scispace - formally typeset

Journal ArticleDOI

Accumulation of FlAsH/Lumio Green in active mitochondria can be reversed by β-mercaptoethanol for specific staining of tetracysteine-tagged proteins

04 Jan 2006-Histochemistry and Cell Biology (Springer-Verlag)-Vol. 125, Iss: 6, pp 743-747

TL;DR: A staining protocol was established using β-mercaptoethanol as thiol binding site competitor resulting in a specific staining of tetracysteine-tagged reggie-1/flotillin-2 of adequate signal to noise ratio, so that the more toxic and inconvenient ethanedithiol could be avoided.

AbstractRecent advances in the field of small molecule labels for live cell imaging promise to overcome some of the limitations set by the size of fluorescent proteins. We tested the tetracysteine–biarsenical labeling system in live cell fluorescence microscopy of reggie-1/flotillin-2 in HeLa and N2a cells. In both cell types, the biarsenical staining reagent FlAsH/Lumio Green accumulated in active mitochondria and led to mitochondrial swelling. This is indicative of toxic side effects caused by arsenic, which should be considered when this labeling system is to be used in live cell imaging. Mitochondrial accumulation of FlAsH/Lumio Green was reversed by addition of low concentrations of thiol-containing reagents during labeling and a subsequent high stringency thiol wash. Both ethanedithiol and β-mercaptoethanol proved to be effective. We therefore established a staining protocol using β-mercaptoethanol as thiol binding site competitor resulting in a specific staining of tetracysteine-tagged reggie-1/flotillin-2 of adequate signal to noise ratio, so that the more toxic and inconvenient ethanedithiol could be avoided. Furthermore, we show that staining efficiency was greatly enhanced by introducing a second tetracysteine sequence in tandem.

Topics: Ethanedithiol (60%), Live cell imaging (54%), Staining (51%)

Summary (2 min read)

Introduction

  • Investigating the distribution and dynamics of proteins inside living cells by fluorescence microscopy has been greatly simplified by genetically encoded recombinant fusion proteins of green fluorescent protein and its variants (Lippincott-Schwartz et al. 2001) .
  • It is based on complex formation between a biarsenical variant of fluorescein (fluorescein arsenical helix binder, FlAsH) or resorufin and a genetically encoded tetracysteine motif of only 6-12 amino acids.
  • Furthermore, FlAsH and ReAsH are now commercially available as Lumio Greenä and Lumio Redä from Invitrogen.
  • This protein of 47 kDa was discovered in their lab as a protein upregulated in goldfish retinal ganglion cells during axon regeneration after optic nerve injury (Schulte et al. 1997; Lang et al. 1998) .

Reagents

  • Lumio Green and Disperse Blue were purchased from Invitrogen (Karlsruhe, Germany) as part of the ''Lumio in cell labeling kitä''.
  • Mitotracker Orange and Rhodamine 123 were from Molecular Probes (Leiden, Netherlands).
  • B-mercaptoethanol (2-ME), ethanedithiol (EDT), formaldehyde and rotenone were from Sigma (Munich, Germany).
  • Oligonucleotides were from Operon Biotechnology (Cologne, Germany).
  • Enzymes for molecular biology were from New England Biolabs (Beverly, USA) or Fermentas (St. Leon-Rot, Germany).

Cloning of reggie-1-tetracysteine expression vectors

  • By ligation with annealed oligonucleotides (fw: 5¢-GATCCATT-CCTGAACTGTTGTCCCGGCTGCTGCATGGAG-CCTTGA-3¢; rv: 5¢-GGCCTCAAGGCTCCATGCAG.
  • CAGCCGGGACAACAGTTCAGGAATG-3¢) the authors then introduced the first tetracysteine sequence coding for FLNCCPGCCMEP*, a tetracysteine sequence with optimized flanking amino acids for particularly high affinity for biarsenical ligands (Martin et al. 2005) .
  • To introduce a second tetracysteine sequence, the authors linearized the resulting plasmid using BamHI, dephosphorylated the ends using calf intestine alkaline phosphatase and ligated phosphorylated, annealed oligonucleotides (fw: Phos-5¢-GATCACTCTCTTAACTGCTGCCCGGGG-TGTTGTATGGAACCCGTAGTCCTT-3¢, rv: Phos-5¢-GATCAAGGACTACGGGTTCCATACAACACC-CCGGGCAGCAGTTAAGAGAGT-3¢) encoding SLNC-CPGCCMEP.
  • The use of different codons made colony PCR screening with a specific reverse primer (5¢-AT-CAAGGACTACGGGTT-3¢) possible.
  • All constructs were finally sequenced for verification.

Cell culture and transfection

  • Cells were transfected using Lipofectamine 2000 according to the manufacturers instructions.
  • For labeling, transfected cells were plated onto chambered coverslips (Nunc, Rochester, USA) coated with poly-Llysine and laminin (both Sigma) 24 h after transfection and labeled 48 h post transfection.

Fluorescence microscopy

  • Where indicated, the Apotome system (Carl Zeiss) was used to acquire confocal images by structured illumination.
  • Images were processed using AxioVision 4.4 (Carl Zeiss) and ImageJ (Abramoff et al. 2004 ).

