scispace - formally typeset
Search or ask a question
Journal ArticleDOI

A single nucleotide polymorphism in the promoter region of river buffalo stearoyl CoA desaturase gene (SCD) is associated with milk yield

TL;DR: Although such results need to be confirmed with large-scale studies in the same and other buffalo populations, they might offer useful indications for the application of MAS programmes in river buffalo and in the future they might be of great economic interest for the river buffalo dairy industry.
Abstract: An association study between the milk yield trait and the stearoyl-CoA desaturase (SCD) polymorphism (g.133A > C) in Italian Mediterranean river buffalo was carried out. A full characterization of the river buffalo SCD promoter region was presented. Genotyping information was provided and a quick method for allelic discrimination was developed. The frequency of the C allele was 0·16. Test-day (TD) records (43 510) of milk production belonging to 226 lactations of 169 buffalo cows were analysed with a mixed linear model in order to estimate the effect of g.133A > C genotype, as well as the effect of parity and calving season. The SCD genotype was significantly associated with milk yield (P = 0·02). The genotype AC showed an over-dominance effect with an average daily milk yield approximately 2 kg/d higher than CC buffaloes. Such a difference represents about 28% more milk/d. The effect of the genotype was constant across lactation stages. The contribution of SCD genotype (r(2)SCD) to the total phenotypic variance in milk yield was equal to 0·12. This report is among the first indications of genetic association between a trait of economic importance in river buffalo. Although such results need to be confirmed with large-scale studies in the same and other buffalo populations, they might offer useful indications for the application of MAS programmes in river buffalo and in the future they might be of great economic interest for the river buffalo dairy industry.

Summary (2 min read)

A single nucleotide polymorphism in the promoter region of

  • An association study between the milk yield trait and the stearoyl-CoA desaturase (SCD) polymorphism (g.133A>C) in Italian Mediterranean river buffalo was carried out.
  • The genotype AC showed an over-dominance effect with an average daily milk yield approximately 2 kg/d higher than CC buffaloes.
  • Mediterranean river buffalo, stearoyl CoA desaturase gene (SCD), milk yield, marker assisted selection, also known as Keywords.
  • Stearoyl-CoA desaturase is a microsomal enzyme which plays a key role in fatty acid metabolism.
  • Associations between polymorphisms in SCD gene and the FA composition of milk have been reported in cattle (Mele et al. 2007; Moioli et al. 2007); and, recently a polymorphism at bovine SCD locus has also been associated with daily milk yield with a constant effect of the genotype across lactation stages (Macciotta et al. 2008).

Materials and Methods

  • Sample collection and nucleic acid isolation A total of 322 buffaloes from different commercial herds located in two provinces (Salerno and Caserta) of the Campania region (Southern Italy) were considered in the study.
  • Most of the farmed buffaloes of the country are in this region of Italy.
  • DNA concentration and OD260/280 ratio of the samples were measured with the Nanodrop ND-2000C Spectrophotometer (Thermo Scientific).
  • Product specificity was confirmed by ethidium-bromide-stained 1·5% agarose gel electrophoresis.
  • The entire panel of 322 animals was genotyped for the g.133A>C SNP using a PCR-RFLP method.

Phenotypic data collection

  • For a subsample of 169 buffalo cows an association study between the SNP polymorphism and milk yield was carried out.
  • A total of 43510 test-day (TD) records for milk yield measured daily with an automatized milk recording system on 226 lactations of 169 Italian water buffalo cows of different parities (1–7) were used.
  • Data were collected in the period January 2007–September 2009 in a herd located in the province of Salerno.
  • Animals were milked twice a day with the Afifarm system (S.A.E. Afikim, Kibbutz Afikim, Israel).

Bioinformatic and statistical analysis

  • The allele frequency and Hardy-Weinberg equilibrium (χ2 test) were calculated for the larger sample of 322 buffaloes.
  • Homology searches, comparison among sequences, and multiple alignments were accomplished using DNAsis-Pro , whereas the putative transcription factor binding sites were searched by Transfact® 7.0 software.
  • Statistical significance of the SNP effect was tested against variance of cow nested within SNP genotype (Littell et al. 1998).
  • Pairwise comparisons among different levels of fixed effects included in model were performed using a Bonferroni adjusted test.
  • Finally, in order to estimate the contribution of the SCD locus to the variance of the trait, a mixed model having the same structure of (1) but with the SCD genotype treated as random was run.

Results and Discussion

  • Characterization of river buffalo SCD promoter A total of 593 bp of the river buffalo SCD promoter (EMBL acc. no. FM876222) upstream the first nucleotide of the first exon were analysed by using Transfact® 7.0 software and characterized in order to investigate the putative transcription factor binding sites that could regulate the gene expression (Fig. 1).
  • Several CCAAT/enhancer binding protein (C/EBP) were identified.
  • To support these findings, a multiple sequence alignment of the river buffalo, pig, human and mouse SCD 1/SCD 2 promoters was achieved (data not shown).
  • PPAR-γ is often referred as the ‘master regulator’ of adipogenesis because it participates in the transcriptional activation of numerous adipogenic and lipogenic genes (Paton & Ntambi, 2009).

