scispace - formally typeset
Search or ask a question
Journal ArticleDOI

A Novel in Vivo Bioassay for (Xeno-)estrogens Using Transgenic Zebrafish

TL;DR: Exposure to estradiol (E2) during juvenile stages of the transgenic zebrafish revealed the period of gonad differentiation to be the most responsive early life stage.
Abstract: Adverse trends in the reproductive health of male fish, including testis abnormalities and intersex gonads, have been increasingly reported over recent years. These effects have been associated with the exposure of fish to natural, synthetic, and xenobiotic estrogens present in the aquatic environment. A novel in vivo test system using transgenic zebrafish has been developed to rapidly determine the effects of estrogenic chemicals on critical life stages and sensitive target organs in the fish. In the transgenic zebrafish, an estrogen binding sequence linked to a TATA box and luciferase reporter gene was stably introduced. Binding of a substance to endogenous estrogen receptors (ER) and the subsequent transactivation of the ER result in luciferase gene induction that is easily measured in tissue lysates. Exposure to estradiol (E2) during juvenile stages of the transgenic zebrafish revealed the period of gonad differentiation to be the most responsive early life stage. In adult male transgenic zebrafish, t...

Summary (1 min read)

Introduction

  • Endocrine disruption is an issue that has raised public concern and is on the political and research agenda of governments worldwide.
  • Reports of chemicals in the environment that can mimic the actions of endogenous estrogens, thereby disturbing normal endocrine functions and causing male reproductive dysfunction in humans and wildlife (reviewed in refs 1-3), are increasing.
  • As an alternative, simpler screening methods such as in vitro reporter gene assays have been developed, allowing large-scale screening of chemicals (reviewed in ref 8).
  • Using transgenic reporter zebrafish, the direct effects of estrogenic chemicals on estrogen-sensitive tissues can be readily determined during various stages of sexual development.
  • § National Institute for Coastal and Marine Management.

Experimental Section

  • To generate transgenic zebrafish, zebrafish embryos were microinjected with 15 pg of the supercoiled DNA construct pEREtata-Luc (11) prior to first cleavage essentially according to Stuart et al. (12).
  • This line, deemed 1.31, showed 13% germ-line transmission of the luciferase gene from F0 to F1 generation.
  • For fish older than 21 dpf, 3-4 transgenic fish were exposed per group.
  • To isolate zfER-R, degenerate primers were chosen with homology to other fish ER-R sequences: upstream C-domain DNA binding region primer HYGVW (CAT/CTAT/CGGA/T/G/CGTA/G/C/.
  • CDNA was synthesized using 1 µg of RNA per reaction using the Superscript cDNA synthesis kit (Gibco B. R.L).

Results and Discussion

  • The authors developed transgenic zebrafish stably expressing pEREtata-Luc, an estrogen responsive luciferase reporter gene regulated by three estrogen response elements (ERE) upstream from a TATA box.
  • ZfER-R mRNA was detected at all stages tested in the developing embryo and fry, though the expression is highest late in sexual differentiating stages (35 dpf) .
  • In control adult transgenic females of 3-6 months of age, however, background levels of luciferase in liver and ovaries were high, reaching approximately the same level as liver in E2 exposed males.
  • To gain further insight in the possible significance of the testicular estrogen receptors, the authors characterized the sensitivity of the transgenic testis to estradiol.
  • Further studies will also be carried out to compare the usefulness of the transgenic zebrafish assay with another widely used biomarker for estrogenic effects in fish, namely the induction of the estrogen-regulated liver protein vitellogenin (26).

Acknowledgments

  • The authors thank Prof. Dr. J. Koeman for his critical appraisal of the manuscript.
  • The Dutch Ministry of Transport, Public Works and Water Management (RWS/RIKZ), Technology Foundation (STW), and the European Community (Environment and Climate Program) financially supported this study.
  • J. Legler was supported by a Natural Sciences and Engineering Research Council of Canada scholarship.

Did you find this useful? Give us your feedback

Figures (4)

Content maybe subject to copyright    Report

VU Research Portal
A novel in bioassay for (xeno-)estrogens using transgenic zebrafish
Legler, J.; Broekhof, J.L.M.; Brouwer, A.; Lanser, P.H.; Murk, A.J.; van der Saag, P.T.;
Vethaak, A.D.; Wester, P.; Zivkovic, D.; van der Burg, B.
published in
Environmental Science and Technology
2000
DOI (link to publisher)
10.1021/es0000605
document version
Publisher's PDF, also known as Version of record
Link to publication in VU Research Portal
citation for published version (APA)
Legler, J., Broekhof, J. L. M., Brouwer, A., Lanser, P. H., Murk, A. J., van der Saag, P. T., Vethaak, A. D.,
Wester, P., Zivkovic, D., & van der Burg, B. (2000). A novel in bioassay for (xeno-)estrogens using transgenic
zebrafish. Environmental Science and Technology, 34(20), 4439-4444. https://doi.org/10.1021/es0000605
General rights
Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners
and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.
• Users may download and print one copy of any publication from the public portal for the purpose of private study or research.
• You may not further distribute the material or use it for any profit-making activity or commercial gain
• You may freely distribute the URL identifying the publication in the public portal ?
Take down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
E-mail address:
vuresearchportal.ub@vu.nl
Download date: 10. Aug. 2022

