Showing papers in "Plant Disease in 1998"

Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits.

Abstract: ilamentous fungi of the genus Colletotrichum and its teleomorph Glomerella are considered major plant pathogens worldwide. They cause significant economic damage to crops in tropical, subtropical, and temperate regions. Cereals, legumes, ornamentals, vegetables, and fruit trees may be seriously affected by the pathogen (3). Although many cultivated fruit crops are infected by Colletotrichum species, the most significant economic losses are incurred when the fruiting stage is attacked. Colletotrichum species cause typical disease symptoms known as anthracnose, characterized by sunken necrotic tissue where orange conidial masses are produced. Anthracnose diseases appear in both developing and mature plant tissues (4). Two distinct types of diseases occur: those affecting developing fruit in the field (preharvest) and those damaging mature fruit during storage (postharvest). The ability to cause latent or quiescent infections has grouped Colletotrichum among the most important postharvest pathogens. Species of the pathogen appear predominantly on aboveground plant tissues; however, belowground organs, such as roots and tubers, may also be affected. In this article, we deal in particular with methods used to identify and characterize Colletotrichum species and genotypes from almond, avocado, and strawberry, as examples, using traditional and molecular tools. The three pathosystems chosen represent different disease patterns of fruitassociated Colletotrichum. Multiple Species on a Single Host Numerous cases have been reported in which several Colletotrichum species or biotypes are associated with a single host. For example, avocado and mango anthracnose, caused by both C. acutatum and C. gloeosporioides, affect fruit predominantly as postharvest diseases (25,40,41). Strawberry may be infected by three Colletotrichum species, C. fragariae, C. acutatum, and C. gloeosporioides, causing anthracnose of fruit and other plant parts (31). Almond and other deciduous fruits may be infected by C. acutatum or C. gloeosporioides (Table 1) (1,5,46,50). Citrus can be affected by four different Colletotrichum diseases (61): postbloom fruit drop and key lime anthracnose, both caused by C. acutatum, and shoot dieback and leaf spot, and postharvest fruit decay, both caused by C. gloeosporioides. Additional examples of hosts affected by multiple Colletotrichum species include coffee, cucurbits, pepper, and tomato. Single Species on Multiple Hosts It is common to find that a single botanical species of Colletotrichum infects multiple hosts. For example, C. gloeosporioides (Penz.) Penz. & Sacc. in Penz. (teleomorph: Glomerella cingulata (Stoneman) Spauld. & H. Schrenk), which is considered a cumulative species and forms the sexual stage in some instances, is found on a wide variety of fruits, including almond, avocado, apple, and strawberry (Table 2) (6,15,31,46). Likewise, C. acutatum J.H. Simmonds has been reported to infect a large number of fruit crops, including avocado, strawberry, almond, apple, and peach (1,5,16,25,27). Examples of other species with multiple host ranges include C. coccodes, C. capsici, and C. dematium (14,56).

Efficacy of Various Fungal and Bacterial Biocontrol Organisms for Control of Fusarium Wilt of Tomato.

Abstract: Numerous fungi and bacteria, including existing biocontrol strains with known activity against soilborne fungal pathogens as well as isolates collected from the roots and rhizosphere of tomato plants growing in the field, were tested for their efficacy in controlling Fusarium wilt of tomato. Tomato seedlings were treated with the potential biocontrol agents in the greenhouse and transplanted into pathogen-infested field soil. Organisms tested included nonpathogenic strains of Fusarium spp., Trichoderma spp., Gliocladium virens, Pseudomonas fluorescens, Burkholderia cepacia, and others. Specific nonpathogenic isolates of F. oxysporum and F. solani collected from a Fusarium wilt-suppressive soil were the most effective antagonists, providing significant and consistent disease control (50 to 80% reduction of disease incidence) in several repeated tests. These isolates also were equally effective in controlling Fusarium wilt diseases of other crops, including watermelon and muskmelon. Other organisms, including isolates of G. virens, T. hamatum, P. fluorescens, and B. cepacia, also significantly reduced Fusarium wilt compared to disease controls (30 to 65% reduction), but were not as consistently effective as the nonpathogenic Fusarium isolates. Commercially available biocontrol products containing G. virens and T. harzianum (SoilGard and RootShield, respectively) also effectively reduced disease (62 to 68% reduction) when granules were incorporated into potting medium at 0.2% (wt/vol). Several fungal and bacterial isolates collected from the roots and rhizosphere of tomato plants also significantly reduced Fusarium wilt of tomato, but were no more effective than other previously identified biocontrol strains. Combinations of antagonists, including multiple Fusarium isolates, Fusarium with bacteria, and Fusarium with other fungi, also reduced disease, but did not provide significantly better control than the nonpathogenic Fusarium antagonists alone.