FlAsH/Lumio Green accumulates in active mitochondria

  • In the absence of thiol reagents during labeling with FlAsH/Lumio Green, the authors observed in both HeLa and N2a cells a very bright staining of mitochondria, which they verified by co-staining using the mitochondrial marker Mitotracker Orange (Fig. 1a ).
  • Several other treatments were reported to reduce background staining while using the tetracysteine-biarsenical system.
  • Disperse Blue is a hydrophobic dye which suppresses unspecific staining by blocking hydrophobic binding sites (Griffin et al. 2000) and is part of the labeling kit sold by Invitrogen.
  • These side effects might severely compromise the value of this labeling system for live cell imaging.
  • Furthermore, addition of low concentrations of thiols during labeling reduced morphological changes of the mitochondria induced by FlAsH/Lumio Green at least to a certain extent, probably by reversing the toxic effect of arsenic on the GSH redox system (Zmuda and Friedenson 1983) .

Specific staining of tetracysteine-tagged reggie in the presence of b-mercaptoethanol

  • So far, all publications using the tetracysteine-biarsenical labeling system utilized EDT to suppress unspecific binding of the biarsenical fluorescent staining reagent to cellular thiols.
  • This clearly demonstrates that specific labeling using the tetracysteine-biarsenical system can be achieved by replacing EDT with the less toxic, easier to handle 2-ME.
  • The authors therefore suggest testing different constructs with variable numbers and localizations of tetracysteine sequences, as not only localization of the tag seems to be crucial (N-terminal tagging of reggie-1/flotillin-2 for example results in a mislocalized fusion protein most probably because myristoylation of Gly2 is inhibited), but staining efficiency and intensity might also be influenced.
  • The lower signal to noise ratio was caused by a diffuse FlAsH/Lumio Green staining of the whole cell, which is most probably due to binding of the biarsenical reagent to intracellular cysteine-rich proteins as previously described (Stroffekova et al. 2001 ).
  • The fact that the FlAsH/Lumio Green label was subject to photobleaching was another problem.

Did you find this useful? Give us your feedback

...read more

Content maybe subject to copyright    Report

Matthi
as F. Langhorst Æ Selda Genisyuerek
Claudia A.O. Stuermer
Accumulation of FlAsH/Lumio Green in active mitochondria
can be reversed by b-mercaptoethanol for specific staining
of tetracysteine-tagged proteins
Abstract Recent advances in the field of small molecule
labels for live cell imaging promise to overcome some of
the limitations set by the size of fluorescent proteins. We
tested the tetracysteine–biarsenical labeling system in
live cell fluore scence microscopy of reggie-1/flotillin-2 in
HeLa and N2a cells. In both cell types, the biarsenical
staining reagent FlAsH/Lumio Green accumulated in
active mitochondria and led to mitochondrial swelling.
This is indicative of toxic side effects caused by arsenic,
which should be considered when this labeling system is
to be used in live cell imaging. Mitochondrial accumu-
lation of FlAsH/Lumio Green was reversed by addition
of low concentrations of thiol-containing reagents dur-
ing labeling and a subsequent high stringency thiol wash.
Both ethanedithiol and b-mercaptoethanol proved to be
effective. We therefore established a staining protocol
using b-mercaptoethanol as thiol binding site competitor
resulting in a specific staining of tetracysteine-tagged
reggie-1/flotillin-2 of adequate signal to noise ratio, so
that the more toxic and inconvenient ethanedithiol could
be avoided. Furthermore, we show that staining effi-
ciency was greatly enhanced by introducing a second
tetracysteine sequence in tandem.
Keywords Tetracysteine Æ Biarsenical fluorescent
ligands Æ Reggie/flotillin Æ Live cell imaging Æ
Fluorescence microscopy
Introduction
Investigating the distribution and dynamics of proteins
inside living cells by fluorescence microscopy has been
greatly simplified by genetically encoded recombinant
fusion proteins of green fluorescent protein and its
variants (Lippincott-Schwartz et al. 2001). However,
fusion to fluorescent proteins, which have a molecular
mass of 25–30 kDa, can severely impair the function
and/or localization especially of small proteins. Smaller
labels may overcome some of these problems by
reducing steric hindrance (reviewed by Chen and Ting
2005). Labeling of recombinant prote ins using the
tetracysteine–biarsenical system developed by Tsien
and coworkers (Griffin et al. 1998) appears to be
particularly promising. It is based on complex forma-
tion between a biarsenical variant of fluorescein
(fluorescein arsenical helix binder, FlAsH) or resorufin
(ReAsH) and a genetically encoded tetracysteine motif
of only 6–12 amino acids. This system cannot only be
used for fluorescence detection of proteins in living
cells, but also for correlative electron microscopy
(Gaietta et al. 2002), fluorophore-assisted light inacti-
vation (FALI) (Marek and Davis 2002; Tour et al.
2003) an d pulse-chase experiments (Gaietta et al.
2002). Furthermore, FlAsH and ReAsH are now
commercially available as Lumio Green and Lumio
Red from Invitrogen.
We are using the tetracysteine–biarsenical labeling
system to investigate the localization and dynamics of
reggie-1/flotillin-2. This protein of 47 kDa was discov-
ered in our lab as a protein upregulated in goldfish ret-
inal ganglion cells during axon regeneration after optic
nerve injury (Schulte et al. 1997; Lang et al. 1998). Its
exact function is still unknown, but it most probably
acts as a lipid raft-associated scaffolding protein, defin-
ing specialized microdomains for multiprotein complex
assembly at cellular membranes (reviewed in Langhorst
et al. 2005).
M.F. Langhorst and S. Genisyuerek contributed equally to this
work.
M. F. Langhorst (&) Æ S. Genisyuerek Æ C. A.O. Stuermer
Developmental Neurobiology Group, Department of Biology,
University of Konstanz, Universitaetsstr. 10, 78457 Konstanz,
Germany
E-mail: Matthiaslanghorst@email.de
Tel.: +49-7531-882128
Fax: +49-7531-883894
First Publ. in: Histochemistry and cell biology ; 125 (2006), 3. - S. 743-747
DOI: 10.1007/s00418-005-0136-3
Konstanzer Online-Publikations-System (KOPS)
URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-180729