A Novel in Vivo Bioassay for
(Xeno-)estrogens Using Transgenic
Zebrafish
JULIETTE LEGLER,
†,‡
JOSEÄ L. M. BROEKHOF,
ABRAHAM BROUWER,
PETER H. LANSER,
ALBERTINKA J. MURK,
PAUL T. VAN DER SAAG,
A. DICK VETHAAK,
§
PIET WESTER,
#
DANICA ZIVKOVIC,
AND
BART VAN DER BURG*
,‡
Hubrecht Laboratory, Netherlands Institute for Developmental
Biology, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands,
Division of Toxicology, Wageningen University and Research
Centre, P.O. Box 8000, 6700 EA Wageningen, The Netherlands,
Ministry of Transport, Public Works and Water Management,
National Institute for Coastal and Marine Management,
P.O. Box 8039, 4330 EA Middelburg, The Netherlands, and
National Institute of Public Health and the Environment,
P.O. Box 1, 3720 BA Bilthoven, The Netherlands
Adverse trends in the reproductive health of male fish,
including testis abnormalities and intersex gonads, have
been increasingly reported over recent years. These effects
have been associated with the exposure of fish to
natural, synthetic, and xenobiotic estrogens present in the
aquatic environment. A novel in vivo test system using
transgeniczebrafishhasbeendevelopedtorapidlydetermine
the effects of estrogenic chemicals on critical life
stages and sensitive target organs in the fish. In the
transgenic zebrafish, an estrogen binding sequence linked
to a TATA box and luciferase reporter gene was stably
introduced. Binding of a substance to endogenous estrogen
receptors (ER) and the subsequent transactivation of the
ERresult inluciferase geneinductionthatis easilymeasured
in tissue lysates. Exposure to estradiol (E2) during juvenile
stages of the transgenic zebrafish revealed the period
of gonad differentiation to be the most responsive early
life stage. In adult male transgenic zebrafish, the testis was
the most sensitive and responsive target tissue to
estrogens. Partial sequences of zebrafish estrogen receptor
subtypes R and β were cloned for the first time and
were found to be differentially expressed in developing
fish and tissues of adult male zebrafish. The transgenic
zebrafish assay is a promising new tool to rapidly determine
the estrogenic potency of chemicals
in vivo.
Introduction
Endocrine disruption is an issue that has raised public
concern and is on the political and research agenda of
governments worldwide. Reports of chemicals in the envi-
ronmentthatcanmimictheactionsofendogenousestrogens,
thereby disturbingnormal endocrinefunctionsand causing
male reproductive dysfunction in humans and wildlife
(reviewedinrefs1-3),areincreasing.Inwildfishpopulations,
intersex(thesimultaneouspresenceofbothmaleandfemale
gonadal characteristics) and testis abnormalities have been
found in a high proportion of male fish sampled in rivers,
estuaries,and coastalwaters(4-6).Thesefeminizingeffects
have beenassociatedwith exposureto environmentallevels
of natural, synthetic, and xenobiotic chemicals (xeno-
estrogens) in the aquatic environment. Natural estrogens
include the female hormones estradiol, estrone, and estriol.
Synthetic estrogensare pharmaceuticalchemicals designed
to mimic the action of natural estrogens, such as the birth
control pill component ethinylestradiol as well as diethyl-
stilbestrol.Xeno-estrogens canbedefinedasenvironmental
and industrialpollutants that arenot designed tobe usedas
estrogensbutneverthelesscanevokeeffectsviatheestrogen
receptor signal transduction pathway. Laboratory exposure
ofmalefish to(xeno-)estrogenshasresultedinthe synthesis
ofhighlevelsoftheestrogen-inducibleyolkprecursorprotein
vitellogenin(VTG)aswellasinhibitedtesticulargrowth,testis
abnormalities, and formation of intersex gonads (reviewed
in ref 7).
Regulationsaimedatdeterminingasubstance’spotential
to disrupt endocrine systems have proven to be extremely
difficult because estrogenic substances often have very
different chemical structures, hampering their analysis and
risk assessment on a structural basis. Tests to determine
estrogenic effects on laboratory animals are available but
arelaborious,time-consuming,costly,andmayrequirelarge
amounts of animals. As an alternative, simpler screening
methods such as in vitro reporter gene assays have been
developed, allowing large-scale screening of chemicals
(reviewed in ref 8). These assays make use of the fact that
thereceptorforestrogensisatranscriptionfactorthatinduces
transcription of target genes after binding to specific DNA
sequences in their promoter. However, major drawbacks of
such cell lines are, compared to in vivo measurements in
animals, that important aspects of in vivo functioning such
as metabolic conversion and breakdown can be missed.
Moreover, no assessment can be made of the vulnerability
of critical life stages, such as developing embryos, to the
hormonal disrupting compounds.
With thisin mind,wehave developeda noveltest system
for (xeno-)estrogens using zebrafish in which an estrogen
responsive reporter gene has been stably introduced. Using
transgenicreporterzebrafish, thedirecteffectsofestrogenic
chemicals on estrogen-sensitive tissues can be readily
determined during various stages of sexual development.
Because of the large number and rapid development of
offspring, transgenic zebrafish can combine the advantages
of in vitro and in vivo systems to provide a rapid and simple
in vivomodelto screenfor hormonallyactive substances.In
addition,zebrafishgeneticsandearlydevelopmenthavebeen
widely studied (9), and it is a recommended freshwater fish
species for toxicity testing (10). Using these transgenic fish,
weshowreportergeneinductioninvivoby(xeno-)estrogens
following short term exposure, demonstrating the presence
of highly responsive estrogen receptors in sexually dif-
ferentiating juvenile fish. Of the wide range of organs tested
in adult male fish, the reproductive organs appear to be the
main target tissue for estrogens.
* Corresponding authorphone: 31302121923;fax: 31302516464;
e-mail: bvdb@niob.knaw.nl.
Wageningen University and Research Centre.
Netherlands Institute for Developmental Biology.
§
National Institute for Coastal and Marine Management.
#
National Institute of Public Health and the Environment.
Environ. Sci. Technol.
2000,
34,
4439-4444
10.1021/es0000605 CCC: $19.00 2000 American Chemical Society VOL. 34, NO. 20, 2000 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
4439
Published on Web 09/08/2000

