A maternal-effect genetic incompatibility in Caenorhabditis elegans
SummaryĀ (4 min read)
Introduction
- In what is perhaps the most extreme scenario, selfish elements can kill individuals that do not inherit them, leading to a genetic incompatibility between carriers and non-carriers (Beeman et al.
- Their underlying genetic mechanisms have been resolved in only a few cases (Werren 2011).
Results
- V from the standard laboratory strain N2 into the strain DL238 by performing eight rounds of backcrossing and selection.
- The authors examined the sequences of sup-35 and pha-1 in 152 C. elegans wild isolates that represented unique isotypes (Cook et al. 2016) in the Caenorhabditis elegans Natural Diversity Resource (Cook et al. 2017).
- This suggested that the DL238 and QX1211 haplotypes were highly divergent from the N2 reference, and that major genomic rearrangements may have occurred.
Discussion
- The antidote, pha-1, was originally thought to be a developmental gene, in large part due to the specific pharyngeal defects observed in mutants (Schnabel and Schnabel 1990; Granato et al.
- An attractive possibility is that this regulation evolved as an additional mechanism to cope with sup-35 toxicity, as part of an arms race between the selfish element and its host.
- These results suggest that the origin of the sup-35/pha-1 element involved the duplication of a pre-existing gene (rmd-2) and the recruitment of a novel gene of unknown origin in the lineage leading to C. elegans.
- Lastly, their work highlights the importance of studying natural genetic variation for understanding gene function.
Acknowledgments:
- The authors thank members of the Kruglyak lab for their comments.
- Funding was provided by the Howard Hughes Medical Institute and NIH grant R01 HG004321 (L.K.).
- E.B. is supported by a Gruss-Lipper postdoctoral fellowship from the EGL foundation.
- All authors discussed and agreed on the final version of the manuscript.
- The authors declare no competing financial interests.
Methods
- C. elegans strains and mutant alleles Strains were grown using standard culturing techniques, with the exception that a modified nematode growth medium (NGM) containing 1% agar and 0.7% agarose was used to prevent burrowing of wild isolates (Brenner 1974; Andersen et al. 2015).
- All experiments were carried out at 20oC.
- All the strains used and generated in this study are listed in Table S2.
- Some of the strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440).
- The construction of strains carrying the peel-1/zeel-1 allele from CB4856 (niDf9) was performed by backcross following a PCR product specific to the N2 allele amplified using the following primers: FW GCAGAGGAGGCAAAGGTGACTA; RV.
AGCACGTGTAGGCAGAAGTCAT.
- Introgression of a Chr. V genetic marker into DL238 We introgressed the fog-2 (q71) allele from the N2 background into DL238 by performing eight consecutive rounds of backcross and selection for the feminization of the germline (fog) phenotype (Schedl and Kimble 1988).the authors.the authors.
- Since the peel-1/zeel-1 element is active in N2 but not in DL238, the authors performed the backcross using DL238 males and feminized hermaphrodites.
- The use of DL238 males avoided the fixation of the peel-1/zeel-1 element on Chr. I because DL238 worms do not carry the PEEL-1 toxin in their sperm.
- The fixation of the N2 haplotype on Chr. III in the introgression strain could not be caused a paternal-effect toxin.
- The introgressed marker, fog-2(q71), is required for spermatogenesis in hermaphrodites but not in males, and the resulting strain must reproduce by outcrossing.
Short read sequencing
- The authors extracted genomic DNA (gDNA) using the DNeasy Blood & Tissue kit .
- The authors prepared sequencing libraries using the Nextera protocol .
- The authors followed the standard protocol with the following exception: they performed agarose size-selection of the Nextera libraries, extracting a ~500 bp band.
- Libraries were quantified using the Qubit HS kit and sequenced using 300bp paired-end V3 kits on a Miseq desktop sequencer at 12 pM.
Variant calling in DL238
- Automated preprocessing, alignment and variant calling were done using bcbio-nextgen (ver. 0.9.9) (https://bcbio-nextgen.readthedocs.io/).
- Short reads from DL238 were aligned to the WBcel235 build of the reference N2 genome.
- Variant calling was performed with four different software packages: GATK HaplotypeCaller (McKenna et al. 2010), Platypus (Rimmer et al. 2014), Freebayes (Garrison and Marth 2012) and Varscan (Koboldt et al. 2012).
- Variants identified by fewer than three of the callers were filtered out, resulting in 239,131 SNVs between DL238 and.
N2.
- Genotyping of the DL238 isolate and the DL238 Chr. V introgression strain Analyses were performed using the R Project for Statistical Genetics (https://www.r-project.org/).
- To reduce the number of spurious SNVs, the authors restricted their analysis to SNVs for which all DL238 reads supported the DL238 allele when aligning to DL238, and no reads supported the N2 allele when aligning to N2.
- Next morning, gravid hermaphrodites were allowed to lay eggs for 4-8 hours.
- Embryonic lethality in the progeny of mating hermaphrodites was scored similarly, but L4 hermaphrodites were transferred together with males to a new plate, and their eggs were laid and collected in the presence of these males to guarantee continuous mating.