Materials and methods
Reagents
Lumio Green and Disperse Blue were purchased from
Invitrogen (Karlsruhe, Germany) as part of the ‘‘Lumio
in cell labeling kit’’. Mitotracker Orange and Rhoda-
mine 123 were from Molecular Probes (Leiden, Neth-
erlands). b-mercaptoethanol (2-ME), ethanedithiol
(EDT), formaldehy de and rotenone were from Sigma
(Munich, Germany). Oligonucleotides were from Oper-
on Biotechnology (Cologne, Germany). Enzymes for
molecular biology were from New England Biolabs
(Beverly, USA) or Fermentas (St. Leon-Rot, Germany).
Cloning of reggie-1-tetracy steine expression vectors
To construct expression vectors for reggie-1/flotillin-2 C-
terminally fused to one (R1FL-Cys
4
) or two tetracyste-
ine-sequences (R1FL-(Cys
4
)
2
) , we excised EGFP from
pR1FL-EGFP, a plasmid containing full-length rat
reggie-1 cloned into pEGF P-N1 (Clontech) (Neumann-
Giesen et al. 2004), using BamHI and NotI. By ligation
with annealed oligonucleotides (fw: 5¢-GATCCATT-
CCTGAACTGTTGTCCCGGCTGCTGCATGGAG-
CCTTGA-3¢; rv: 5¢-GGCCTCAA GGCTCCATGCAG
CAGCCGGGACAACAGTTCAGGAAT G-3¢) we then
introduced the first tetracysteine sequence coding for
FLNCCPGCCMEP*, a tetracysteine sequence with
optimized flanking amino acids for particularly high
affinity for biarsenical ligands (Martin et al. 2005). To
introduce a second tetracysteine sequence, we linearized
the resulting plasmid using BamHI, dephosphorylated
the ends using calf intestine alkaline phosphatase and
ligated phosphorylated, annealed oligonucleotides (fw:
Phos-5¢-GAT CACTC TCTTAACTGCTGCCCGGGG-
TGTTGTATGGAACCCGTAGTCCTT-3¢ , rv: Phos-
5¢-GATCAAGGACTACGG GTTCCATACAACACC-
CCGGGCAGCAGTTAAGAGAGT-3¢)encodingSLNC-
CPGCCMEP. The use of different codons made colony
PCR screening with a specific reverse primer (5¢-AT-
CAAGGACTACGGGTT-3¢) possible. All constructs
were finally sequenced for verifica tion. This strategy
proved to be a fast, reliable and versatile way to intro-
duce tetracysteine sequences wherever a restriction site
was available or could be introduced.
Cell culture and transfection
N2a and HeLa cells were cultured in MEM (Invitrogen)
supplemented with 100 units/ml Penicillin, 50 mg/ml
Streptavidin, 1 mM sodium pyruvate, 2 mM glutamine
and 10% foetal calf serum (all Invitrogen) at 37 C and
5% CO
2
. Cells were transfected using Lipofectamine
2000 according to the manufacturers instructions. For
labeling, transfected cells were plated onto chambered
coverslips (Nunc, Rochester, USA) coated with poly-
L-
lysine and laminin (both Sigma) 24 h after transfection
and labeled 48 h post transfection.
Labeling of HeLa and N2a cells
Cells were washed with Hepes-buffered salt solution
(HBSS) (135 mM NaCl, 4.5 mM KCl, 1.5 mM CaCl
2
,
0.5 mM MgCl
2
, 5.6 mM Glucose, 25 mM HEPES, pH
7.4) and incubated with 0.3–0.5 lM FlAsH/Lumio
Green and—if indicated—0.6–4 lM 2-ME or EDT in
HBSS for 1 h. After labeling, cells were thoroughly
washed with HBSS and either imaged immediately or
incubated with 100 lM 2-ME or EDT in HBSS for
30 min before microscopic analysis.
Fluorescence microscopy
Images were acquired on an Axiovert 200 M using a
Plan-Apochromat 63· objective (NA=1.4) and an
Axiocam MRm operated at full resolution (12 bit,
1,388·1,040 pixels; all Carl Zeiss, Jena, Germany).
Where indicated, the Apotome system (Carl Zeiss) was
used to acquire confocal images by structured illumi-
nation. Images were processed using AxioVision 4.4
(Carl Zeiss) and ImageJ (Abramoff et al. 2004).
Results and discussion
FlAsH/Lumio Green accumulates in active
mitochondria
In the absence of thiol reagents during labeling with
FlAsH/Lumio Green, we observed in both HeLa and
N2a cells a very bright staining of mitochondria, which
we verified by co-staining using the mitochondrial
marker Mitotracker Orange (Fig. 1 a). This bright
mitochondrial labeling by FlAsH/Lumio Green pre-
vented the identification of potentially present specific
staining of reggie-1/flotillin-2 in cells transfected with
R1FL-Cys
4
or R1FL-(Cys
4
)
2
. Furthermore, after
FlAsH/Lumio Green labeling we often observed a dis-
tinct change of mitochondria morphology towards a
round, swollen appearance (Fig. 1b) indicating that the
labeling procedure has a toxic effect on mitochondria.
Addition of low concentrations (1–2 lM) of the dithiol
ethanedithiol (EDT) during labeling and a 30 min wash
of the labeled cells with 100 lM EDT greatly reduced
the mitochondrial accumulation of FlAsH/Lumio
Green, but it did not completely prevent the morpho-
logical changes. Surprisingly, the monothiol b-mercap-
toethanol (2-ME) proved to be similarly effective in
reversing mitochondrial accumulation of FlAsH/Lumio
Green (Fig. 1c).
To test whether the accumulation of FlAsH/Lumio
Green in mitochondria is activity-dependent, we inhib-
744