Eucalyptus rust: a disease with the potential for serious international implications.

Abstract: Eucalyptus spp. are propagated extensively as non-natives in plantations in many parts of the tropics and sub-tropics. A number of diseases result in serious losses to this economically important forest resource. Eucalyptus rust, caused by Puccinia psidii, is one such example. The economic losses due to this disease are the result of infections of seedlings, young trees, and coppice. P. psidii occurs predominately in Central and South America, but reports of a similar rust are known from other areas. Eucalyptus rust is a remarkable disease in that the pathogen is not known on eucalypts in their centers of origin. It has apparently originated on native Myrtaceae in South America and is highly infective on some Eucalyptus spp. planted there. P. psidii causes one of the most serious forestry diseases in Brazil and is considered to be the most serious threat to eucalypt plantations worldwide. Advances in eucalyptus rust research are reviewed here, with a focus on topics such as distribution, host range, pathogen specialization, symptomatology, etiology, epidemiology, and control.

Ergot: A New Disease Threat to Sorghum in the Americas and Australia

Abstract: Sorghum, Sorghum bicolor (L.) Moench, is the world’s fifth most important cereal crop, cultivated on about 45 million hectares for food, feed, beverage, and fodder. The most significant technological change since the 1960s has been the development and use of F1 hybrid seed (14), which has lead to a dramatic improvement in the crop’s productivity. Sorghum cultivation in intensive, commercialized systems where yields average 3 to 5 t ha-1 relies almost totally on hybrid seed. In contrast, yields vary widely and average less than 1 t ha-1 in low-input production systems.

Effects of chitin and chitosan on the incidence and severity of Fusarium yellows of celery

Abstract: Bell, A. A., Hubbard, J. C., Liu, L., Davis, R. M., and Subbarao, K. V. 1998. Effects of ch itin and chitosan on the incidence and severity of Fusarium yellows in celery. Plant Dis. 82:322-328. The effects of chitin and chitosan on disease incidence and severity of Fusarium yellows of celery and on populations of Fusarium oxysporum were investigated between 1994 and 1996. Field experiments were conducted at two locations with a history of severe Fusarium yellows. Disease incidence and severity were significantly reduced by pre-plant chitin amendments to soil. Chitosan applied as a root dip alone did not reduce disease incidence but significantly ( P < 0.05) reduced disease severity when used with a tolerant celery cultivar. Standard soil dilution methods were used to enumerate populations of soil microflora. Ch itin increased bacterial and actinomycete populations in soil in 2 of the 3 years of study. The effects of potential biocontrol agents recovered from chitin-treated plots in 1995 were studied in 1996; enriching the transplant medium with isolates of bacteria and actinomycetes 4 weeks and 1 week prior to transplanting did not alter the established equilibrium in the field, and no biocontrol effect was observed. Chitin amendments to soil or chitosan treatment of transplants did not reduce soil populations of F. oxysporum. Whether these treatments affected the F. oxysporum f. sp. apii subpopulation within the F. oxysporum population could not be determined.

