by electrocardiography. Isometric exercise of one forearm (at one-third maximal voluntary contraction) for 90 seconds caused an increase in blood pressure and heart rate; the vascular resistance decreased in the resting forearm, and increased in the calf. The decrease in forearm resistance was greater with the subjects supine and attenuated with the subjects standing or reclining head-down. With arterial occlusion of the exercising forearm just prior to cessation of the handgrip, the blood pressure and the calf resistance remained elevated, while the heart rate returned to control. The forearm resistance increased during the occlusion period and remained elevated throughout it. Mental stress caused an increase in heart rate and blood pressure and a dilation of the forearm but not of the calf vessels; these changes were smaller in standing than in supine subjects. Resisted breathing and coughing caused an increase in heart rate and in forearm blood flow, but not in calf blood flow. The Valsalva maneuver was followed by decreases in blood flow to the upper and lower limbs. The different responses in forearm and calf vessels can be explained by a central component which triggers a vasodilator pathway (possibly cholinergic) which is distributed to forearm but not to calf vessels.
103 citations
••
TL;DR: In this article, the results from the duplicate impactor samples were normally in good agreement, indicating that the combined uncertainty of sampling and PIXE analysis was of the order of 20%.
91 citations
••
TL;DR: A comprehensive review is given of the determination of selenium by the various atomic-absorption spectrometry methods that have been developed, covering the use of various flame and electrothermal ionization methods, hydride techniques, preconcentration and separation, and giving an appraisal of the results.
74 citations
••
TL;DR: This discussion will deal with two major aspects where arterial and venous smooth muscle differ in their sensitivity to vasoactive agents; theirensitivity to inhibitors of calcium-influx (Ca2+ antagonists) on the one hand and their reactivity to serotonin (5-hydroxytryptamine) and serotonin antagonists, on the other.
Abstract: There are marked differences in responsiveness to naturally occurring vasoactive substances1-4 between isolated blood vessels of different anatomical origin and in particular between arteries and veins. This discussion will deal with two major aspects where arterial and venous smooth muscle differ in their sensitivity to vasoactive agents; their sensitivity to inhibitors of calcium-influx (Ca2+ antagonists) on the one hand and their reactivity to serotonin (5-hydroxytryptamine) and serotonin antagonists, on the other.
68 citations
••
TL;DR: In this paper, a relativistic many-body calculation of the thallium atom hyperfine interaction including the effect of a tetragonal crystal field has been carried out for the first time.
Abstract: Two thallium atom defects of tetragonal symmetry around $〈100〉$ are produced by x irradiation above 230 K in KCl: TlCl. Their electron-spin-resonance spectra are characterized by comparable and large $g$ shifts but quite different hyperfine parameters. A relativistic many-body calculation of the ${\mathrm{Tl}}^{0}$ atom hyperfine interaction including the effect of a tetragonal crystal field permits a quantitative analysis of the spin-Hamiltonian parameters. It is found in particular that the hyperfine data of the two ${\mathrm{Tl}}^{0}$ defects can be explained by assuming the presence of one or two perturbing positive charges, respectively, and a corresponding 35 and 45% delocalization of the $6{p}^{1}$ electron on the surrounding lattice. This analysis together with x-ray production, optical-excitation, and pulse-anneal data and the fact that both ${\mathrm{Tl}}^{0}$ defects can only be produced at temperatures where negative-ion vacancies are mobile (g230 K) allows one to propose precise defect structures: In one defect the ${\mathrm{Tl}}^{0}$ atom (on a positive-ion site) is associated with a single negative-ion vacancy in a nearest-neighbor position along $〈100〉$; in the other one, the ${\mathrm{Tl}}^{0}$ is flanked by two nearest-neighbor negative-ion vacancies along $〈100〉$. The data also provide strong evidence for the existence of a defect consisting of a ${\mathrm{Tl}}^{+}$ ion and a nearest-neighbor anion vacancy.
67 citations
••
TL;DR: The results suggest that the reactivity of innervated blood vessels to $$ norepinephrine is similar in SHR and normotensive rats, and the adrenergic nerve terminals in hypertensive blood vessels can modulate the junctional concentration of nOREpinephrine so that the contractile response to this agent is similar to that in normotintensive blood vessels.