ited mitochondrial respiration by a short incubation
with 5 lM Rotenone (Lindahl and Oberg 1960). This
treatment abolished labeling of the mitochondria by
FlAsH/Lumio Green (Fig. 1d), suggesting that accu-
mulation and/or fluorescence of FlAsH/ Lumio Green in
mitochondria is somehow linked to mitochondrial
activity. Uptake of Rhodamine 123 into mitochondria,
which only occurs in active mitochondria and which
could readily be inhibited by rotenone treatment, was,
however, not affected by the 2-ME concentrations nec-
essary to reduce mitochondrial staining by FlAsH/Lu-
mio Green (data not shown), suggesting that the thiol
reagents act only by competing with cellular thiol
binding sites in mitochondria and do not impair mito-
chondrial function.
Several other treatments were reported to reduce
background staining while using the tetracysteine–biar-
senical system. Disperse Blue is a hydrophobic dye
which suppresses unspecific staining by blocking
hydrophobic binding sites (Griffin et al. 2000) and is part
of the labeling kit sold by Invitrogen. Addition of
pyruvate was also suggested as a means of reducing
background staining (Griffin et al. 2000). However, both
reagents had no discernible effect on mitochondrial
accumulation of FlAsH/Lumio Green.
The FlAsH/Lumio Green-induced morphological
changes of the mitochondria might reflect toxic effects of
arsenic, which is known to disrupt mitochondrial func-
tion by generating reactive oxygen species and perturb-
ing the GSH redox system (Dalton 2002). These side
effects might severely compromise the value of this
labeling system for live cell imaging. In our experiments,
including EDT or 2-ME in the labeling procedure was
mandatory, as a high stringency wash with EDT or 2-
ME prove d to be the only efficient way to reverse the
accumulation of FlAsH/Lumio Green in mitochondria.
Furthermore, addition of low concentrations of thiols
during labeling reduced morphological changes of the
mitochondria induced by FlAsH/Lumio Green at least
to a certain extent, probably by reversing the toxic effect
of arsenic on the GSH redox system (Zmuda and Frie-
denson 1983). Still, the toxic side effects of the biarsen-
Fig. 1 Mitochondrial
accumulation of FlAsH/Lumio
Green and toxic side effects a
Untransfected N2a cells were
labeled with 1 lM FlAsH/
Lumio Green and Mitotracker
Orange in the absence of thiol-
containing reagents for 1 h,
washed and analyzed by
fluorescence microscopy.
FlAsH/Lumio Green clearly
accumulated in mitochondria
stained by MitoTracker (a
confocal slice acquired by
structured illumination is
shown). b Many cells stained as
described above exhibited
aberrant mitochondria with a
round, swollen appearance c
Untransfected N2a cells were
stained with 1 lM FlAsH/
Lumio Green + 4 lM 2-ME
for 1 h, washed and incubated
with 100 lM 2-ME for 30 min.
This treatment reversed
mitochondrial accumulation of
FlAsH/Lumio Green and
resulted in a diffuse background
staining. d Cells were labeled
with 1 lM FlAsH/Lumio
Green for 1 h, washed and then
incubated with 5 lM rotenone
for 15 min. Inhibition of
mitochondrial respiration by
rotenone also reversed the
mitochondrial accumulation of
FlAsH/Lumio Green
fluorescence. All bars,10lm
745