Effect of Phosphite on Tomato and Pepper Plants and on Susceptibility of Pepper to Phytophthora Root and Crown Rot in Hydroponic Culture

Abstract: Tomato and pepper plants were grown hydroponically in a greenhouse using phosphate or technical and commercial formulations of phosphite as sources of phosphorus nutrition to determine the effects on plant development and susceptibility to Phytophthora root and crown rot. Phosphite-treated tomato and pepper plants were deficient of phosphate and developed phosphorus-deficiency symptoms. Growth of plants (leaf area and leaf, stem, and root dry weights) that were fertilized with phosphite was significantly (P < 0.05) reduced compared with phosphate-fertilized plants. In Phytophthora capsici-inoculated pepper plants, incidence of Phytophthora crown rot was significantly reduced in phosphite-treated plants compared with no phosphorus or phosphate-treated plants. Incidence of crown rot in pepper plants treated with 1 mM phosphate plus 0.3 mM phosphite was intermediate between plants treated with only phosphite (1 mM or 0.1 mM) and plants treated with phosphate (1 mM).

Coffee Leaf Scorch Bacterium: Axenic Culture, Pathogenicity, and Comparison with Xylella fastidiosa of Citrus.

Abstract: Symptoms of coffee leaf scorch (CLS) appear on young flushes of field plants as large marginal and apical scorched areas on recently mature leaves. Affected leaves drop, shoot growth is stunted, and apical leaves are small and chlorotic. Symptoms may progress to shoot dieback. Only scorched leaves which could not be related to other known agents consistently contained bacteria and bacterial agglomerates when observed with light microscopy. Only plants with these symptoms were positive in enzyme-linked immunosorbent assay (ELISA) tests using antiserum to Xylella fastidiosa Wells et al. The bacterium Xylella fastidiosa Wells et al. was isolated in November 1995 from coffee (Coffea arabica) leaves with scorch symptoms on supplemented periwinkle wilt medium. Colonies were circular, dome-shaped, white, and 0.5 to 1.5 mm in diameter. Two of 10 young coffee seedlings stem-inoculated with a suspension of the isolated X. fastidiosa in January 1996 showed leaf scorch symptoms 3 to 5 months later, contained bacteria in xylem extracts, and reacted positively in ELISA using antiserum to the citrus variegated chlorosis (CVC) strain of X. fastidiosa. ELISA-positive bacteria were reisolated from this plant. None of the symptomless plants, including controls, revealed bacteria on microscopic examinations, ELISA, or isolation attempts. Antisera developed against cultured bacteria from both CLS and CVC plants reacted positively against plant extracts of both diseases in dot immunobinding assays (DIBA). The level of detection was about 5 × 105 bacteria ml-1 for both homologous and heterologous reactions. The polymerase chain reaction amplification products produced by CLS and CVC strains of X. fastidiosa were indistinguishable. Geographical distribution of these strains is not the same. CLS is widespread and usually occurs if coffee is adjacent to CVC-affected citrus. However, CVC does not always occur when citrus is grown adjacent to CLS-affected coffee. The bacteria are closely related, if not identical.

Effects of wounding, inoculum density, and biological control agents on postharvest brown rot of stone fruits

Abstract: The effects of wounding, inoculum density, and three isolates (New, Ta291, and 23-E-6) of Trichoderma spp. and one isolate (BI-54) of Rhodotorula sp. on postharvest brown rot of stone fruits were determined at 20°C and 95% relative humidity (RH). Brown rot was observed frequently on wounded nectarine, peach, and plum fruits inoculated with two spores of Monilinia fructicola per wound, and occasionally on unwounded nectarine and peach fruits inoculated with the same spore load. Brown rot was observed on wounded plums only. A substantial increase in lesion diameter of brown rot was also recorded on wounded nectarines and peaches inoculated with suspensions of ≤20 spores and ≤200 spores per wound, respectively, compared with unwounded fruit. At concentrations of 107 and 108 spores per ml, all Trichoderma isolates substantially reduced brown rot on peaches (63 to 98%) and plums (67 to 100%) when fruits were inoculated with M. fructicola following the application of a biological control agent. Similar...