Conclusions

  • Stearoyl-CoA desaturase genes have been intensively investigated in ruminants mainly through association studies between SNP and the fatty acid spectrum.
  • Little information is available for this species about association studies but also on the effectiveness of traditional selection schemes.
  • Lactation curves of different SCD genotype for milk yield (kg/d) Table 3.
  • This study represents one of the first indications of an association between a trait of economic importance and a candidate locus in river buffalo.
  • Cwas provided and a quick method for allelic discrimination was set up.

Did you find this useful? Give us your feedback

Content maybe subject to copyright    Report

A single nucleotide polymorphism in the promoter region of
river buffalo stearoyl CoA desaturase gene (SCD) is associated
with milk yield
Alfredo Pauciullo
1
*, Gianfranco Cosenza
1
*, Roberto Steri
2
, Angelo Coletta
3
, Antonio La Battaglia
4
,
Dino Di Berardino
1
, Nicolò P P Macciotta
2
and Luigi Ramunno
1
1
Department of Soil, Plant, Environment and Animal Production Science, University of Naples Federico II, Portici (NA), Italy
2
Department of Agricultural Sciences, University of Sassari, Sassari, Italy
3
Associazione Nazionale Allevatori Specie Bufalina, Località Centurano, Caserta, Italy
4
Comunità Montana Alto Agri, Villa DAgri di Marsicovetere (PZ), Italy
Received 27 January 2012; accepted for publication 11 May 2012; first published online 20 September 2012
An association study between the milk yield trait and the stearoyl-CoA desaturase (SCD)
polymorphism (g.133A >C) in Italian Mediterranean river buffalo was carried out. A full
characterization of the river buffalo SCD promoter region was presented. Ge notyping information
was provided and a quick method for allelic discrimination was developed. The frequency of the C
allele was 0·16. Test-day (TD) records (43510) of milk production belonging to 226 lactations of 169
buffalo cows were analysed with a mixed linear model in order to estimate the effect of g.133A > C
genotype, as well as the effect of parity and calving season. The SCD genotype was significantly
associated with milk yield (P =0·02). The genotype AC showed an over-dominance effect with an
average daily milk yield approximately 2 kg/d higher than CC buffaloes. Such a difference represents
about 28% more milk/d. The effect of the genotype was constant across lactation stages. The
contribution of SCD genotype (r
2
SCD
) to the total phenotypic variance in milk yield was equal to 0·12.
This report is among the first indications of genetic association between a trait of economic
importance in river buffalo. Although such results need to be confirmed with large-scale studies in the
same and other buffalo populations, they might offer useful indications for the application of MAS
programmes in river buffalo and in the future they might be of great economic interest for the river
buffalo dairy industry.
Keywords: Mediterranean river buffalo, stearoyl CoA desaturase gene (SCD), milk yield, marker assisted
selection.
The buffalo is a relatively young species, domesticated
approximately 5000 years ago. The little exchange of
buffaloes among countries allowed a good differentiation
among the known breeds, thus nowadays each population
has maintained its own phenotypic traits and performances
(Borghese & Mazzi, 2005). A long period of isolation and the
lack of crossbreeding allowed an evident morpho-functional
differentiation of the Mediterranean type, which has been
recognized as Mediterranean Italian breed since 2000 (D.
M. 201992 5/7/2000).
The Italian buffalo population has increased of 53·5% in
the decade 19992009 (http://www.aia.it). The reason for
this trend lies in the growing interest of farmers in buffalo
milk production (not subject to EU milk quotas), and the
increasing market demand for mozzarella PDO (Protected
Denomination of Origin Reg. EC 510/2006) cheese. Such
an increase of economic importance and size of the dairy
Buffalo industry was followed by a limited improvement of
the production level of the animals. Average milk yield per
buffalo cow is 2180±597 kg in 270 d of lactation (it was
2140 kg in the year 2000) with 8·45 and 4·59% of fat and
protein contents respectively (AIA, 2010).
Gene polymorphisms significantly associated with milk
production traits may provide useful indications for identify-
ing selection candidates with high genetic merit. In
this regard, a single nucleotide polymorphism (SNP) (EMBL
acc. no. FM876222: g.133A >C) recently reported in
the promoter region of the river buffalo stearoyl-CoA
*For correspondence; e-mail: apauciul@unina.it; giacosen@unina.
it
Journal of Dairy Research (2012) 79 429435. © Proprietors of Journal of Dairy Research 2012
doi:10.1017/S0022029912000507
429