ical labeling reagent on mitochondria have to be con-
sidered when choosing a labeling system, especially for
long-term live cell imaging.
Specific staining of tetracysteine-tagged reggie in the
presence of b-mercaptoetha nol
So far, all publications using the tetracysteine–biar-
senical labeling system utilized EDT to suppress
unspecific binding of the biarsenical fluorescent staining
reagent to cellular thiols. EDT is highly toxic, not
readily soluble in physiological salt solutions and even
after extensive washing, the stench emanating from
EDT-treated samples is almost unbearable. Encouraged
by our observation that the mitochon drial accumula-
tion of FlAsH/Lumio Green was efficiently inhibited by
addition of 2-ME, we tested whether we could establish
conditions for specific labeling of tetracysteine-tagg ed
reggie-1/flotillin-2 in the presence of 2-ME only. Incu-
bation of cells transiently transfected with R1FL-Cys
4
with 0.3–0.5 lM FlAsH/Lumio Green in the presence
of an 4–6· excess of 2-ME for 1 h, followed by a
30 min wash with 100 lM 2-ME resulted in a clear,
reggie-1/flotillin-2-specific staining of the plasma
membrane and intracellular vesicles (Fig. 2a), very
much comparable to the localization observed in
R1FL-EGFP expressing cells (Fig. 2c). This clearly
demonstrates that specific labeling using the tetracy-
steine–biarsenical system can be achieved by replacing
EDT with the less toxic, easier to handle 2-ME. This
suggests that the bivalency of EDT is not indispensable
and that an excess of a monothiol like 2-ME can also
efficiently suppress unspecific binding of the biarsenical
fluorescent ligand to cellular thiols.
The staining efficiency using R1FL-Cys
4
with a
single tetracysteine-sequence was relatively low, but
introducing a second tetracysteine sequence in tandem
improved staining efficiency significa ntly (Fig. 2b).
Although all constructs were expressed at similar levels
(data not shown), the staining efficiency could be more
than doubled by a second tetracysteine sequence. We
therefore suggest testing different constructs with
variable numbers and localizations of tetracysteine
sequences, as not only localization of the tag seems to
be crucial (N-terminal tagging of reggie-1/flotillin-2 for
example results in a mislocalized fusion protein most
probably because myristoylation of Gly2 is inhibited),
but staining efficiency and intensity might also be
influenced. A prev ious report on FlAsH-labeling in
yeast cells stated that introducing a tandem tetracy-
steine sequence increased the photostability of the
labeling (Andresen et al. 2004).
The signal to noise ratio obtained by our staining
procedure was adequate for many applications, but in
comparison with R1FL-EGFP expressing cells (Fig. 2c)
clearly inferior. The lower signal to noise ratio was
caused by a diffuse FlAsH/Lumio Green staining of the
whole cell, whic h is most probably due to binding of the
biarsenical reage nt to intracellular cysteine-rich proteins
as previously described (Stroffekova et al. 2001). This
background staining was further reduced by increasing
the 2-ME concentration during the high stringency
wash, but this led to a severe loss of cells due to
detachment from the coverslip, as similarly observed for
EDT-treatment.
The fact that the FlAsH/Lumio Green label was
subject to photobleaching was another problem. FlAsH/
Lumio Green is a biarsenical variant of fluorescein,
which is known to photoblea ch rapidly (Song et al.
1995). The recent description of a rational design of new
fluorescein variants with improved properties (Urano
et al. 2005) might allow the development of more
photostable variants, which would greatly facilitate live
cell imaging of FlAsH/Lumio Green labeled proteins.
In summary we have demonstrated that specific
staining of tetracysteine-tagged proteins using biarseni-
cal fluorescent ligands is possible without ethanedithiol,
which we replaced by b-mercaptoethanol, which is less
toxic and more convenient to handle. A thiol-rea gent
proved to be mandatory in the labeling procedure to
reverse the accumulation of FlAsH/Lumio Green in
active mitochondria. The mitochondrial accumulation
of the biarsenical labeling reagent was accompanied by
mitochondrial swelling, which could only partly reversed
by thiol-containing reagents. These toxic side effects
might limit the usefulness of the tetracysteine–biarseni-
cal labeling system for live cell imaging.
Fig. 2 R1FL-Cys
4
/ R1FL-(Cys
4
)
2
labeling in N2a cells using b-
mercaptoethanol: N2a cells were transiently transfected with
R1FL-Cys
4
(a), R1FL-(Cys
4
)
2
(b) or R1FL-EGFP (c). R1FL-
Cys
4
/R1FL-(Cys
4
)
2
expressing cells were stained with 0.3 lM
FlAsH/Lumio Green + 1.2 lM 2-ME with a subsequent wash
with 100 lM 2-ME and analyzed by fluorescence microscopy. All
bars,10lm
746

Acknowledgements We thank Gonzalo Solis and Alexander Reuter
for their help with cloning of the R1-Cys
4
-expression vectors. This
work was supported by grants from the Deutsche Forschungs-
gemeinschaft DFG (SFB-TR11), the Ministerium Forschung,
Wissenschaft und Kunst Baden-Wu
¨
rttemberg (TSE program) and
the Fonds der Chemischen Industrie.
References
Abramoff MD, Magelhaes PJ, Ram SJ (2004) Image processing
with image. J Biophotonics Int 11:36–42
Andresen M, Schmitz-Salue R, Jakobs S (2004) Short tetracysteine
tags to beta-tubulin demonstrate the significance of small labels
for live cell imaging. Mol Biol Cell 15:5616–5622
Chen I, Ting AY (2005) Site-specific labeling of proteins with small
molecules in live cells. Curr Opin Biotechnol 16:35–40
Dalton WS (2002) Targeting the mitochondria: an exciting new
approach to myeloma therapy. Commentary re: Bahlis NJ
et al. (2002) Feasibility and correlates of arsenic trioxide
combined with ascorbic acid-mediated depletion of intracel-
lular glutathione for the treatment of relapsed/refractory
multiple myeloma. Clin Cancer Res 8:3658–3668. Clin Cancer
Res 8:3643–3645
Gaietta G, Deerinck TJ, Adams SR, Bouwer J, Tour O, Laird DW,
Sosinsky GE, Tsien RY, Ellisman MH (2002) Multicolor and
electron microscopic imaging of connexin trafficking. Science
296:503–507
Griffin BA, Adams SR, Jones J, Tsien RY (2000) Fluorescent
labeling of recombinant proteins in living cells with FlAsH.
Methods Enzymol 327:565–578
Griffin BA, Adams SR, Tsien RY (1998) Specific covalent labeling
of recombinant protein molecules inside live cells. Science
281:269–272
Lang DM, Lommel S, Jung M, Ankerhold R, Petrausch B, Laes-
sing U, Wiechers MF, Plattner H, Stuermer CA (1998) Identi-
fication of reggie-1 and reggie-2 as plasmamembrane-associated
proteins which cocluster with activated GPI-anchored cell
adhesion molecules in non-caveolar micropatches in neurons.
J Neurobiol 37: 502–523
Langhorst MF, Reuter A, Stuermer CA (2005) Scaffolding micr-
odomains and beyond: the function of reggie/flotillin proteins.
Cell Mol Life Sci 62:2228–2240
Lindahl PE, Oberg KE (1960) Mechanism of the physiological
action of rotenone. Nature 187:784
Lippincott-Schwartz J, Snapp E, Kenworthy A (2001) Studying
protein dynamics in living cells. Nat Rev Mol Cell Biol 2:
444–456
Marek KW, Davis GW (2002) Transgenically encoded protein
photoinactivation (FlAsH-FALI): acute inactivation of syn-
aptotagmin I. Neuron 36:805–813
Martin BR, Giepmans BN, Adams SR, Tsien RY (2005) Mam-
malian cell-based optimization of the biarsenical-binding tet-
racysteine motif for improved fluorescence and affinity. Nat
Biotechnol 23(10):1308–1314
Neumann-Giesen C, Falkenbach B, Beicht P, Claasen S, Luers G,
Stuermer CA, Herzog V, Tikkanen R (2004) Membrane and
raft association of reggie-1/flotillin-2: role of myristoylation,
palmitoylation and oligomerization and induction of filopodia
by overexpression. Biochem J 378:509–518
Schulte T, Paschke KA, Laessing U, Lottspeich F, Stuermer CA
(1997) Reggie-1 and reggie-2, two cell surface proteins ex-
pressed by retinal ganglion cells during axon regeneration.
Development 124:577–87
Song L, Hennink EJ, Young IT, Tanke HJ (1995) Photobleaching
kinetics of fluorescein in quantitative fluorescence microscopy.
Biophys J 68:2588–600
Stroffekova K, Proenza C, Beam KG (2001) The protein-labeling
reagent FLASH-EDT2 binds not only to CCXXCC motifs but
also non-specifically to endogenous cysteine-rich proteins.
Pflugers Arch 442:859–66
Tour O, Meijer RM, Zacharias DA, Adams SR, Tsien RY (2003)
Genetically targeted chromophore-assisted light inactivation.
Nat Biotechnol 21:1505–1508
Urano Y, Kamiya M, Kanda K, Ueno T, Hirose K, Nagano T
(2005) Evolution of fluorescein as a platform for finely tunable
fluorescence probes. J Am Chem Soc 127:4888–4894
Zmuda J, Friedenson B (1983) Changes in intracellular glutathione
levels in stimulated and unstimulated lymphocytes in the pres-
ence of 2-mercaptoethanol or cysteine. J Immunol 130:362–364
747