Abstract: SUMMARY The goal of this study was to compare adrenergic neurotransmlssion in isolated vascular smooth muscle from spontaneously hypertensive (SHR) and normotensive rats. Tail arteries, excised from adult SHR and normotensive rats, were cut helically into strips that were mounted in organ chambers between two platinum wire electrodes; isometric contractions were recorded. Vascular responsiveness was determined before and after acute denerration with 6-hydroxydopamine or before and after treatment with phentolamine. Release or displacement of endogenous norepinepbrine was obtained with electrical stimulation, tyramine, and potassium. The sensitivity to exogenous noreplnephrine of innervated vessels was similar for SHR and normotensive rats. Denerration produced a significant shift to tbe left in the concentration-response curve to noreplnephrine only in SHR vessels. Contractile responses to electrical stimulation, tyramine, and potassium were similar in both groups before denervation. Contractile responses to potassium-free solution were greater in SHR than in normotensive vessels. Following denerration, the SHR and normotensive vessels responded similarly to these latter interventions. Blockade of alpha-adrenoceptors with phentolamine reduced contractile responses to all agents in innervated and denerrated vessels. Cocaine caused a slowing of the relaxation following contraction induced by electrical stimulation in both SHR and normotensive vessels. The relaxation of SHR vessels was less affected by cocaine than in normotensive vessels. The tissue content of norepinephrine was similar in SHR and normotensive arterial strips. In arterial strips from SHR the uptake of 'H-norepinephrine was significantly larger than in those from normotensive rats. The results suggest that the reactivity of innervated blood vessels to $$ norepinephrine is similar in SHR and normotensive rats. Important differences in sensitivity to norepinephrine in hypertensive vessels are unmasked when tbe relationship between the vascular smooth muscle cell and the adrenergic nerve terminal is altered. Apparently, the adrenergic nerve terminals in hypertensive blood vessels can modulate the junctional concentration of norepinephrine so that the contractile response to this agent is similar to that in normotensive blood vessels.
64 citations
••
TL;DR: In this paper, the characteristic structural asymmetries and distortions of AXYB systems in which an electron lone pair is at Y are discussed on the basis of the completely relaxed ab initio equilibrium geometries of a number of representative systems including various conformations of methanediol, hydrazine, 1,2-dimethylhydrazine and compounds with CH 3 groups adjacent to , OCH 3, NH, NCH 3 and C(π).
Abstract: The characteristic structural asymmetries and distortions of AXYB systems in which an electron lone pair is at Y are discussed on the basis of the completely relaxed ab initio equilibrium geometries of a number of representative systems including various conformations of methanediol, hydrazine, 1,2-dimethylhydrazine and of compounds with CH 3 groups adjacent to OH, OCH 3 , NH, NCH 3 and C(π). It is found that, regardless of quantitative overlap and energy gap factors, all calculated trends in the relative extensions of bond distances and bond angles can be correlated in every detail to qualitative predictions based only on the orientational aspects of orbital interaction concepts.
62 citations
••
TL;DR: In this article, the geometries of three conformations of FCH 2 OH and four conformations each of NH 2 CH 2 NH 2 were completely refined by ab initio calculations on the 4-21G level.
Abstract: The geometries of three conformations of FCH 2 OH and four conformations each of NH 2 CH 2 NH 2 and NH 2 CH 2 OH are completely refined by ab initio calculations on the 4–21G level. It is found that most characteristic structural and conformational properties of such systems can be reliably predicted on the basis of a simple anomeric orbital interaction model. The extension of this model to all compounds in which two electronegative substituents with non-bonding lone pairs or bonding π-electrons are attached to the same tetrahedral carbon atom, including polymer systems such as proteins, seems to be useful.
53 citations
••
TL;DR: Two basic techniques are presented to show the decidability status of a number of problems concerning node label controlled graph grammars, mainly of graph-theoretic nature.
44 citations
••
TL;DR: Dog aorta-derived endothelial cells invariably retracted the fibrin clot when stimulated with exogenously added or endogenously formed thrombin and incorporation of additional Ca 2+ into non-retracting, Reptilase®-formed clots resulted in a retraction which was not blocked by heparin.
••
TL;DR: A series of 6,7-phenanthreno- and 6, 7-acenaphthenopteridines bearing different substituents at positions 2 and 4 are prepared in this article.
••
TL;DR: This work provides a characterization of the class of context-free string languages in terms of DNLC grammars, and studies the use of those Grammars to define string languages.