desaturase (SCD) gene (Pauciullo et al. 2010 ) is particularly
interesting.
Stearoyl-CoA desaturase is a microsomal enzyme which
plays a key role in fatty acid metabolism. It is also known as
delta-9-desaturase because it catalyses the introduction of
the first cis-double bond in the Δ9 position in a large
spectrum of fatty acyl-CoA substrates (Ntambi, 1999). The
stearoyl-CoA desaturase (SCD) locus has been suggested as a
candidate gene affecting milk fatty acid (FA) profile (Gautier
et al. 2006). In river buffalo, the g.133A > C SNP creates a
new consensus site for the SP1 binding site and a preliminary
association study with the milk FA content showed a
significant effect on the desaturation index (Pauciullo et al.
2010). In sheep, no significant associations have been
reported (García-Fernández et al. 2010), even though this
gene is a strong positional and functional candidate for a
quantitative trait locus (QTL) detected on chromosome 22
for the conjugated linoleic acid (CLA)/vaccenic ratio in
milk (Carta et al. 2008). Associations between polymorph-
isms in SCD gene and the FA composition of milk have
been reported in cattle (Mele et al. 2007; Moioli et al. 2007);
and, recently a polymor phism at bovine SCD locus has also
been associated with daily milk yield with a constant effect
of the genotype across lactation stages (Macciotta et al.
2008). Therefore, SCD locus has been proposed in gene-
assisted selection programmes for the improvement of milk
production traits in dairy cattle (Macciotta et al. 2008).
The aim of this study was to investigate the occurrence of
the above mentioned polymorphism at the SCD locus in the
Italian Mediterranean river buffalo and to test possible
associations with milk yield.
Materials and Methods
Sample collection and nucleic acid isolation
A total of 322 buffaloes from different commercial herds
located in two provinces (Salerno and Caserta) of the
Campania region (Southern Italy) were considered in the
study. Most of the farmed buffaloes of the country are in this
region of Italy.
Biological samples of these animals were used to extract
DNA from blood, using the procedure described by Gossens
& Kan ( 1981).
DNA concentration and OD
260/280
ratio of the samples
were measured with the Nanodrop ND-2000C Spectropho-
tometer (Thermo Scientific).
PCR conditions and genotyping by TaqI PCR-RFLP
PCR reaction mixture and thermal conditions for the
amplification of the DNA fragment spanning from
593 bp of 5 flanking region to + 159 bp of exon 1
(752 bp) of the river buffalo SCD gene were accomplished
by using the following primer: SCD AF (5-GAAACTTCCCC-
AGTGCC-3) and SCD AR (5-CAAGTGGGCCGGCATC-3),
according to Pauciullo et al. (2010). Product specificity was
confirmed by ethidium-bromide-stained 1·5% agarose gel
electrophoresis.
The entire panel of 322 animals was genotyped for the
g.133A > C SNP using a PCR-RFLP method. Digestion of
17 μl of each PCR amplification was accomplished
with 10 U of TaqI endonuclease (T#CGA) (Promega) for 5 h
at 65 °C. The digestion products were analysed directly by
electrophoresis in 1·5% agarose gel in 1X TBE buffer and
stained with ethidium bromide.
Phenotypic data collection
For a subsample of 169 buffalo cows an association study
between the SNP polymorphism and milk yield was carried
out. A total of 43 510 test-day (TD) records for milk yield
measured daily with an automatized milk recording system
on 226 lactations of 169 Italian water buffalo cows of
different parities (17) were used. Data were collected in the
period January 2007September 2009 in a herd located in
the province of Salerno. Animals were milked twice a day
with the Afifarm system (S.A.E. Afikim, Kibbutz Afikim,
Israel).
Bioinformatic and statistical analysis
The allele frequency and Hardy-Weinberg equilibrium (χ
2
test) were calculated for the larger sample of 322 buffaloes.
Homology searches, comparison among sequences, and
multiple alignments were accomplished using DNAsis-Pro
(Hitachi), whereas the putative transcription factor binding
sites were searched by Transfact
®
7.0 software.
Associations between SCD polymorphism for 169 buffa-
loes and milk yield was investigated with the following
mixed linear model (SAS Institute, Cary NC, USA):
y
ijlmn
¼ YS
i
þ Par
j
þ SCD
l
þ DIM
m
þ DIM
m
ðSCD
l
Þ
þ c
n
ðSCD
l
Þþe
ijlmn
ð1Þ
where y
ijlmn
=test-day record of milk yield; YS = fixed effect
of the ith year per season of production (8 levels: autumn
2007 to summer 2009); Par=fixed effect of the jth parity
(5 levels: 14, >5); SCD = fixed effect of the lth SCD
genotype (3 levels: AA, AC, CC); DIM=fixed effect of the
mth stage of lactation (30 levels of 10 d each); c = random
effects of individual cow (169 levels), nested within SCD
genotype; e
ijlmn
= random residual.
The fixed effect of SNP genotype fits the average effect
across the whole lactation. The DIM (days in milk) factor
nested within SCD genotype was included in the model to
estimate lactation curves of the different genotypes (Stanton
et al. 1992). (Co)variance matrices of random effects of cow
and residual were assumed to be diagonal, Iσ
2
c and Iσ
2
e,
respectively. They allow for the REML estimation of variance
components associated to individual cow (σ
2
c
) and residual
(σ
2
e
). Statistical significance of the SNP effect was
tested against variance of cow nested within SNP genotype
430 A Pauciullo and others