Citations
More filters

Journal ArticleDOI
TL;DR: A generally applicable labeling procedure that can be applied to proteins with expression below 1 pmol mg−1 of protein, such as G protein–coupled receptors, and it can be used to study the intracellular localization of proteins as well as functional interactions in fluorescence resonance energy transfer experiments.
Abstract: In this paper, we provide a general protocol for labeling proteins with the membrane-permeant fluorogenic biarsenical dye fluorescein arsenical hairpin binder-ethanedithiol (FlAsH-EDT₂) Generation of the tetracysteine-tagged protein construct by itself is not described, as this is a protein-specific process This method allows site-selective labeling of proteins in living cells and has been applied to a wide variety of proteins and biological problems We provide here a generally applicable labeling procedure and discuss the problems that can occur as well as general considerations that must be taken into account when designing and implementing the procedure The method can even be applied to proteins with expression below 1 pmol mg⁻¹ of protein, such as G protein-coupled receptors, and it can be used to study the intracellular localization of proteins as well as functional interactions in fluorescence resonance energy transfer experiments The labeling procedure using FlAsH-EDT₂ as described takes 2-3 h, depending on the number of samples to be processed

167 citations


Journal ArticleDOI
TL;DR: RhoBo functions as a cell-permeable, turn-on fluorescent sensor for tetraserine motifs in recombinant proteins and current efforts to identify optimal serine-rich sequences for RhoBo suggest it to function effectively as a selective small-molecule label for appropriately tagged proteins either upon or within living cells.
Abstract: There is considerable interest in novel cell imaging tools that avoid the use of fluorescent proteins. One widely used class of such reagents are “pro-fluorescent” biarsenical dyes such as FlAsH, ReAsH, CrAsH, and Cy3As. Despite their utility, biarsenicals are plagued by high background labeling and cytotoxicity and are challenging to apply in oxidizing cellular locale. Here we demonstrate that [(3-oxospiro[isobenzofuran-1(3H),9′-[9H]xanthene]-3′,6′-diyl)bis(iminomethylene-2,1-phenylene)]bis-(9CI), a rhodamine-derived bisboronic acid (RhoBo) described initially as a monosaccharide sensor, functions as a cell-permeable, turn-on fluorescent sensor for tetraserine motifs in recombinant proteins. RhoBo binds peptides or proteins containing Ser-Ser-Pro-Gly-Ser-Ser with affinities in the nanomolar concentration range and prefers this sequence to simple monosaccharides by >10 000-fold. RhoBo fails to form fluorescent complexes with constituents of the mammalian cell surface, as judged by epifluorescent, confocal...

155 citations


Journal ArticleDOI
TL;DR: Current approaches to visualize actin filaments are presented, emphasizing the advantages and pitfalls of available tools to investigate F-actin not only in the cytoplasm, but also in the somatic cell nucleus.
Abstract: Actin functions in a multitude of cellular processes owing to its ability to polymerize into filaments, which can be further organized into higher-order structures by an array of actin-binding and regulatory proteins. Therefore, research on actin and actin-related functions relies on the visualization of actin structures without interfering with the cycles of actin polymerization and depolymerization that underlie cellular actin dynamics. In this Cell Science at a Glance and the accompanying poster, we briefly evaluate the different techniques and approaches currently applied to analyze and visualize cellular actin structures, including in the nuclear compartment. Referring to the gold standard F-actin marker phalloidin to stain actin in fixed samples and tissues, we highlight methods for visualization of actin in living cells, which mostly apply the principle of genetically fusing fluorescent proteins to different actin-binding domains, such as LifeAct, utrophin and F-tractin, as well as anti-actin-nanobody technology. In addition, the compound SiR-actin and the expression of GFP-actin are also applicable for various types of live-cell analyses. Overall, the visualization of actin within a physiological context requires a careful choice of method, as well as a tight control of the amount or the expression level of a given detection probe in order to minimize its influence on endogenous actin dynamics.