Experimental Section
Generation of Transgenic Zebrafish. Zebrafish were main-
tained at 27 °C on a 14 h light/10 h dark photoperiod and
were fed brine shrimp Artemia salinas four times daily. To
generate transgenic zebrafish, zebrafish embryos were mi-
croinjected with 15 pg of the supercoiled DNA construct
pEREtata-Luc(11)priortofirst cleavageessentiallyaccording
toStuartetal.(12).Intotal,about1600embryoswereinjected.
At24hpostfertilization(hpf),940(56%)ofembryossurvived
and were individually tested for luciferase expression by
immersionin200µLofanontoxicluciferinsubstratesolution
(20 mM tricine, 1 mM (MgCO)
4
MgOH
2
-5H
2
O, 2.67 mM
MgSO
4
,0.1mMEDTA,270µMcoenzymeA,470µMluciferin,
530µMATP,pH7.8))in96-wellplates.Embryoswereassayed
for luciferase activity in a scintillation counter (Top Count,
Packard). Embryos with luciferase expression (about 500
embryos or 55% of the survivors) were selected and reared
to sexual maturity (approximately 3 months). Potential
foundertransgenicfishwere crossedwithwild-typezebrafish.
F
1
offspring at 24-48 hpf were pooled in eppendorf tubes
(about 60 embryos per tube) and lysed overnight at 55 °Cin
500 µL lysis buffer containing 100 mM TrisHCl (pH 8.5), 5
mM EDTA, 0.2% SDS, 200 mM NaCl, and 100 µg/mL
proteinase K. Genomic DNA was extracted by addition of
500 µLisoproponal, mixingand centrifugationat 14000rpm
for10 min.DNAwasdissolvedin 200µLofTE buffer(10mM
Tris-Cl, 1 mM EDTA (pH 7.5)). PCR was performed in a
Biometra PCR on 1 µL DNA samples using primers within
the luciferase gene (upstream primer GGTCCTATGATTAT-
GTCCGG and downstream primer GGCCTTTATGAGGAT-
CTCTC). The following conditions were used for 32 PCR
cycles: denaturationat95°Cfor5min,annealingat56°,and
extension at 72 °C for 1 min. Offspring of a total of 142 adult
fishwere analyzed,ofwhich42wereidentified astransgenic
founders () 30% germ-line transmission). Confirmation of
stable integration was carried out by performing Southern
blots on genomic DNA. Of the 42 transgenic founders, two
independent lines were identified with similar inducible
luciferase activity following 48-h exposure of 4-5 week old
offspring to 1000 nM E2. All studies presented here were
carried out with one line with the highest expression of
luciferase. This line, deemed 1.31, showed 13% germ-line
transmission of theluciferase gene fromF
0
to F
1
generation.
IntheF
2
andF
3
generationsobtainedbycrossingtransgenics
with wild-type zebrafish, 50% of offspring were transgenic,
demonstratingMendelianinheritanceoftheluciferasegene.
Exposure Studies. Exposure studies with transgenic
zebrafish were carried out with heterozygousF2 en F3 adult
(3-6 months of age, weight range 500-1000 mg) and F3
juvenile (<6 weeks of age) fish of the highly expressing
transgenic 1.31 line. Fish were exposed to ligands or solvent
controls in dimethyl sulfoxide (DMSO) or ethanol not
exceeding 0.01% via the water phase in glass Petri dishes or
aquariafor48or96hwithdaily renewal.Following sacrifice,
tissues weredissectedfrom adultfish. Juvenilefish lessthan
28 days post fertilization (dpf) in age were pooled. Juvenile
fisholderthan21 dpfweresampledindividually.Fish(tissues)
were lysed in 500 µL Triton-lysis buffer (pH 7.8) containing
1% Triton X-100, 25 mM glycylglycin, 15 mM MgSO4, 4 mM
EGTA, and 1 mM DTT and frozen at -80 °C. Samples were
thawedonice,homogenizedwithanEppendorfmicropestle,
and centrifuged (15 min, 14 000 rpm at 4 °C). Luciferase
activity was assayed on duplicate samples of 25 µL using a
luminometer (LUMAC) with automatic injection of 100 µL
luciferine substrate solution containing 33 mM DTT ac-
cordingtomanufacturer’sspecifications. Proteincorrection
was carried out according to the method of Bradford (13).
For fish older than21 dpf, 3-4 transgenic fish wereexposed