(Littell et al. 1998 ). Pairwise comparisons among different
levels of fixed effect s included in model were performed
using a Bonferroni adjusted test.
The average gene substitution effect (α) was calculated
using a mixed linear model with the same structure of (1) but
with the gene effect treated as a covariable, represented by
the number of C alleles at the SCD locus (0, 1, 2), and an
interaction between alleles at the SNP locus to account for
possible dominance effects (Banos et al. 2008).
Finally, in order to estimate the contribution of the SCD
locus to th e variance of the trait, a mixed model having the
same structure of (1) but with the SCD genotype treated as
random was run. Thus a variance component associated to
the SCD lo cus (σ
2
SCD
) was estimated. Contributions of SCD
C/EBP NF-1
GAAACTTCCCCAGTGCCCATCCATTTGCGAATTGCCCGGGGCCAGTTCTGGGCTGGCACG -534
CATCCCCGCGCCACTCCCCGACAGGGTCTTCTCCCTCTCCCCGAGCGCCTCCGAGGCGGC -474
SP1 SP1
AGGGTGCCCGGTMGAGGCCCAGCGGCCGGTGTAAGAGAAGCCGAGGAGAAAGGGAGGGGA -414
SREBP C/EBP NF-1
GGGGGAGTGAGGAGCTCGCGGCAGAGGGAACAGCAGATTGCGCCGAGCCAATGGCAACGG -354
NF-1 C/EBP C/EBP
CAGGACGAGGTGGCACCAAATTCCCTTCGGCCAATGACGCGCCAGAGTCTACAGAAGCCC -294
C/EBP C/EBP C/EBP
ATTAGCATTTCCCCAGGGGCAGGGGCAGAGGCAGGGGCTGCGGCGGCTAAGCCGCGGTGT -234
C/EBP
GTCTGCAGCATCCAGTTCTTGCTTCTTCGGCCCCCAGCACGCCTCGGCGCTCTGTCTCCT -174
CCCCTCTCCCGCCCATGCGGATCTCCCACGGTGAGCCAACTCTGCGCACTTTGCCCCTTG -114
NF-1 TATA box C/EBP
SREBP SP1
TTGGCAACGAATAAAAGGGGTCTGAGGAAATACGGGACACAGTCACCCCCTGCCAGCGCT -54
TATA BOX PPAR SP1
ATTAAATCCCCAGCACAGCAGGTCGGGTCCGGACACCGGTCCAGCGCGCACCGtgcagcg 7
PPAR
gaaggtcccgagcgcagcgccgcggatcgccacgcaaaagcaggctcaggaactagtcta 67
Fig. 1. Key transcription factors binding sites found in the 5 promoter region of the river buffalo SCD gene. The conserved polyunsaturated
fatty acid (PUFA) response region including the sterol response element (SREBP), CCAAT-box (C/EBP), nuclear factor (NF)-1 and stimulator
protein 1 (SP1) binding site are shown. TATA motifs and peroxisome proliferator activated receptor-γ (PPAR-γ) are also shown proximal to the
transcription start site. SNP g.133A>C is indicated with M nucleotide according to international nomenclature
SNP at river buffalo SCD gene associated with milk yield 431