- Visual inspection of DL238 short read alignments in the homozygous region revealed that pha-1 and sup-35 were very likely missing in DL238.
Microscopy
- Larvae were transferred to a 3% agarose pad and visualized under bright field using a Nikon Eclipse 90i microscope equipped with a Photometrics CoolSNAP HQ2 CCD camera.
- Multiple sequence alignments were visualized using Geneious ver. 10 (restricted free version) (https://www.geneious.com/).
- In contrast, even null variants in sup-36 or sup-37, which are unlinked to sup-35/pha-1, are predicted to only reduce the embryonic lethality from 25% to 18.75% if they are recessive.
- Furthermore, in a backcross of F1 males to QX2327 hermaphrodites, all of the F2 progeny inherit at least one functioning copy of sup-36 (or sup-37) from the QX2327 parent, and the lethality isnāt expected to be reduced at all.
- For these reasons, and given the sample sizes in their screening, the authors cannot rule out the presence of hypomorphic variants weakly affecting sup-35, or even strongly affecting sup-36 and sup-37, in some of the wild isolates tested.
Validation of chimeric fusion
- To validate the large deletion leading to the fusion of sup-35 and the Y48A6C.1 pseudogene, the authors designed primers that flanked the deletion: FW-del: GATCACGTGAGACAGGAAAAG and RV- del: CCCTTCAAAAGCACACCAAC.
- This primer pair amplified the expected 1000 bp band in the wild isolate ED3012, which carries the deletion, but not in the reference N2 (fig. S8C).
- As a positive control, the authors amplified the pha-1 locus using primers FW-pha-1: CCGTTTTCATCACGTTGCTCGA and RV-pha-1: TGTCGCGCACTACTGAATCAGA.
- To confirm whether the chimeric fusion sup-35/Y48A6C.1 is expressed, the authors performed reverse transcription (RT) PCR (fig. S8D).
- Total RNA was isolated from mixed stage N2 and ED3012 populations using the RNeasy kit , and cDNA was prepared using the SuperScript III Reverse Transcriptase kit (Thermo Fisher Scientific).
TTTTTCGCTTTCCAAACTGG, RV1: GCGAGCAACTCTTTCTCGAT, RV2:
- The FW1-RV1 primer pair amplifies exclusively the spliced cDNA of wild type sup-35, and the FW1-RV2 primer pair amplifies exclusively the spliced cDNA of the sup-35/Y48A6C.1 chimeric fusion.
- The authors then used blastn (Altschul et al. 1990) to search for scaffolds that had homology to sup- 35, pha-1, and genes in their vicinity.
- Moreover, the region of interest contained several repetitive elements.
- Finally, DL238 and QX1211 Illumina short reads were re-aligned to the assembled haplotypes and visually inspected to discard errors introduced by the assemblers.
Multiple sequence alignment
- To study the genomic architecture and evolution of the sup-35/pha-1 element, the authors recovered the sequence at the sup-35/pha-1 locus in additional Caenorhabditis species.
- Hmt-1 is a predicted transmembrane ABC transporter, and Y47D3A.29 encodes the catalytic subunit of DNA polymerase alpha.
- Y48A6C.4, a predicted ortholog of S. cerevisiae IPI1, is located between hmt-1 and Y47D3A.29 in all sequenced Caenorhabditis.
Phylogenetic tree
- The coding sequence of Y48A6C.4 was recovered in the different C. elegans isolates and other Caenorhabditis species.
- The authors then assembled the cDNA sequences of Y48A6C.4 in each isolate.
- To that end, the authors first aligned the sequence around the start and end positions of each exon to the alternative reference using blast (Altschul et al. 1990).
- To create a gene tree, the cDNA sequences were in-silico translated, and the protein sequences were aligned using MAFFT (Katoh and Standley 2013).
- The general time reversible (GTR) substitution model with gamma distributed rate variation was used as it was found to be the best fit (by minimizing the BIC criterion) using jModelTest2 (Darriba et al. 2012).
Did you find this useful? Give us your feedback
References
323Ā citations
"A maternal-effect genetic incompati..." refers background in this paper
...Selfish elements are predicted to spread in natural populations (Hurst and Werren 2001; Werren 2011), and consequently, there is significant interest in using synthetic forms of such elements to drive population replacement of pathogen vectors in the wild (Chen et al. 2007; Hammond et al. 2015)....
[...]
277Ā citations
272Ā citations
"A maternal-effect genetic incompati..." refers background or methods in this paper
...Global variation in the activity of the sup-35/pha-1 element We examined the sequences of sup-35 and pha-1 in 152 C. elegans wild isolates that represented unique isotypes (Cook et al. 2016) in the Caenorhabditis elegans Natural Diversity Resource (Cook et al. 2017)....
[...]
...ā¦element in these isolates, we de novo assembled the genomes of DL238 and QX1211 using a combination of our and previously published Illumina short reads (vanSchendel et al. 2015; Cook et al. 2017), followed by targeted Sanger sequencing to resolve repetitive regions and confirm scaffolds....
[...]
225Ā citations
209Ā citations