A Global Marker Database for Phytophthora infestans.

Abstract: A marker database was compiled for isolates of the potato and tomato late blight pathogen, Phytophthora infestans, originating from 41 locations which include 31 countries plus 10 regions within Mexico. Presently, the database contains information on 1,776 isolates for one or more of the following markers: restriction fragment length polymorphism (RFLP) fingerprint consisting of 23 bands; mating type; dilocus allozyme genotype; mitochondrial DNA haplotype; sensitivity to the fungicide metalaxyl; and virulence. In the database, 305 entries have unique RFLP fingerprints and 258 entries have unique multilocus genotypes based on RFLP fingerprint, dilocus allozyme genotype, and mating type. A nomenclature is described for naming multilocus genotypes based on the International Organization for Standardization (ISO) two-letter country code and a unique number, Forty-two previously published multilocus genotypes are represented in the database with references to publications. As a result of compilation of the database, seven new genotypes were identified and named. Cluster analysis of genotypes from clonally propagated populations worldwide generally confirmed a previously published classification of old and new genotypes. Genotypes from geographically distant countries were frequently clustered, and several old and new genotypes were found in two or more distant countries. The cluster analysis also demonstrated that A2 genotypes from Argentina differed from all others. The database is available via the Internet, and thus can serve as a resource for Phytophthora workers worldwide.

Location of Geminiviruses in the Whitefly Bemisia tabaci (Homoptera: Aleyrodidae).

Abstract: The location of tomato mottle virus (ToMoV) and cabbage leaf curl virus (CabLCV) (Geminiviridae, genus Begomovirus) in the whitefly vector Bemisia tabaci B-biotype (Homoptera: Aleyrodidae) was elucidated using a novel technique incorporating indirect immunofluorescent labeling in freshly dissected whiteflies. Begomoviruses were visualized in the whitefly by indirect-fluorescent-microscopy. Polyclonal and monoclonal primary antibodies were used to successfully detect both ToMoV and CabLCV. Both begomoviruses were located in the anterior region of the midgut and filter-chamber of adult whiteflies, with ToMoV detected in the salivary glands. CabLCV was detected at a greater frequency than ToMoV, with a positive detection of 16% (89 out of 560) for CabLCV and 3% (25 out of 840) for ToMoV. Possible sites involved in geminivirus transport from the gut lumen of whiteflies into the hemocoel were located in the filter-chamber and anterior portion of the midgut. The location of these begomoviruses suggests a possible scenario of virus movement through the whitefly, which is discussed.

Effects of Onion Yellow Dwarf and Leek Yellow Stripe Viruses on Symptomatology and Yield Loss of Three French Garlic Cultivars.

Abstract: This study was conducted to determine the effect of two potyviruses, onion yellow dwarf virus (OYDV) and leek yellow stripe virus (LYSV), on the symptoms, growth, and potential yield loss of garlic (Allium sativum). For 2 consecutive years, the impact on leaf length, pseudostem diameter, and bulb weight was evaluated after mechanical inoculation of cultivars Messidrome, Germidour, and Printanor, the three main garlic cultivars grown in France. The reduction in bulb weight due to OYDV ranged from 39% for Germidour to about 60% for the two other cultivars. For LYSV, the reduction in bulb weight was less on Messidrome (17%) and Germidour (26%) than on Printanor (54%). Coinfection with both viruses further reduced growth and bulb weight. When cloves originating from bulbs infected by each virus alone or a mixture of both viruses were planted, results indicated that such chronic infection induced further yield reduction. An assay designed to evaluate the role of LYSV inoculation date on yield revealed that yield losses were the lowest for late-season infections. However, yield loss was greater than 30% when the inoculation was performed at the end of April, the time when natural contamination generally occurs in southern France. A comparison of the impact of mixed infections of OYDV and LYSV from different origins suggested that the isolates did not differ significantly in their effects on yield loss.