per group. Experiments were repeated at least twice.
ERIsolation.ToisolatezebrafishER(zfER)subtypes,total
RNAwasisolatedfromnonexposedfemalegonadsusingacid
guanidiumthiocyantate-phenol-chloroformextraction.Poly-
(A)+ RNA was isolated by oligo(dT) microbeads (Miltenyi
Biotec). Random primed double-stranded cDNA was syn-
thesized usinga cDNAsynthesiskit (GibcoB.R.L). Toisolate
zfER-R, degenerate primers were chosen with homology to
otherfishER-R sequences: upstreamC-domainDNAbinding
regionprimerHYGVW(CAT/CTAT/CGGA/T/G/CGTA/G/C/
TTGG) and downstream E-domain ligand binding region
primer I/MKCKNK (TTA/GTTT/CTTA/GCAT/CTTCAT). A
second set of degenerate primers was designed for nested
PCR (upstream primer VGMMKG (GTA/T/G/CGGA/G/T/
CATGATGAAA/GGG) and downstream primer MSNKGM
(CATA/G/T/CCCT/CTTA/GCTCAT)) resulting in an 840
nucleotide sequence with highest homology (84%) with
channel catfish ER-R (14). To isolate zfER-β, degenerate
primersdescribedelsewheretoisolateaputativeER-β inthe
Japanese eel (15) encompassing the C and E domain were
used (upstream primer: GACTAC/TATGTGC/TCCC/TGC-
GAC and downstream primer: GTGAC/GCGTCCAGCATCTC-
CAG).Asecondsetofnesteddegenerateprimers(KCYEVGM
(AAATGTTATGAAGTT/C/A/GGGA/C/T/GATG) and KGME-
HLS (ACTAAGATGTTCGATA/G/C/TCCT/CTT)) were used,
resulting in an 857 nucleotide fragment showing highest
homology(80%)withtheJapaneseeelputativeER-β isoform
(15). The nucleotide sequences of the zfERR and -β partial
fragmentscanbeaccessedintheEMBLNucleotideSequence
Database (Accession numbers AJ275910 and AJ275911,
respectively).
ER Distribution using RT-PCR. Using the partial zfER-R
and β sequences described above, specific primers were
designed to detect zfER-R (forward primer: GGGCGTTCT-
GTCAGGCGTAAG and reverse primer CAGGCGATCATGTG-
GACGAGT) and zfER-β (forward primer: CGTAACCCCCAAAT-
CAGAGACAGC and reverse primer: ATCCTCAGGAGTCT-
GTGGCAAACT) in cDNA prepared from RNA isolated from
developing stages of nonexposed juvenile zebrafish and
tissues from adult males. Specific primers from zebrafish
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for-
ward primer: GGCTCCTTTGGCAAAGGTCA and reverse
primer: TGGCAGGTTTCTCAAGACGG) were used as an
internalcontrol forRT-PCRreactions(16). Priortosynthesis
ofrandomprimeddouble-strandedcDNA,DNAwasremoved
from RNA samples by treating 10 µg RNA with 1 Unit RQ1
RNAse-Free DNAse (Promega) in a volume of 100 µLof
Reaction Buffer (Promega). After incubation of samples for
30 min at 37 °C, the reaction wasstopped with 25 µL of Stop
Solution (Promega) and 125 µL of a phenol:chloroform:
isoamyl alcohol (25:24:1) solution. RNA was precipitated by
adding 825 µL of 100%ethanol, mixing, and centrifuging for
30minat14 000 rpm.The RNApellet wasthen washedtwice
with 70%ethanol and dissolvedin 20µL of water.cDNA was
synthesized using 1 µg of RNA per reaction using the
Superscript cDNA synthesis kit (GibcoB. R.L). RNA samples
werefirstincubated for3minat65°C,quickly chilledonice,
and briefly centrifuged. The reverse transcriptase (RT)
reaction was carried out in a volume of 20 µL containing 1
µg RNA, 100 ng oligo(dT) primer, 5 mM dNTP mix, 0.1 mM
DTT,RT reactionbuffer,and200 unitsSuperscriptIIreverse
transcriptase (Gibco B.R.L.) for 90 min at 37 °C. Following
incubation, 30 µLwater was added tothe samples fora total
volumeof 50µLcDNA.PCRreactions werecarriedoutusing
5 µL cDNA samples in a total volume of 50 µL, containing
2.5 mM MgCl
2
, PCR reaction buffer (1X, Eurogentec), 0.4
mM each of dATP, dCTP, dGTP, and dTTP (Gibco B.R.L.),
and 1.5 units of TAQ polymerase (Eurogentec). Primers for
zfERR, zfER-β, and GAPDH were used a concentration of 20
pmol per reaction. PCR reactions were carried out in a
Biometra PCR using 35 cycles of amplification for each
4440
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 34, NO. 20, 2000