locus (r
2
SCD
) and cow (r
2
c
) to the total phenotypic variance of
the trait considered were calculated as:
r
2
SCD
¼
σ
2
SCD
σ
2
SCD
þ σ
2
c
þ σ
2
e
and r
2
C
¼
σ
2
C
σ
2
c
þ σ
2
e
þ σ
2
SCD
Results and Discussion
Characterization of river buffalo SCD promoter
A total of 593 bp of the river buffalo SCD promoter (EMBL
acc. no. FM876222) upstream the first nucleotide of the first
exon were analysed by using Transfact
®
7.0 software and
characterized in order to investigate the putative transcrip-
tion factor binding sites that could regulate the gene
expression (Fig. 1).
The buffalo SCD promoter contains two TATA box
located, with reference to the first nucleotide of the first
exon, at nucleotides 51/ 48 and 102/ 99 and at least
four SP1 consensus sequence ( 473/ 468, 459/448,
58/64, 18/ 6). The high GC content (64·9%) is a typical
feature of housekeeping genes promoters (Zhu et al. 2008)
and the presence of these last sites could contribute to the
constitutive expression of the SCD in various tissues.
Several CCAAT/enhancer binding protein (C/EBP) were
identified. This family of transcription factors are key
regulators of adipogenesis and lipid metabolism, playing a
fundamental role in expression of adipocyte genes as
ADIPOQ, DGAT1, LPL, CD36 (Olofsson et al. 2008). In
river buffalo SCD promoter, most of these C/EBP consensus
sequences were found in a very closed DNA fragment of
about 130 bp (nucleotide 382/ 250), suggesting that this
region could have an essential function in the gene
expression. To support these findings, a multiple sequence
alignment of the river buffalo, pig, human and mouse
SCD 1/SCD 2 promoters was achieved (data not shown).
Such DNA region was found to be highly conserved and
among the found binding sites for transcription factors, those
regulating lipid metabolism were: one sterol regulatory
element binding protein (SREBP) at position 382/ 372,
which is considered a key components of trans-10, cis-12
C18:2 conjugated linoleic acid (CLA) regulation of bovine
milk fat synthesis (Harvatine & Bauman, 2006); and two
nuclear factor (NF)-1 binding sites ( 362/ 358 and
343/ 339), which are functional enhancers with speci-
ficity for adipose cells and involved in adipocyte-specific
gene expression (Graves et al. 1991).
The analysis of the remaining portion of 5 flanking region
showed other regulatory elements: one sterol regulatory
element (SREBP) at the nucle otides 71/ 68, one NF-1 at
the position 112/ 108 and two peroxisome proliferator
activated receptor-γ (PPAR-γ) at the positions 34/ 29 and
10/15. PPAR-γ is often referred as the master regulator of
adipogenesis becaus e it participates in the transcriptional
activation of numerous adipogenic and lipogenic genes
(Paton & Ntambi, 2009). Recently, a gene network analysis
in bovine mammary tissue showed that expression of PPAR-γ
and its putative target genes was up-regulated during
lactation, suggesting a role for this nuclear receptor in the
regulation of milk fat synthesis (Bionaz & Loor, 2008).
Genotyping
The transvertion g.133A > C creates a restriction site for the
endonuclease TaqI, thus a PCR-RFLP protocol was set up for
the quick genotyping of the samples. Digestion of the PCR
product (752 bp) allows the identification of both alleles
(Fig. 2).
The restriction pattern is characterized by one undigested
fragment of 752 bp for the AA homozygous samples,
whereas the same amplicon is restricted into two fragments
of 132 and 620 bp in the presence of cytosine at the
homozygous status. The restriction pattern of the hetero-
zygous samples shows 3 fragments. The frequency of
cytosine in the sample of 322 buffaloes was 0·16 (Table 1).
This value might open the possibility for a rapid directional
selection in favour of the C allele, which was found to be
associated with a higher content of unsaturated FAs in milk
(Pauciullo et al. 2010). Hardy-Weinberg disequilibrium was
detected for the genotype distribution, but this event could
be the result of several causes. In particular, the restricted
number of genotyped individuals and the mating system. In
the last case, even though the mating technique in buffalo is
still almost exclusively natural for the physiological
Fig. 2. Genotyping of SCD g.133A > C SNP by Taq I (T#CGA) PCR-
RFLP. Line 1: AA homozygous samples; line 3: CC homozygous
samples; line 2 heterozygous samples. In the lines 2 and 3 is not
visible the band 132 bp long. Line M is 2-log DNA ladder (0·110 kb;
New England Biolabs)
432 A Pauciullo and others