Abstract: Directed node-label controlled graph grammars (DNLC grammars) are sequential graph rewriting systems. In a direct derivation step of a DNLC grammar a single node is rewritten. Both the rewriting of a node and the embedding of a "daughter graph" in a "host graph" are controlled by the labels of nodes only. We study the use of those grammars to define string languages. In particular we provide a characterization of the class of context-free string languages in terms of DNLC grammars.
••
TL;DR: Equations are derived that allow the computation of the number of repeats of different lengths and frequencies expected in any random sequence of known chain length and base composition.
••
TL;DR: This study is based partly on personal observations during surgery, but principally on data from anatomical specimens in the temporal tissue bank, which have been dissected since 1964 and each anomaly has been noted and classified.
Abstract: The main anomalies of the middle ear generally correspond to a well-defined chronological stage of embryogenesis. With minor abnormalities there is sometimes no chronological uniformity. This study is based partly on personal observations during surgery, but principally on data from anatomical specimens in our temporal tissue bank. Since 1964, more than 2000 specimens have been dissected, and each anomaly has been noted and classified. Further information comes from the radiograms and tomograms of cases in which congenital malformations were suspected.
••
TL;DR: In this paper, a new phase, denoted X, was discovered in Cr100-xAlx alloys in and around the composition range 20 at% ⪅ x ⫅ 25 at%, and the electron diffraction patterns of this phase appear to be commensurate with the reciprocal lattice of the disordered b.c. r. α-phase.
Abstract: This paper reports on a new phase, denoted X, discovered in Cr100–xAlx alloys in and around the composition range 20 at% ⪅ x ⪅ 25 at%. The electron diffraction patterns of this phase appear to be commensurate with the reciprocal lattice of the disordered b.c.c. α-phase, except in rapidly cooled samples. Dark-field images show that the reflections originate from very small domains, 1 to 3 nm in size. High-resolution images reveal rather ill-defined fringes corresponding to two X-phase orientation variants. The X-phase is accompanied by the β-phase in a large part of the composition range considered. The identification of the X-phase either as a rhombohedral superstructure or a concentration modulation of the α-phase or as a periodic anti-phase boundary structure of the β-phase is discussed. The influence of size-, disorder-, and twinning effects on the diffraction patterns and high-resolution images is consdered. Finally, a tentative correction to the currently accepted phase diagram is presented.
Es wird uber eine neue Phase, X-Phase, berichtet, die in Cr100–xAlx-Legierungen im Zusammensetzungsbereich 20 At% ⪅ x ⪅ 25 At% gefunden wird. Das Elektronenbeugungsdiagramm dieser Phase scheint mit dem reziproken Gitter der fehlgeordneten k. r. z. α-Phase kommensurabel zu sein, ausgenommen fur schnell abgekuhlte Proben. Dunkelfelddiagramme zeigen, das die Reflexe von sehr kleinen Domanen mit 1 bis 3 nm Abmessungen herruhren. Hochauflosungsbilder zeigen ziemlich schlecht definierte Streifen, die zwei Orientierungsvarianten der X-Phase entsprechen. Die X-Phase ist von der β-Phase in einem grosen Teil des untersuchten Zusammensetzungsbereichs begleitet. Die Identifizierung der X-Phase entweder als rhombische Superstruktur oder als Konzentrationsmodulation der α-Phase oder als periodische Antiphasengrenzenstruktur der β-Phase wird diskutiert. Der Einflus von Grosen-, Fehlordnungs- und Zwillingsbildungseffekten auf die Beugungsdiagramme und Hochauflosungsbilder wird untersucht. Schlieslich wird eine vorlaufige Korrektur des gegenwartig akezptierten Phasendiagramms angegeben.
••
TL;DR: Purine nucleotides important for normal cellular metabolism are derived endogenously from de novo synthesis and also from recycling of pre-formed purines via the so-called salvage pathway, the absence of which can lead to disturbances of purine metabolism and also severe clinical symptoms.
Abstract: Purine nucleotides important for normal cellular metabolism are derived endogenously from de novo synthesis and also from recycling of pre-formed purines via the so-called salvage pathway (Figure 1). The latter pathway contains a number of enzymes, the absence of which can lead to disturbances of purine metabolism and also severe clinical symptoms1. An example is the deficiency of the salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT) which can lead either to the Lesch-Nyhan syndrome or X-linked gout1.
••
TL;DR: In this article, the calibration of an energy-dispersive X-ray spectrometer was calculated from published physical constants, when the geometry factor of secondary target, sample, detector is obtained experimentally and when the detection efficiency of the Si(Li) detector is calculated from such experimentally derived parameters as the thickness of cryostat window, gold surface barrier contact and silicon dead layer.