reaction.The followingconditionswere used: denaturation
at 95 °C for 5 min, annealing at 53 °C (zfERR), 68 °C (zfERβ),
or 58 °C (GAPDH), and extension at 72 °C for 1 min. As a
positive control, a sample of zebrafish liver cDNAgiving the
sameamountof productas10 000 copiesofspecificplasmid
DNA was included in the amplification reaction. No PCR
products were found in RNA or water controls.
Immunohistochemistry.Adultmaletransgenicandwild-
typefishwerefixedin4%paraformaldehydecontaining 10%
EDTA and embedded in paraffin. Immunohistochemistry
was performed on 5 µm sections following antigen retrieval
by heating sections four times for 5 min in 10 mM citrate
buffer, pH 6. Following blocking with 20% swine serum,
sections were incubated with a 1:200 dilution of an affinity
purifiedrabbitpolyclonalanti-luciferase(Promega),followed
by avidin-conjugated swine anti-rabbit Ig, and avidin-
peroxidase with a biotin bridge. Reactivity was visualized
using diaminobenzidine + H
2
O
2
(Sigma).
Results and Discussion
We developed transgenic zebrafish stably expressing pERE-
tata-Luc, an estrogen responsive luciferase reporter gene
regulated by three estrogen response elements (ERE) up-
stream from a TATA box. The pEREtata-Luc construct and
activationbyestradiolinvitrohavebeendescribedelsewhere
(11). Since enhancer regions other than the ERE are absent
in this construct, it very specifically responds to estrogen
receptor(ER)activation.Compoundsactivatingendogenous
estrogen receptors in target cells leadto receptor binding to
the EREs and consequently activate transcription of the
luciferasegene.Followingshorttermexposureoftransgenic
zebrafish to (xeno-)estrogens, the production of luciferase
proteincan beeasilyassayedbypreparingtissue lysatesand
measuring light activity following addition of the enzyme
substrate luciferin.
Estrogen Receptor Gene Activity Is Developmentally
RegulatedinTransgenicZebrafish. Expressionofluciferase
in transgenic zebrafish was determined in developing life
stagesfollowing48hexposureinwaterto1000nME2(Figure
1a). Range finding toxicity tests carried out prior to these
experiments under the same exposure periods established
thatthisconcentrationdidnotcauseacutetoxicity(datanot
shown).In embryoslessthan28days postfertilization(dpf),
luciferaseactivitycouldbeeasilyassayedinlysatesofpooled
embryos. In fry between 28 and 35 dpf of approximately 1
cm length, luciferase activity was assayed in lysates of
individualembryos.Luciferaseinductionincreasedwithage
and stage of gonad differentiation, ranging from 4-fold in 1
day old embryos (1 dpf) to 100 to 300-fold induction in 35
dpfjuveniletransgenicfry relativetovehicle-exposedcontrols
(Figure1a).Gonaddifferentiationinthezebrafishcommences
at about 2 weeks of age in zebrafish (17). Clear evidence of
femaleovarianandmaletesticulargonaddifferentiationhas
been observed in fry at about 28 dpf (Wester, unpublished
results). Our results indicate that transgene induction cor-
relates with the sexual development of the zebrafish.
As transgene expression is regulated by the ER, we
determined the timing of expression and distribution of the
zebrafish ER (zfER). We isolated specific fragments of ER
subtypes R and β in zebrafish ovarian cDNA and designed
specificprimersforsemiquantitativePCR(see Experimental
Section). It should be noted that the PCR reactions with
primers for zfER-β were more efficient than with the zfER-R
primers(Figure1b,control),indicatingthattheabsolutelevels
ofzfER-R mRNAmay beunderestimated.zfER-R mRNA was
detected at all stages tested in the developing embryo and
fry, though the expression is highest late in sexual dif-
ferentiating stages (35 dpf) (Figure 1b). zfER-β mRNA was
also detected at all stages, though was low at 14 dpf, the
stage of the onset of gonad differentiation. From 28 to 35
dpf, ERβ mRNA expression increased, coinciding with high
luciferase induction (Figure 1a). Our results suggest that
estrogenreceptorsareveryactiveduringsexualdevelopment.
Therefore, the period of gonad differentiation may be very
sensitive to disruption by estrogenic compounds.
LigandSensitivity ofReporterGene InductioninJuvenile
Fish.TodeterminethesensitivityofjuvenilefishtoE2, dose-
response studies were carried out with transgenic 35 dpf fry
(Figure 2a). A nominal concentration of 0.1 nM E2 resulted
in 7 ( 4-fold induction following 96 h exposure (Figure 2a),
indicating that the juvenile fish undergoing sexual dif-
ferentiation maybesensitive toE2. Theconcentrationof 0.1
nM E2 is a realistic concentration that may be encountered
in aquatic systems in the environment (18). Some natural,
synthetic,andxenobioticestrogenswerealsotestedfor their
potentialtoinduceluciferaseinjuveniletransgeniczebrafish.
Following 48h exposureto anominal concentration of1000
nM, the natural estrogens 17R-estradiol and estrone as well
as the synthetic estrogens diethylstilbestrol and ethinylestra-
diolinducedluciferaseat levelsranging from70to300times
that of nonexposed controls (Figure 2b). Importantly, the
principle DDT isomer o,p-DDT, a known environmental
estrogen in mammals (19) and fish (20), also induced
FIGURE 1. (A) Luciferase activity in developing life stages of
transgeniczebrafishexposedfor 48h to1000nM17β-estradiol(fold
induction in light units/µg protein relative to vehicle exposed
controls) and (B) stage-related expression of zebrafish estrogen
receptor type ER-r and ER-β mRNA in nonexposed developing life
stages (dpf ) days post fertilization). “Control” lane shows PCR
product from liver cDNA (10000 copies) amplified under the same
conditions. In Figure 1(A), age given indicates age at initiation of
exposure. Bars show the luciferase induction in pools of embryos
from 1 to 21 dpf: 1 dpf:
n
) 20; 7 dpf:
n
) 10, 14 dpf:
n
) 10; 21
dpf:
n
) 5.Forembryosof28and35dpf,barsshowmeanluciferase
induction in individual fry (
n
) 4); error bars show standard error
of the mean.
VOL. 34, NO. 20, 2000 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
4441