problems in the application of the AI (Barile, 2005; Drost,
2007), we cannot exclude an inbreeding effect often due to
the use of the same tested bulls.
Association between SCD genotype and milk traits
The SCD genotype was significantly associated with milk
yield (P = 0·02) (Table 2). In particular, buffalo cows with
heterozygous genotype AC at the promoter of SCD locus
showed the highest daily milk yield, with more than 2 kg/d
compared with CC buffaloes. Such a difference accounts for
about 28% more milk per day. On the contrary homozygous
AA were slightly lower than AC. The behaviour of the three
genotypes tended to remain constant throughout the whole
lactation, as can be seen from the estimated lactation curves
of the three genotypes (Fig. 3). A similar pattern has been
observed also in other association studies involving poly-
morphisms at the SCD gene in Italian Holstein (Macciotta
et al. 2008) and at the OXT gene in river buffalo (Pauciullo
et al. 2011).
The allele substitution effect of the adenine into cytosine
was about 1 kg/d (P < 0·01 ), and the contribution of the
SCD polymorphism to the total phenotypic variance was
12% (Table 3). Such an effect is larger than the one reported
for the SCD (Macciotta et al. 2008) and also higher than the
contribution reported for DGAT1 (Grisart et al. 2002) on milk
yield in dairy cattle.
The large effect of dominance on milk yield observed in
the present work, more than 1·2 kg (P < 0·02), is also very
interesting (Table 3). This offers a possible explanation of the
over-dominance effect of the heterozygous (AC) on the best
homozygous phenotype (AA). Often such an effect is not
detected or considered to be not relevant because numeri-
cally much lower than the additive effect. However, it might
have an impact on allele substitution effect in the population
as recently reported in dairy cattle (Kuehn et al. 2007).
Moreover, lactation curves of different genotypes showed
that the superiority of the heterozygous over the AA
genotype is concentrated mainly around the lactation peak
and, to a lesser extent, between 120 and 150 DIM (Fig. 3).
In previous research carried out on the same group of
animals, Pauciullo et al. (2010) showed that CC genotype is
associated to higher desaturation index in milk fatty acids,
probably as consequence of an additional SP1 transcription
factor in the promoter. It is also well known that the lipid
Table 1. Genotyping data, allele frequency, absolute (relative) frequencies of buffalo cows, lactations and tests across genotypes of the g.133 A> C SNP at the SCD promoter gene of the in
Mediterranean river buffalo population
EMBL acc. No. Position
SNP
Allele
frequency
Frequencies used in the model
g.133A >C Genotype n of cows n of lactations n of tests
FM876222 Promoter
AA AC CC TOT A C AA 117 (69·23) 154 (68·14) 29858 (68·62)
Obs. 232 75 15
322 0·84 0·16
AC 44 (26·04) 58 (25·66) 11 294 (25·96)
Exp. 225·56 87·88 8·56 CC 8 (4·73) 14 (6·19) 23 58 (5·42)
χ
2
= 6·92 P 4 0·05 Total 169 (100) 226 (100) 43 510 (100)
Table 2. Least squares means of milk yield (kg/d) for the three
genotypes at the g.133A>C SNP in the promoter of SCD gene
estimated with model (1)
SCD genotype Milk yield (kg/d)
SE
AA 8·63
ab
0·20
CA 8·83
a
0·33
CC 6·60
b
0·73
a,b
Means within columns without a common superscript differ (Bonferroni
adjusted P<0·05)
SNP at river buffalo SCD gene associated with milk yield 433

Citations
More filters
Book ChapterDOI
01 Jan 2013
TL;DR: In vitro studies evidenced that SREBP1 is a key transcription factor of mammary SCD1 gene expression, whereas LXR and PPARG roles need to be precised and mammarySCD is inhibited by cis-9-18-1 and activated by trans-11-18:1.
Abstract: In lactating ruminants, the stearoyl-CoA desaturase (SCD) gene expression and activity is implicated in mammary gland physiology and in milk technological and nutritional qualities. This chapter reviews the present knowledge on the effects of nutritional factors on SCD genes expression in the ruminant mammary gland, in relation with milk fatty acid (FA) composition. In addition, the effects of specific FA on SCD using in vitro mammary models and the known molecular mechanisms underlying these regulations are presented. In ruminants, two isoforms, SCD1 and SCD5, are produced from two different genes. In vivo nutrition studies in cows showed that diets inducing milk fat depression (MFD) decreased the mRNA abundance of mammary lipogenic genes which was not always observed for SCD1, leading to the hypothesis of a response of these genes as a two-step phenomenon, probably due to differences of response to transcription factors (SREBP1 or others). However, in cows, SCD1 mRNA decreased with marine oil supplements. In goats, SCD is regulated at a transcriptional and/or post-transcriptional level, depending on the lipid supplements. Post-ruminal infusion studies of specific FA in cows and goats confirmed that trans-10, cis-12-CLA, trans-10, trans-12- and trans-9, trans-11-CLA reduced milk fat Δ9-desaturation ratios and could be inhibitors of SCD activity despite that the two latter isomers were not associated with MFD. Finally, in vitro studies evidenced that (1) SREBP1 is a key transcription factor of mammary SCD1 gene expression, whereas LXR and PPARG roles need to be precised and (2) mammary SCD is inhibited by cis-9-18:1 and activated by trans-11-18:1.

48 citations


Cites background from "A single nucleotide polymorphism in..."

  • ...…promoter has not allowed the detection of SNP (Keating et al. 2005 ), a more recent study highlighted a SNP (133A>C) creating a new consensus site for the transcription factor SP1 binding site, which could be responsible for a difference in the milk FA desaturation ratio (Pauciullo et al. 2012 )....

    [...]