Abstract: The calibration of an energy-dispersive X-ray spectrometer is calculated from published physical constants, when the geometry factor of secondary target, sample, detector is obtained experimentally and when the detection efficiency of the Si(Li) detector is calculated from such experimentally derived parameters as the thickness of cryostat window, gold surface barrier contact and silicon dead layer. The results are compared with calibrations obtained experimentally from commercial single element thin film standards obtained by vacuum evaporation and multielement standards obtained by incorporating known amounts of the elements into a thin film polymer. The results obtained from fundamental parameters agree with the experimental data to within 5–6%.
••
TL;DR: In this paper, the authors derived a microscopic model for the NaNO2 crystal in the paraelectric phase, where the dynamical variables are the translational displacements of both the NO2-groups and the Na-ions, and the reorientations of the NO 2-groups are described by means of symmetry adapted functions.
Abstract: Starting from a sterical hindrance potential for the motion of the NO2-molecular group in the deformable cage of neighbouring Na-ions, we derive a microscopic model for the NaNO2 crystal in the paraelectric phase. The dynamical variables are the translational displacements of both the NO2-groups and the Na-ions, and the reorientations of the NO2-groups. Reorientations are described by means of symmetry adapted functions. From a numerical study of the model, we conclude that reorientations of the NO2-groups take place essentially through rotations about the crystallographicc-axis. The model explains why optical experiments have led to the incorrect conclusion of reorientations about thea-axis. By studying the symmetry properties of the bilinear coupling of translations and rotations, we separate optical and acoustical displacements. Only the former couple to the order parameter in the long wavelength limit. Therefore there is no acoustical soft mode at the ferroelectric phase transitions. The bilinear coupling leads to an effective lattice mediated interaction among reorienting NO2-groups.
••
TL;DR: It is suggested that a highly diluted solution of trypan blue can be used without teratogenic effects, as a tracer for exogenous yolk uptake and migration into oocytes, and that fluorescence microscopy is a reliable method for its further localization.
Abstract: It was shown that the vital dye trypan blue injected subcutaneously is adsorbed on exogenous yolk and stored in oocytes of Japanese quails The binding sites of the dye could be visualized by fluorescence microscopy The spectral distribution of the trypan blue-induced fluorescence emitted by yolk granules was analyzed microspectrographically The analysis revealed that yolk granules exhibit a deep red fluorescence radiation with a maximum intensity at 670 nm, when blue or green excitation light is used This fluorescence was exclusively induced by the presence of trypan blue, and not by contaminants of the dye The fluorescence intensity did not decrease during processing of the tissue throughout the different solvents routinely used in light microscopy, especially after fixation in Heidenhain's fluid, nor did it suffer from pronounced fading during irradiation of the tissue Model experiments showed that the value of the fluorescence emission maximum was concentration-dependent, and that amounts as little as 5×10−3 mg trypan blue per ml solution containing an excess of yolk as a substrate for the dye, could clearly be detected and measured It is suggested that a highly diluted solution of trypan blue can be used without teratogenic effects, as a tracer for exogenous yolk uptake and migration into oocytes, and that fluorescence microscopy is a reliable method for its further localization A detailed account of the procedure is reported
••
TL;DR: In this paper, a 10-cm2 cellulose filter with immobilized 2,2-diaminodiethylamine functional groups was used for trace anion preconcentration from aqueous solution, with subsequent x-ray fluorescence measurements.
••
TL;DR: In this article, the molecular structures of five conformations of dimethoxymethane (CH 3 OCH 2 -OCH 3 ) were determined by geometrically unconstrained ab initio force relaxation on the 4-21G level.
Abstract: The molecular structures of five conformations of dimethoxymethane (CH 3 OCH 2 -OCH 3 ) were determined by geometrically unconstrained ab initio force relaxation on the 4—21G level. The results are consistent with the expected structural effects of anomeric orbital interactions.
••
TL;DR: A simple method for rapid determination of IgG containing circulating immune complexes by commercially available reagents was developed, which is slightly more sensitive than the C1q-binding method.
••
TL;DR: In this article, a study on the microstructure of Cr100-xAlx alloys (10 at% ⪅ x⪅ 33 at%) results are reported on the β-phase.