Natural Occurrence of Fumonisins in Rice with Fusarium Sheath Rot Disease.

Abstract: Twenty samples of rough rice (Oryza sativa) (unpolished kernels) collected during the 1995 harvest season from Arkansas (seven samples) and Texas (13 samples) were obtained from rice fields known to include plants with symptoms of Fusarium sheath rot putatively caused by Fusarium proliferatum. Samples were analyzed for fumonisin B1 (FB1) at three laboratories using three different extracting solvents by high-performance liquid chromatography (HPLC) or enzyme-linked immunosorbent assay (ELISA) methods. Forty percent of the samples were positive for FB1 at levels ≤4.3 μg/g by HPLC. The same samples contained FB1 at ≤3.6 μg/g when measured by an ELISA method. Most samples that were positive for FB1 were positive for fumonisin B2 (FB2) and fumonisin B3 (FB3) by HPLC at levels ≤1.2 μg/g. Very good agreement was obtained among the two laboratories using HPLC methods and the third using ELISA. Shelling of the unpolished rice results in hull and brown rice fractions. In a sample that contained 4.3 μg/g i...

Distribution of Fumonisins in Maize Ears Infected with Strains of Fusarium moniliforme that Differ in Fumonisin Production

Abstract: Desjardins, A. E., Plattner, R. D., Lu, M., and Claflin, L. E. 1998. Distribution of fumonisins in maize ears infected with strains of Fusarium monUijorme that differ in fumonisin production. Plant Dis. 82:953-958. Strains of Fusarium monilijorme (Gibberella fujikuroi mating population A) that differ in fu­ monisin production in vitro were previously identified in a Kansas field population. One strain that produced high levels of fumonisins and two strains that produced very low levels of fu­ monisins were applied to maize kernels at planting at the Rocky Ford Farm near Manhattan, Kansas. The distribution of fumonisins in symptomatic and symptomless kernels from individ­ ual harvested ears was determined by high performance liquid chromatography, and the distri­ bution of the three applied strains in the kernels was determined by vegetative compatibility group analysis. Both symptomatic and symptomless kernels were extensively colonized with F. monilijorme, but the highest levels of fumonisins were in the symptomatic kernels. All three applied strains were recovered from kernels in 1993, and two of them were recovered from kernels in 1994. However, a high frequency of ear and kernel infection with a strain that pro­ duced little fumonisin in vitro did not consistently decrease the level of fumonisins. The fre­ quency of infection with fumonisin low-producing strains may have been too low for competi­ tive exclusion of naturally occurring fumonisin high-producing strains. Also, strains that are low-fumonisin producers under laboratory conditions may be high producers in the field.

Management of Meloidogyne hapla on Lettuce in Organic Soil with Sudangrass as a Cover Crop

Abstract: Host suitability for Meloidogyne hapla of six cover crops was tested in the greenhouse. Sudan-grass cv. Trudan 8 and rye (mixture of cultivars) were nonhosts; oat cv. Porter was a poor host; and phacelia cv. Angelia, oilseed radish cv. Renova, and yellow mustard cv. Martigena were maintenance hosts. When incorporated as a green manure before planting of lettuce cv. Mon-tello, sudangrass was the most effective of the cover crops in reducing egg production of M. hapla. Soil amendment with all parts of sudangrass resulted in lower reproduction of M. hapla on lettuce than soil amendment with only roots of sudangrass. Soil incorporation of 2-month-old (or younger) tissues of sudangrass was more effective in reducing nematode reproduction on subsequent lettuce plants than incorporation of 3-month-old tissues. Sudangrass was grown as a cover crop after lettuce for three growing seasons in field microplots and incorporated as a green manure before the first fall frost. Weight of lettuce heads was significantly higher and reproduction of M. hapla was significantly lower in sudangrass-amended microplots compared with those left fallow between lettuce crops, but results varied with year and nematode infestation level.