127 citations


Cites background from "Accumulation of FlAsH/Lumio Green i..."

  • ...Moreover, owing to potential chemical toxicity caused by the labeling reaction, such as the accumulation of FlAsH in active mitochondria (Langhorst et al., 2006), this technique might be better suited for short-term live-cell imaging....

    [...]


Journal ArticleDOI
TL;DR: It is shown here that reggie‐1/flotillin‐2 microdomains are organized along cortical F‐actin in several cell types and can efficiently be immobilized by actin polymerisation, while exchange of reggie-1/ Flotillin-2 molecules between micro domains is enhanced by actIn disruption as shown by tracking of individual microdomain using TIRF microscopy.
Abstract: The reggies/flotillins are oligomeric scaffolding proteins for membrane microdomains. We show here that reggie-1/flotillin-2 microdomains are organized along cortical F-actin in several cell types. Interaction with F-actin is mediated by the SPFH domain as shown by in vivo co-localization and in vitro binding experiments. Reggie-1/flotillin-2 microdomains form independent of actin, but disruption or stabilization of the actin cytoskeleton modulate the lateral mobility of reggie-1/flotillin-2 as shown by FRAP. Furthermore, reggie/flotillin microdomains can efficiently be immobilized by actin polymerisation, while exchange of reggie-1/flotillin-2 molecules between microdomains is enhanced by actin disruption as shown by tracking of individual microdomains using TIRF microscopy.

95 citations


Cites methods from "Accumulation of FlAsH/Lumio Green i..."

  • ...N2a and HeLa cells were cultured and transfected as described previously [14]....

    [...]


Journal ArticleDOI
TL;DR: It is shown that trafficking of reggie-1/flotillin-2 is BFA sensitive and that deletion mutants of reggies/ flotillins accumulate in the Golgi complex in HeLa, Jurkat and PC12 cells, suggesting Golgi-dependent trafficking ofreggie- 1/flotsillins-2.
Abstract: The reggie/flotillin proteins oligomerize and associate into clusters which form scaffolds for membrane microdomains. Besides their localization at the plasma membrane, the reggies/flotillins reside at various intracellular compartments; however, the trafficking pathways used by reggie-1/flotillin-2 remain unclear. Here, we show that trafficking of reggie-1/flotillin-2 is BFA sensitive and that deletion mutants of reggie-1/flotillin-2 accumulate in the Golgi complex in HeLa, Jurkat and PC12 cells, suggesting Golgi-dependent trafficking of reggie-1/flotillin-2. Using total internal reflection fluorescence microscopy, we observed fast cycling of reggie-1/flotillin-2-positive vesicles at the plasma membrane, which engaged in transient interactions with the plasma membrane only. Reggie-1/flotillin-2 cycling was independent of clathrin, but was inhibited by cholesterol depletion and microtubule disruption. Cycling of reggie1/flotillin-2 was negatively correlated with cell–cell contact formation but was stimulated by serum, epidermal growth factor and by cholesterol loading mediated by low density lipoproteins. However, reggie-1/flotillin-2 was neither involved in endocytosis of the epidermal growth factor itself nor in endocytosis of GPI-GFPs or the GPI-anchored cellular prion protein (PrP c ). Reggie-2/flotillin-1 and stomatin-1 also exhibited cycling at the plasma membrane similar to reggie-1/flotillin-2, but these vesicles and microdomains only partially co-localized with reggie-2/flotillin-1. Thus, regulated vesicular cycling might be a general feature of SPFH protein-dependent trafficking.

88 citations


Cites background or methods from "Accumulation of FlAsH/Lumio Green i..."

  • ...HeLa, PC12 and Jurkat T cells were cultured and transfected as described previously (Langhorst et al., 2006a, b)....

    [...]

  • ...C-terminal EGFP-tagging of the full-length reggie-1/ flotillin-2 protein does not significantly alter its biochemical properties and its subcellular localization (Neumann-Giesen et al., 2004; Langhorst et al., 2006b)....

    [...]

  • ...Reggie/ flotillin-dependent signaling complexes were shown to be involved in actin remodeling during T cell activation (Langhorst et al., 2006b) and in Glut4translocation to the plasma membrane after insulin stimulation of adipocytes (Baumann et al., 2000; Kimura et al., 2001)....

    [...]


References
More filters

01 Jan 2004
TL;DR: ImageJ is an open source Java-written program that is used for many imaging applications, including those that that span the gamut from skin analysis to neuroscience, and can read most of the widely used and significant formats used in biomedical images.
Abstract: Wayne Rasband of NIH has created ImageJ, an open source Java-written program that is now at version 1.31 and is used for many imaging applications, including those that that span the gamut from skin analysis to neuroscience. ImageJ is in the public domain and runs on any operating system (OS). ImageJ is easy to use and can do many imaging manipulations. A very large and knowledgeable group makes up the user community for ImageJ. Topics covered are imaging abilities; cross platform; image formats support as of June 2004; extensions, including macros and plug-ins; and imaging library. NIH reports tens of thousands of downloads at a rate of about 24,000 per month currently. ImageJ can read most of the widely used and significant formats used in biomedical images. Manipulations supported are read/write of image files and operations on separate pixels, image regions, entire images, and volumes (stacks in ImageJ). Basic operations supported include convolution, edge detection, Fourier transform, histogram and particle analyses, editing and color manipulation, and more advanced operations, as well as visualization. For assistance in using ImageJ, users e-mail each other, and the user base is highly knowledgeable and will answer requests on the mailing list. A thorough manual with many examples and illustrations has been written by Tony Collins of the Wright Cell Imaging Facility at Toronto Western Research Institute and is available, along with other listed resources, via the Web.