Abstract: As part of a study on the microstructure of Cr100–xAlx alloys (10 at% ⪅ x ⪅ 33 at%) results are reported on the β-phase (26 at% ⪅ x ⪅ 33 at%) since they bear a relationship with the microstructure in the wider composition range. From a crystallographic analysis of the structure, models are proposed for the defects of chemical as well as magnetic nature. Electron microscopy and diffraction observations are analysed in terms of these models and confirm the proposals. High resolution microscopy is used for a detailed analysis of the interfaces between domains down to an atomic scale. Diffuse intensity contours observed in the diffraction patterns of alloys with 20 at% ⪅ x ⪅ 26 at% Al are interpreted in terms of a transition state of the β-phase.
Als Teil einer Untersuchung zur Mikrostruktur von Cr100–xAlx-Legierungen (10 At% ⪅ x ⪅ 33 At%) werden die Ergebnisse an der β-Phase (26 At% ⪅ x ⪅ 33 At%) mitgeteilt, da sie eine Beziehung mit der Mikrostruktur in einem weiteren Zusammensetzungsbereich enthalten. Aus der kristallograephischen Analyse der Struktur werden Modelle fur chemische sowie auch magnetische Defekt vorgeschlagen. Elektronenmikroskopische und Beugungsmessungen werden mit diesen Modellen analysiert und bestatigen diese Vorschlage. Hochauflosende Mikroskopie wird fur eine ausfuhrliche Analyse der Grenzflachen zwischen Domanen bis zu atomaren Abmessungen herab benutzt. Die in den Beugungsdiagrammen von Legierungen mit 20 At % ⪅ x ⪅ 26 At% Al beobachteten diffusen Intensitatskonturen werden mit einem Ubergangszustand der β-Phase gedeutet.
••
TL;DR: The presence of chicken aorta tissue in chicken whole blood inhibited 5HT-, but not arachidonic acid-induced aggregation, as indicated by inhibitory studies with indomethacin, and the lack of any hemostatic function of PGI2 in chickens was indicated by the absence of biosynthesis of endogenous P GI2 in chicken aorts.
••
01 Jan 1981TL;DR: A new integrity constraint, called general dependencies, is introduced that generalizes a number of well-known types of constraints and a corresponding decomposition property is given and a set of inference rules is presented.
Abstract: In this paper a new integrity constraint, called general dependencies, is introduced. It generalizes a number of well-known types of constraints. A corresponding decomposition property is given and a set of inference rules is presented.
••
TL;DR: A patient treated with combined prolonged hemoperfusion and hemodialysis for severe dimethoate poisoning and the combination of dialysis and adsorption may improve overall drug removal is reported on.
Abstract: We report on a patient treated with combined prolonged hemoperfusion (HP, Adsorba 300 C, Gambro, Sweden) and hemodialysis (HD, C-DAK 1.2, Cordis Dow, USA) for severe dimethoate poisoning. This procedure was adopted since the combination of dialysis and adsorption may improve overall drug removal. Combined HP-HD was performed during 24 h using the same charcoal column and dialyser. Adequate heparinization was obtained by monitoring the whole blood activated partial thromboplastin time. The patient (a 34-year-old female) ingested approximately 10 g of dimethoate (Teletox 10) in a suicide attempt, 30 min before admission to the hospital. On admission, serum level of dimethoate (analysed by gas chromatography) was 2340 ng ml-1. She received conventional treatment and combined HP-HD was started within 2 h after admission. At this time serum levels had risen to 3110 ng ml-1. However, they declined constantly during the epuration and after 18 h no more dimethoate could be detected in the serum. She was discharged 3 days after treatment. During the 24 h of HP-HD treatment, 110.8 mg dimethoate entered the epuration system via the plasma. 55.3 mg were extracted by the charcoal column and 25.3 mg by hemodialysis.
••
TL;DR: The analytical features and most important fields of application of spark source mass spectrometry are described with respect to the trace analysis of highpurity materials and the multielement analysis of technical alloys, geochemical and cosmochemical, biological and radioactive materials, as well as in environmental analysis as mentioned in this paper.
Abstract: The analytical features and most important fields of application of spark source mass spectrometry are described with respect to the trace analysis of highpurity materials and the multielement analysis of technical alloys, geochemical and cosmochemical, biological and radioactive materials, as well as in environmental analysis. Comparisons are made to other analytical methods. The distribution of the method as well as opportunities for contract analysis are indicated and developmental tendencies discussed.
••
TL;DR: The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUacUUGGAUGGGUGACCGCCUGgGAACACCGGGUGCUGUUGGCAU (OH).
Abstract: The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.