Postharvest Application of Organic and Inorganic Salts for Suppression of Silver Scurf on Potato Tubers.

Abstract: Seven organic and inorganic salts were tested for suppression of silver scurf, a postharvest disease of potato tubers caused by Helminthosporium solani. Potassium sorbate, calcium propionate, sodium carbonate, sodium bicarbonate, potassium carbonate, potassium bicarbonate, and ammonium bicarbonate were added to V8 agar at concentrations of 0.06–0.2 M. Radial growth of H. solani was significantly reduced (P < 0.05) by all salts at all concentrations. All salts except sodium bicarbonate and potassium bicarbonate were fungicidal at 0.2 M. Effects of postharvest salt treatments on disease severity and sporulation of H. solani on inoculated and naturally infected potato tubers were evaluated in separate experiments. Greenhouse-grown tubers were inoculated with H. solani spore suspensions (2 × 105 spores/ml), incubated for 5 days, dipped into 0.2 M solutions of each of the salts, and incubated in a moist chamber at 22–24°C for 6 weeks. All salt treatments prevented lesion development and sporulation of...

Soybean cultivar responses to Sclerotinia sclerotiorum in field and controlled environment studies

Abstract: The responses of 12 soybean cultivars to Sclerotinia sclerotiorum were evaluated under field and controlled environment conditions. The 12 cultivars were planted in fields naturally or artificially infested with S. sclerotiorum and evaluated for disease incidence. In controlled environment studies, the cultivars were compared with respect to lesion size on detached leaves and stems inoculated with mycelial disks, incidence of stem rot following mycelial inoculation of foliage, lesion lengths on stems discolored by oxalic acid, and levels of soluble pigment(s) in stems. Significant differences (P ≤ 0.05) in disease incidence, lesion sizes, and levels of soluble pigment(s) were detected among the 12 cultivars in all evaluations, but ranking of cultivars varied among methods and experiments within methods. Corsoy 79 and S19-90 were consistently most resistant in all methods; whereas Kenwood, A2242, Bell, and Williams 82 were least resistant. Pearson correlation coefficients (R) for disease incidence...

A Formulation of Trichoderma and Gliocladium to Reduce Damping-off Caused by Rhizoctonia solani and Saprophytic Growth of the Pathogen in Soilless Mix

Abstract: Commercially manufactured cellulose granules (Biodac) were mixed with a sticker and fermentor-produced biomass of isolates of Trichoderma spp. and Gliocladium virens to produce a formulation in which chlamydospores in the biomass were "activated" with dilute acid. Activation resulted in the formation of young, actively growing hyphae of the biocontrol fungi within a 2- to 3-day period under no special aseptic conditions. Activated Biodac with biomass of isolates Gl-3, Gl-21, and Gl-32 of G. virens and isolate TRI-4 of T. hamatum applied to soilless mix at a rate of 1.5% (wt/wt) reduced damping-off of eggplant caused by Rhizoctonia solani (R-23) and resulted in stands comparable to that (88%) in noninfested soilless mix. Saprophytic growth of the pathogen was also reduced. The application of either of two activated Biodac formulations to provide the same amount (1.5% with 9.4 mg of biomass per g of Biodac or 0.2% with 75.0 mg of biomass per g of Biodac) reduced preemergence damping-off as well as saprophytic growth of R-23. Also, there was about a 103-fold population increase of Gl-3 and TRI-4 in the soilless mix at the time of plant harvest compared with that provided to the soilless mix at the time of formulation addition. Activated Biodac of Gl-3 also reduced the spread of R-23 in soilless mix when the pathogen was applied at specific foci rather than evenly distributed. The inhibition of pathogen spread significantly reduced the postemergence damping-off of cucumber, eggplant, and pepper seedlings.