luciferaseactivitytoalevelaround40timesthatofthesolvent
control (Figure 2b). It should be noted that relatively high
variation wasfound inthe responseof individualtransgenic
fish to estrogens. The outbred genetic background of these
heterozygoustransgenicfishmaycontributetothevariation
in estrogenicresponse observedsince differencesin genetic
backgroundmaygreatlyinfluencetheresponsetoestrogens
(20). Inaddition,both malesand femalesundergoing gonad
differentiation were assayed together at this stage, as their
phenotypic sex is not yet apparent. It was found that males
andfemalesresponddifferentlyto exogenousestrogens (see
below).
Estrogen Reporter Gene Induction Is Highly Tissue
Specific. To determine the tissue distribution of transgene
expression,westudiedtheresponseofadult,sexuallymature,
male transgeniczebrafish toestrogen treatment(Figure 3a).
Surprisingly, dramatically high transgene expression of up
to1000-foldwasobservedinthetestisfollowing48hexposure
to1000nME2 (Figure3a).Inaddition,luciferaseactivitywas
also prominent in liver (30-fold) and slightly induced in the
scales (4-fold) and muscle (3.6-fold). Slight or no significant
luciferase induction was found in heart, brain, eye, or bone
tissue.Incontrolmalesexposedtovehicle(DMSOorethanol)
alone, luciferase was not induced, indicating extremely low
levels of endogenous estrogens. In control adult transgenic
females of 3-6 months of age, however, background levels
of luciferase in liver and ovaries were high, reaching
approximately the same level as liver in E2 exposed males.
High background levels of luciferase in transgenic females
are likely due to high levels of circulating endogenous
estrogens. Exposure to E2 in adult females did not result in
luciferase induction above this elevated background level
(data not shown).
Analysis of the zfER mRNA expression pattern in various
tissues of the adult male zebrafish confirmed the presence
of both zfER-R and ER-β (Figure 3b) in tissues showing high
luciferaseinductionsuchastestisandliver(Figure3a).Tissues
that did not show high luciferase induction such as brain,
bone, digestive tract, and eyes, however, expressed varying
amounts of both receptors (Figure 3b). Differences in the
expression of the internal control GAPDH do not reflect
differences in the amount of tissue amplified per reaction.
GAPDH is differentially expressed in various organs, with
lower expression in the brain. We therefore did not correct
forGAPDHvariationthroughoutthesamples.Thedifferences
inERmRNAexpressionandactivationofluciferasebetween
various tissues may be explained by differences in levels of
receptor protein or coactivators necessary for ER-mediated
transcriptionalactivation.Itisalsopossiblethattheluciferase
response toE2in sometissueswas limiteddue tothetissue-
specific bioavailability of the ligand, perhaps partly due to
the short exposure period.
Ligand SpecificityandTissue DistributionofTesticular
Reporter Gene Induction. To gain further insight in the
possible significanceofthe testicularestrogenreceptors, we
characterized the sensitivity of the transgenic testis to
estradiol. A dose-response related luciferase induction to
FIGURE2. Luciferaseactivity(foldinductioninlightunits/µgprotein
relative to vehicle exposed controls) in juvenile (35 days post
fertilization)transgeniczebrafishexposedfor96hto(A)increasing
doses of 17β-estradiol (E2) and (B) 1000 nM of the estrogenic
compounds 17r-estradiol (E2-17A), estrone (E1), diethylstilbestrol
(DES), ethinylestradiol (EE2), and o,p-DDT (DDT). Bars show mean
luciferase induction in individual fry (
n
) 3-4); error bars show
standard error of the mean.
FIGURE3. (A)Luciferaseactivityin tissuesofadultmaletransgenic
zebrafish exposed for 48 h to 1000 nM E2 (fold induction in light
units/µgproteinrelativetovehicle exposedcontrols)and(B)tissue-
related expression of zebrafish estrogen receptor type ER-r and
ER-β mRNA in nonexposed adult male zebrafish. “Control” lane
showsPCRproductfromlivercDNA (10 000copies)amplifiedunder
the same conditions.
4442
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 34, NO. 20, 2000