11,336 citations


"Accumulation of FlAsH/Lumio Green i..." refers methods in this paper

  • ...Images were processed using AxioVision 4.4 (Carl Zeiss) and ImageJ (Abramoff et al. 2004)....

    [...]


Journal ArticleDOI
10 Jul 1998-Science
TL;DR: This system provides a recipe for slightly modifying a target protein so that it can be singled out from the many other proteins inside live cells and fluorescently stained by small nonfluorescent dye molecules added from outside the cells.
Abstract: Recombinant proteins containing four cysteines at the i , i + 1, i + 4, and i + 5 positions of an α helix were fluorescently labeled in living cells by extracellular administration of 4′,5′-bis(1,3,2-dithioarsolan-2-yl)fluorescein. This designed small ligand is membrane-permeant and nonfluorescent until it binds with high affinity and specificity to the tetracysteine domain. Such in situ labeling adds much less mass than does green fluorescent protein and offers greater versatility in attachment sites as well as potential spectroscopic and chemical properties. This system provides a recipe for slightly modifying a target protein so that it can be singled out from the many other proteins inside live cells and fluorescently stained by small nonfluorescent dye molecules added from outside the cells.

1,529 citations


"Accumulation of FlAsH/Lumio Green i..." refers methods in this paper

  • ...Labeling of recombinant proteins using the tetracysteine–biarsenical system developed by Tsien and coworkers (Griffin et al. 1998) appears to be particularly promising....

    [...]


Journal ArticleDOI
TL;DR: Live cell imaging, in combination with photobleaching, energy transfer or fluorescence correlation spectroscopy are providing unprecedented insights into the movement of proteins and their interactions with cellular components.
Abstract: Since the advent of the green fluorescent protein, the subcellular localization, mobility, transport routes and binding interactions of proteins can be studied in living cells. Live cell imaging, in combination with photobleaching, energy transfer or fluorescence correlation spectroscopy are providing unprecedented insights into the movement of proteins and their interactions with cellular components. Remarkably, these powerful techniques are accessible to non-specialists using commercially available microscope systems.

1,174 citations


"Accumulation of FlAsH/Lumio Green i..." refers background in this paper

  • ...Investigating the distribution and dynamics of proteins inside living cells by fluorescence microscopy has been greatly simplified by genetically encoded recombinant fusion proteins of green fluorescent protein and its variants (Lippincott-Schwartz et al. 2001)....

    [...]


Journal ArticleDOI
19 Apr 2002-Science
TL;DR: This approach was used to show that newly synthesized connexin43 was transported predominantly in 100- to 150-nanometer vesicles to the plasma membrane and incorporated at the periphery of existing gap junctions, whereas older connexins were removed from the center of the plaques into pleiomorphic vesicle of widely varying sizes.
Abstract: Recombinant proteins containing tetracysteine tags can be successively labeled in living cells with different colors of biarsenical fluorophores so that older and younger protein molecules can be sharply distinguished by both fluorescence and electron microscopy. Here we used this approach to show that newly synthesized connexin43 was transported predominantly in 100- to 150-nanometer vesicles to the plasma membrane and incorporated at the periphery of existing gap junctions, whereas older connexins were removed from the center of the plaques into pleiomorphic vesicles of widely varying sizes. Selective imaging by correlated optical and electron microscopy of protein molecules of known ages will clarify fundamental processes of protein trafficking in situ.

898 citations


"Accumulation of FlAsH/Lumio Green i..." refers background in this paper

  • ...2003) and pulse-chase experiments (Gaietta et al. 2002)....

    [...]

  • ...This system cannot only be used for fluorescence detection of proteins in living cells, but also for correlative electron microscopy (Gaietta et al. 2002), fluorophore-assisted light inactivation (FALI) (Marek and Davis 2002; Tour et al....

    [...]

  • ...This system cannot only be used for fluorescence detection of proteins in living cells, but also for correlative electron microscopy (Gaietta et al. 2002), fluorophore-assisted light inactivation (FALI) (Marek and Davis 2002; Tour et al. 2003) and pulse-chase experiments (Gaietta et al. 2002)....

    [...]


Journal ArticleDOI
TL;DR: Both the theoretical simulation and experimental data show that photobleaching of fluorescein in microscopy is, in general, not a single-exponential process.
Abstract: An investigation on the photobleaching behavior of fluorescein in microscopy was carried out through a systematic analysis of photobleaching mechanisms. The individual photochemical reactions of fluorescein were incorporated into a theoretical analysis and mathematical simulation to study the photochemical processes leading to photobleaching of fluorescein in microscopy. The photobleaching behavior of free and bound fluorescein has also been investigated by experimental means. Both the theoretical simulation and experimental data show that photobleaching of fluorescein in microscopy is, in general, not a single-exponential process. The simulation suggests that the non-single-exponential behavior is caused by the oxygen-independent, proximity-induced triplet-triplet or triplet-ground state dye reactions of bound fluorescein in microscopy. The single-exponential process is a special case of photobleaching behavior when the reactions between the triplet dye and molecular oxygen are dominant.

598 citations


"Accumulation of FlAsH/Lumio Green i..." refers background in this paper

  • ...FlAsH/ Lumio Green is a biarsenical variant of fluorescein, which is known to photobleach rapidly (Song et al. 1995)....

    [...]