Journal ArticleDOI
TL;DR: This work identified and classified the candidate genes associated with buffalo milk production traits and identified four genes, especially APOB, that deserve further study to explore regulatory roles in buffalo milkProduction.
Abstract: Water buffalo (Bubalus bubalis) is of great economic importance as a provider of milk and meat in many countries. However, the milk yield of buffalo is much lower than that of Holstein cows. Selection of candidate genes related to milk production traits can be applied to improve buffalo milk performance. A systematic review of studies of these candidate genes will be greatly beneficial for researchers to timely and efficiently understand the research development of molecular markers for buffalo milk production traits. Here, we identified and classified the candidate genes associated with buffalo milk production traits. A total of 517 candidate genes have been identified as being associated with milk performance in different buffalo breeds. Nineteen candidate genes containing 47 mutation sites have been identified using the candidate gene approach. In addition, 499 candidate genes have been identified in six genome-wide association studies (GWASes) including two studies performed with the bovine SNP chip and four studies with the buffalo SNP chip. Genes CTNND2 (catenin delta 2), APOB (apolipoprotein B), FHIT (fragile histidine triad) and ESRRG (estrogen related receptor gamma) were identified in at least two GWASes. These four genes, especially APOB, deserve further study to explore regulatory roles in buffalo milk production. With growth in the number of buffalo genomic studies, more candidate genes associated with buffalo milk production traits will be identified. Therefore, future studies, such as those investigating gene location and functional analyses, are necessary to facilitate the exploitation of genetic potential and the improvement of buffalo milk performance.

39 citations

Journal ArticleDOI
14 Jan 2016-PLOS ONE
TL;DR: A phylogenetic analysis showed that the five swamp buffalo populations were clustered together, whereas two river buffalo breeds clustered separately, and the Illumina RNA-seq technology was utilized to perform transcriptome analysis and SSR marker discovery in the swamp buffalo without using a reference genome.
Abstract: The Chinese swamp buffalo (Bubalis bubalis) is vital to the lives of small farmers and has tremendous economic importance. However, a lack of genomic information has hampered research on augmenting marker assisted breeding programs in this species. Thus, a high-throughput transcriptomic sequencing of B. bubalis was conducted to generate transcriptomic sequence dataset for gene discovery and molecular marker development. Illumina paired-end sequencing generated a total of 54,109,173 raw reads. After trimming, de novo assembly was performed, which yielded 86,017 unigenes, with an average length of 972.41 bp, an N50 of 1,505 bp, and an average GC content of 49.92%. A total of 62,337 unigenes were successfully annotated. Among the annotated unigenes, 27,025 (43.35%) and 23,232 (37.27%) unigenes showed significant similarity to known proteins in NCBI non-redundant protein and Swiss-Prot databases (E-value < 1.0E-5), respectively. Of these annotated unigenes, 14,439 and 15,813 unigenes were assigned to the Gene Ontology (GO) categories and EuKaryotic Ortholog Group (KOG) cluster, respectively. In addition, a total of 14,167 unigenes were assigned to 331 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Furthermore, 17,401 simple sequence repeats (SSRs) were identified as potential molecular markers. One hundred and fifteen primer pairs were randomly selected for amplification to detect polymorphisms. The results revealed that 110 primer pairs (95.65%) yielded PCR amplicons and 69 primer pairs (60.00%) presented polymorphisms in 35 individual buffaloes. A phylogenetic analysis showed that the five swamp buffalo populations were clustered together, whereas two river buffalo breeds clustered separately. In the present study, the Illumina RNA-seq technology was utilized to perform transcriptome analysis and SSR marker discovery in the swamp buffalo without using a reference genome. Our findings will enrich the current SSR markers resources and help spearhead molecular genetic research studies on the swamp buffalo.

33 citations

Journal ArticleDOI
TL;DR: The biological role of the SNP g.133A>C in the SCD promoter and how it affects gene function is clarified, providing important knowledge on the genetic background of lipid metabolism, including the future possibility of selecting alleles with quantitatively or qualitatively favorable effects.

22 citations

References
More filters
Journal ArticleDOI
TL;DR: This procedure implements random effects in the statistical model and permits modeling the covariance structure of the data, and can compute efficient estimates of fixed effects and valid standard errors of the estimates in the SAS System.
Abstract: Mixed linear models were developed by animal breeders to evaluate genetic potential of bulls. Application of mixed models has recently spread to all areas of research, spurred by availability of advanced computer software. Previously, mixed model analyses were implemented by adapting fixed-effect methods to models with random effects. This imposed limitations on applicability because the covariance structure was not modeled. This is the case with PROC GLM in the SAS® System. Recent versions of the SAS System include PROC MIXED. This procedure implements random effects in the statistical model and permits modeling the covariance structure of the data. Thereby, PROC MIXED can compute efficient estimates of fixed effects and valid standard errors of the estimates. Modeling the covariance structure is especially important for analysis of repeated measures data because measurements taken close in time are potentially more highly correlated than those taken far apart in time.

2,770 citations


"A single nucleotide polymorphism in..." refers methods in this paper

  • ...Statistical significance of the SNP effect was tested against variance of cow nested within SNP genotype (Littell et al. 1998)....

    [...]