Citations
More filters
Journal ArticleDOI
TL;DR: It is concluded that hormones (especially 17 alpha-ethynylestradiol) and possibly also nonylphenol(ethoxylate)s are primarily responsible for these effects of feminizing effects in male fish.

529 citations


Cites methods from "A Novel in Vivo Bioassay for (Xeno-..."

  • ...The transgenic zebrafish contains a stably-transfected estrogen-receptor mediated luciferase reporter gene (identical to the reporter gene construct used in the ER-CALUX assay) and therefore the assay bridges the gap between in vitro estrogenic induction and estrogenic effects on the organism level (Legler et al., 2000)....

    [...]

Journal ArticleDOI
TL;DR: The zebrafish (Danio rerio) is now the pre-eminent vertebrate model system for clarification of the roles of specific genes and signaling pathways in development, and to fully utilize the potential of zebra fish as an animal model for understanding human development, disease, and toxicology the authors must greatly advance the knowledge on zebra Fish diseases and pathology.
Abstract: The zebrafish (Danio rerio) is now the pre-eminent vertebrate model system for clarification of the roles of specific genes and signaling pathways in development. The zebrafish genome will be completely sequenced within the next 1-2 years. Together with the substantial historical database regarding basic developmental biology, toxicology, and gene transfer, the rich foundation of molecular genetic and genomic data makes zebrafish a powerful model system for clarifying mechanisms in toxicity. In contrast to the highly advanced knowledge base on molecular developmental genetics in zebrafish, our database regarding infectious and noninfectious diseases and pathologic lesions in zebrafish lags far behind the information available on most other domestic mammalian and avian species, particularly rodents. Currently, minimal data are available regarding spontaneous neoplasm rates or spontaneous aging lesions in any of the commonly used wild-type or mutant lines of zebrafish. Therefore, to fully utilize the potential of zebrafish as an animal model for understanding human development, disease, and toxicology we must greatly advance our knowledge on zebrafish diseases and pathology.

364 citations


Cites background from "A Novel in Vivo Bioassay for (Xeno-..."

  • ...Potential for disruption of endocrine systems in the zebrafish model has been assessed with a growing list of agents (301, 522)....

    [...]

Journal ArticleDOI
TL;DR: It is demonstrated that early life stages of zebrafish are sensitive to low concentrations of E2 and provides relevant data that could be used for the adaptation of existing fish early life stage test for the in vivo testing of estrogenic compounds.

361 citations


Cites result from "A Novel in Vivo Bioassay for (Xeno-..."

  • ...This is in agreement with the study of Legler et al. (2000) who demonstrated that the estrogen receptor subtypes and are expressed very early in the development in the zebrafish (from 1 dpf) and that exposure to E2 upregulates ER-genes expression....

    [...]

Journal ArticleDOI
TL;DR: The established AR CALUX bioassay proved to excel in terms of easy cell line maintenance, high fold induction range, low minimal detection limit, and high androgen selectivity, and potential applications such as testing the androgenic or estrogenic activity of pure chemicals and pharmaceuticals and complex mixtures are discussed.

311 citations


Cites background from "A Novel in Vivo Bioassay for (Xeno-..."

  • ...This approach has been shown to be successful in generation of both in vitro (Legler et al., 1999; Lemmen et al., 2002) and in vivo (Legler et al., 2000; Lemmen et al., 2004) models for selective measurement of estrogen effects....

    [...]

  • ..., 2002) and in vivo (Legler et al., 2000; Lemmen et al., 2004) models for selective measurement of estrogen effects....

    [...]

Journal ArticleDOI
TL;DR: There are currently no in vitro or in vivo assays in fish species that are sufficiently developed to warrant recommendation for use to efficiently screen chemicals for thyroid disruption, and this chapter provides a thorough review of the available scientific literature on the thyroid system in these important vertebrate animals.
Abstract: Bony fishes represent the largest vertebrate class and are a very diverse animal group. This chapter provides a thorough review of the available scientific literature on the thyroid system in these important vertebrate animals. The molecular components of the hypothalamic-pituitarythyroid (HPT) axis in this group correspond closely to those of mammals. The thyroid tissue in the fishes is organized as diffuse follicles, with a few exceptions, rather than as an encapsulated gland as is found in most other vertebrate species. The features of this diffuse tissue in fishes are reviewed with an emphasis on feedback relationships within the HPT axis, the molecular biology of the thyroid system in fishes, and comparisons versus the thyroid systems of other vertebrate taxa. A review of the role of thyroid hormone in fish development and reproduction is included. Available information about the HPT axis in fishes is quite detailed for some species and rather limited or absent in others. This review focuses on species that have been intensively studied for their value as laboratory models in assays to investigate disruption in normal function of the thyroid system. In addition, in vitro and in vivo assay methods for screening chemicals for their potential to interfere with the thyroid system are reviewed. It is concluded that there are currently no in vitro or in vivo assays in fish species that are sufficiently developed to warrant recommendation for use to efficiently screen chemicals for thyroid disruption. Methods are available that can be used to measure thyroid hormones, although our ability to interpret the causes and implications of potential alterations in T4 or T3 levels in fishes is nonetheless limited without further research.

302 citations

References
More filters
Journal ArticleDOI
TL;DR: This assay is very reproducible and rapid with the dye binding process virtually complete in approximately 2 min with good color stability for 1 hr with little or no interference from cations such as sodium or potassium nor from carbohydrates such as sucrose.