Occurrence, Distribution, and Relative Incidence of Mosaic Viruses Infecting Field-Grown Melon in Spain

Abstract: The main areas for field-grown melon (Cucumis melo) production in Spain were surveyed for the occurrence and relative incidence of cucumber mosaic virus (CMV), papaya ringspot virus-watermelon strain (PRSV-W), watermelon mosaic virus-2 (WMV-2), and zucchini yellow mosaic virus (ZYMV) during the growing seasons of 1995 and 1996. Samples from 1,152 plants showing symptoms of virus infection were collected from commercial melon fields and analyzed by enzyme-linked immunosorbent assay (ELISA). CMV and WMV-2 were the most frequently found viruses, both by the number of locations and by their incidence in each location. In contrast, PRSV-W and ZYMV were detected in fewer sites and at lower incidences. PRSV-W was not found in 1996. In 79% of the samples, only one virus was detected; 15% of the samples were doubly infected. Both the incidence of plants showing symptoms of viral infection and the relative incidence of each of the four viruses varied according to the region, while the main trends of virus distribution were similar for 1995 and 1996.

Detection of a Geminivirus Infecting Sweet Potato in the United States.

Abstract: In 1994, a sweet potato sample showing leaf curl symptoms was collected from the field in Louisiana. When graft-inoculated, Ipomoea nil cv. Scarlett O'Hara reacted with severe leaf distortion and chlorosis symptoms. I. aquatica reacted with a bright yellow mottle. The virus isolated was designated the United States isolate of sweet potato leaf curl virus (SPLCV-US). It was transmitted to I. nil by the sweet potato whitefly, Bemisia tabaci biotype B. DNA probes prepared with component A of pepper Huasteco geminivirus, with an isolate of bean golden mosaic geminivirus from Guatemala, with an isolate of tomato mottle geminivirus from Florida, and with an isolate of tomato yellow leaf curl geminivirus from the Dominican Republic (TYLCV-DR) hybridized with a 2.6-kb DNA band present in DNA extracts from plants infected with SPLCV-US. Probes prepared with the B component of these geminiviruses did not hybridize with these DNA extracts. We were unable to amplify SPLCV-US DNA products by polymerase chain reaction (PCR) in quantities that could be visualized by ethidium bromide staining. However, Southern blots from amplifications with primers AV494/AC1048 revealed PCR products of approximately 600 bp and 550 bp when hybridized with the TYLCV-DR probe. These results were consistently obtained from infected I. cordatotriloba and less consistently from I. aquatica or I. setosa. Fibrillar inclusions were occasionally seen, and granular aggregates of viruslike particles were observed in the nucleus of infected I. cordatotriloba. These results suggest that the virus isolated from sweet potato with leaf curl symptoms belongs to the geminivirus group.

Yield and Seed Quality of Soybean Cultivars Infected with Sclerotinia sclerotiorum

Abstract: Sclerotinia stem rot (SSR) is one of the most important diseases of soybean in the United States. Five maturity group III cultivars, Asgrow A3304 STS (A3304), Pioneer Brand 9342 (P9342), P...

Comparative virus resistance and fruit yield of transgenic squash with single and multiple coat protein genes.

Abstract: Five transgenic squash lines expressing coat protein (CP) genes from cucumber mosaic cucumovirus (CMV), zucchini yellow mosaic potyvirus (ZYMV), and watermelon mosaic virus 2 potyvirus (WMV 2) were analyzed in the field for their reaction to mixed infections by these three viruses and for fruit production. Test plants were exposed to natural inoculations via aphids in trials simulating the introduction of viruses by secondary spread from mechanically infected susceptible border row plants. Plants of transgenic line CZW-3 expressing the CP genes from CMV, ZYMV, and WMV 2 displayed the highest level of resistance with no systemic infection, although 64% exhibited localized chlorotic dots which were mainly confined to older leaves. CZW-3 plants had a 50-fold increase in marketable yield compared to controls and the highest predicted cash returns. Plants of transgenic line ZW-20 expressing the CP genes from ZYMV and WMV 2 displayed high levels of resistance to these two potyviruses, but 22% became infected by CMV. However, ZW-20 plants provided a 40-fold increase in marketable yield relative to controls and good estimated cash returns. Three transgenic lines expressing single CP genes from either ZYMV (line Z-33), WMV 2 (line W-164) or CMV (line C-14) developed systemic symptoms similar to those of controls but showed a delay of 2 to 4 weeks before the onset of disease. Plants of transgenic line Z-33 were highly resistant to ZYMV but not to WMV 2 and CMV. Interestingly, Z-33 plants had a 20-fold increase in marketable yield compared to controls and some predicted cash returns if market sale prices were high. This study indicates that virus-resistant transgenic lines are economically viable even if they are affected by viruses other than those to which they are resistant.