Journal ArticleDOI
TL;DR: The positional candidate cloning of this QTL is reported, involving the construction of a BAC contig spanning the corresponding marker interval, and the demonstration that a very strong candidate gene, acylCoA:diacylglycerol acyltransferase (DGAT1), maps to that contig.
Abstract: We recently mapped a quantitative trait locus (QTL) with a major effect on milk composition--particularly fat content--to the centromeric end of bovine chromosome 14. We subsequently exploited linkage disequilibrium to refine the map position of this QTL to a 3-cM chromosome interval bounded by microsatellite markers BULGE13 and BULGE09. We herein report the positional candidate cloning of this QTL, involving (1) the construction of a BAC contig spanning the corresponding marker interval, (2) the demonstration that a very strong candidate gene, acylCoA:diacylglycerol acyltransferase (DGAT1), maps to that contig, and (3) the identification of a nonconservative K232A substitution in the DGAT1 gene with a major effect on milk fat content and other milk characteristics.

899 citations

Journal ArticleDOI
TL;DR: The goal of this review is to provide an overview of the genetic regulation of the stearoyl-CoA desaturase in response to dietary polyunsaturated fatty acids and cholesterol.

758 citations


"A single nucleotide polymorphism in..." refers background in this paper

  • ...It is also known as delta-9-desaturase because it catalyses the introduction of the first cis-double bond in the Δ9 position in a large spectrum of fatty acyl-CoA substrates (Ntambi, 1999)....

    [...]

Journal ArticleDOI
TL;DR: Results challenge the proposal that SREBF1 is central for milk fat synthesis regulation and highlight a pivotal role for a concerted action among PPARG, PPARGC1A, and INSIG1.
Abstract: The molecular events associated with regulation of milk fat synthesis in the bovine mammary gland remain largely unknown. Our objective was to study mammary tissue mRNA expression via quantitative PCR of 45 genes associated with lipid synthesis (triacylglycerol and phospholipids) and secretion from the late pre-partum/non-lactating period through the end of subsequent lactation. mRNA expression was coupled with milk fatty acid (FA) composition and calculated indexes of FA desaturation and de novo synthesis by the mammary gland. Marked up-regulation and/or % relative mRNA abundance during lactation were observed for genes associated with mammary FA uptake from blood (LPL, CD36), intracellular FA trafficking (FABP3), long-chain (ACSL1) and short-chain (ACSS2) intracellular FA activation, de novo FA synthesis (ACACA, FASN), desaturation (SCD, FADS1), triacylglycerol synthesis (AGPAT6, GPAM, LPIN1), lipid droplet formation (BTN1A1, XDH), ketone body utilization (BDH1), and transcription regulation (INSIG1, PPARG, PPARGC1A). Change in SREBF1 mRNA expression during lactation, thought to be central for milk fat synthesis regulation, was ≤2-fold in magnitude, while expression of INSIG1, which negatively regulates SREBP activation, was >12-fold and had a parallel pattern of expression to PPARGC1A. Genes involved in phospholipid synthesis had moderate up-regulation in expression and % relative mRNA abundance. The mRNA abundance and up-regulation in expression of ABCG2 during lactation was markedly high, suggesting a biological role of this gene in milk synthesis/secretion. Weak correlations were observed between both milk FA composition and desaturase indexes (i.e., apparent SCD activity) with mRNA expression pattern of genes measured. A network of genes participates in coordinating milk fat synthesis and secretion. Results challenge the proposal that SREBF1 is central for milk fat synthesis regulation and highlight a pivotal role for a concerted action among PPARG, PPARGC1A, and INSIG1. Expression of SCD, the most abundant gene measured, appears to be key during milk fat synthesis. The lack of correlation between gene expression and calculated desaturase indexes does not support their use to infer mRNA expression or enzyme activity (e.g., SCD). Longitudinal mRNA expression allowed development of transcriptional regulation networks and an updated model of milk fat synthesis regulation.

634 citations


"A single nucleotide polymorphism in..." refers background in this paper

  • ...Recently, a gene network analysis in bovinemammary tissue showed that expression of PPAR-γ and its putative target genes was up-regulated during lactation, suggesting a role for this nuclear receptor in the regulation of milk fat synthesis (Bionaz & Loor, 2008)....

    [...]

Journal ArticleDOI
TL;DR: Oleate is the most abundant monounsaturated fatty acid in dietary fat and is therefore readily available, and inhibition of its expression could be of benefit for the treatment of obesity, diabetes, and other metabolic diseases.
Abstract: A key and highly regulated enzyme that is required for the biosynthesis of monounsaturated fatty acids is stearoyl-CoA desaturase (SCD), which catalyzes the D9-cis desaturation of a range of fatty ...

608 citations


"A single nucleotide polymorphism in..." refers background in this paper

  • ...PPAR-γ is often referred as the ‘master regulator’ of adipogenesis because it participates in the transcriptional activation of numerous adipogenic and lipogenic genes (Paton & Ntambi, 2009)....

    [...]

Related Papers (5)
Frequently Asked Questions (1)
Q1. What have the authors contributed in "A single nucleotide polymorphism in the promoter region of river buffalo stearoyl coa desaturase gene (scd) is associated with milk yield" ?

This report is among the first indications of genetic association between a trait of economic importance in river buffalo.