225,085 citations

Journal ArticleDOI
TL;DR: Mechanisms underlying the disruption of the development of vital systems, such as the endocrine, reproductive, and immune systems, are discussed with reference to wildlife, laboratory animals, and humans.
Abstract: Large numbers and large quantities of endocrine-disrupting chemicals have been released into the environment since World War II. Many of these chemicals can disturb development of the endocrine system and of the organs that respond to endocrine signals in organisms indirectly exposed during prenatal and/or early postnatal life; effects of exposure during development are permanent and irreversible. The risk to the developing organism can also stem from direct exposure of the offspring after birth or hatching. In addition, transgenerational exposure can result from the exposure of the mother to a chemical at any time throughout her life before producing offspring due to persistence of endocrine-disrupting chemicals in body fat, which is mobilized during egg laying or pregnancy and lactation. Mechanisms underlying the disruption of the development of vital systems, such as the endocrine, reproductive, and immune systems, are discussed with reference to wildlife, laboratory animals, and humans.

3,323 citations

Journal ArticleDOI
TL;DR: This paper demonstrates a high incidence of intersexuality in wild populations of riverine fish (roach; Rutilus rutilus) throughout the United Kingdom and indicates that reproductive and developmental effects do result from exposure to ambient levels of chemicals present in typical British rivers.
Abstract: A number of chemicals present in the environment have been shown to mimic or antagonize the actions of steroid hormones, an issue often described as “endocrine disruption/modulation”. There is very little evidence, however, to support the hypothesis that exposure to endocrine-disrupting chemicals is a global environmental health problem. In this paper, we demonstrate a high incidence of intersexuality in wild populations of riverine fish (roach; Rutilus rutilus) throughout the United Kingdom. These reproductive disturbances are consistent with exposure to hormonally active substances and are associated with discharges from sewage treatment works that are known to contain estrogenic chemicals. This is the first documented example of a widespread sexual disruption in wild populations of any vertebrate and indicates that reproductive and developmental effects do result from exposure to ambient levels of chemicals present in typical British rivers.

1,998 citations

Journal ArticleDOI
TL;DR: In this article, a fractionation system combined with an in vitro assay for detecting estrogenic activity was developed in order to isolate and identify the major estrogenic chemicals present in seven sewage-treatment works (STW) effluents, receiving primarily domestic effluent, discharging into British rivers.
Abstract: A fractionation system, combined with an in vitro assay for detecting estrogenic activity, was developed in order to isolate and identify the major estrogenic chemicals present in seven sewage-treatment works (STW) effluents, receiving primarily domestic effluent, discharging into British rivers. Three sterols were isolated from estrogenic fractions of sewage extracts; these were the natural hormones 17β-estradiol and estrone and the synthetic hormone 17α-ethynylestradiol. 17β-Estradiol and estrone were present in all the effluents at measured concentra tions ranging from 1 ng/L to almost 50 and 80 ng/L, respectively. The concentration of 17α-ethynylestradiol was generally below the limit of detection but was positively identified in three of the effluent samples at concentrations ranging from 0.2 to 7.0 ng/L. These data suggest that natural and synthetic hormones may be responsible for the observed induction of vitellogenin synthesis in male fish placed downstream of effluent discharges from STWs that re...

1,668 citations

Journal ArticleDOI
TL;DR: The evidence, from both laboratory and field studies, that exposure to steroid hormone mimics may impair reproductive function is reviewed and the weight of evidence for endocrine disruption in wildlife is critically assessed.
Abstract: In recent years, a number of man-made chemicals have been shown to be able to mimic endogenous hormones, and it has been hypothesized that alterations in the normal pattern of reproductive development seen in some populations of wildlife are linked with exposure to these chemicals. Of particular importance are those compounds that mimic estrogens and androgens (and their antagonists), because of their central role in reproductive function. In fact, the evidence showing that such chemicals actually do mimic (or antagonize) the action of hormones in the intact animal is limited. In only a few cases have laboratory studies shown that chemicals that mimic hormones at the molecular level (in vitro) also cause reproductive dysfunction in vivo at environmentally relevant concentrations. In addition, the reported studies on wild populations of animals are limited to a very few animal species and they have often centered on localized 'hot-spots' of chemical discharges. Nevertheless, many of these xenobiotics are persistent and accumulate in the environment, and therefore a more widespread phenomenon of endocrine disruption in wildlife is possible. This article reviews the evidence, from both laboratory and field studies, that exposure to steroid hormone mimics may impair reproductive function and critically assesses the weight of evidence for endocrine disruption in wildlife.

1,077 citations

Frequently Asked Questions (2)
Q1. What are the contributions mentioned in the paper "A novel in vivo bioassay for (xeno-)estrogens using transgenic zebrafish" ?

In this paper, a transgenic zebrafish was used to evaluate the effect of synthetic estrogens on the male reproductive organs. 

Their future studies aim at testing this hypothesis, thereby testing the validity of the transgenic zebrafish model. Further studies will also be carried out to compare the usefulness of the transgenic zebrafish assay with another widely used biomarker for estrogenic effects in fish, namely the induction of the estrogen-regulated liver protein vitellogenin ( 26 ). In conclusion, the authors have developed a new in vivo model that has the potential to rapidly determine the estrogenic mode of action of chemicals during development and further throughout sexual differentiation in fish. The transgenic zebrafish bioassay is a promising new tool in the field of environmental contaminant monitoring and risk assessment of new and existing chemicals.