Influence of Inoculum Density, Wetness Duration, Plant Age, Inoculation Method, and Cultivar Resistance on Infection of Pepper Plants by Colletotrichum coccodes

Abstract: Effects of inoculum density, wetness duration, plant age, inoculation method, and cultivar resistance on the development of pepper anthracnose caused by Colletotrichum coccodes were evaluated under controlled environmental conditions. As inoculum density of C. coccodes increased from 103 to 106 conidia/ml, symptoms of anthracnose developed. Disease severity also increased with increasing time of wetness duration from 0 to 60 h. Wetness duration above 48 h and a high inoculum density at 106 conidia/ml caused severe defoliation and blight symptoms in pepper seedlings. Inoculum at 104 conidia/ml and 24 to 36 h of continuous wetness duration was enough to form irregular or circular brown lesions on pepper leaves. Age-related resistance was expressed as pepper plants matured. To evaluate resistance, the foliar-inoculation method was more reliable than the soil-drench method, which did not induce symptoms on older plants. The responses of 35 pepper cultivars or accessions tested to C. coccodes were quantitative rather than qualitative. No hypersensitive symptoms were observed in any of the cultivars inoculated with any of the two isolates. No significant differences in susceptibility to anthracnose were found among cultivars from Korea, the United States, India, and Thailand or accessions tested, irrespective of genetic or country origin of cultivars. The Korean cultivar Kwangbok was relatively less susceptible to anthracnose, compared with the other cultivars tested.

A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

Abstract: A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

Aspergillus flavus Infection and Aflatoxin Accumulation in Resistant and Susceptible Maize Hybrids.

Abstract: Field studies were conducted for 2 years in Mississippi to monitor maize kernel infection and aflatoxin accumulation caused by Aspergillus flavus at various times during the growing season. Hybrids resistant and susceptible to A. flavus were compared to determine temporal differences in infection and aflatoxin levels. The resistant hybrids tested were Mo18W × Mp313E, Mp420 × Tx601, and SC54 × SC76; and the susceptible hybrids tested were GA209 × Mp339, Mp307 × Mp428, and Mp68:616 × SC212M. The top ear of each plant was inoculated with a suspension containing A. flavus conidia at 7 days after midsilk (50% of the plants in a plot had silks emerged) using the side needle technique. Inoculated ears were harvested 35, 42, 49, 56, and 63 days after midsilk to determine kernel infection by A. flavus and aflatoxin contamination. Differences in aflatoxin levels between resistant and susceptible hybrids occurred in all harvest dates. However, significant differences between resistant and susceptible hybrids for kernel infection were not observed until 42 days after midsilk. Differences between resistant and susceptible hybrids occurred for kernel infection and aflatoxin concentrations 49, 56, and 63 days after midsilk. Incidence of kernel infection (8.1% for GA209 × Mp339) was the highest 49 days after midsilk, and aflatoxin concentrations (510 ng/g for Mp307 × Mp428) were the highest 63 days after midsilk. Maximum differences between resistant and susceptible hybrids for aflatoxin levels were observed 63 days after midsilk. Two of the resistant hybrids, Mo18W × Mp313E and Mp420 × Tx601, had significantly less aflatoxin than the three susceptible hybrids 63 days after midsilk.