scispace - formally typeset
Open AccessJournal ArticleDOI

Accumulation of FlAsH/Lumio Green in active mitochondria can be reversed by β-mercaptoethanol for specific staining of tetracysteine-tagged proteins

Reads0
Chats0
TLDR
A staining protocol was established using β-mercaptoethanol as thiol binding site competitor resulting in a specific staining of tetracysteine-tagged reggie-1/flotillin-2 of adequate signal to noise ratio, so that the more toxic and inconvenient ethanedithiol could be avoided.
Abstract
Recent advances in the field of small molecule labels for live cell imaging promise to overcome some of the limitations set by the size of fluorescent proteins. We tested the tetracysteine–biarsenical labeling system in live cell fluorescence microscopy of reggie-1/flotillin-2 in HeLa and N2a cells. In both cell types, the biarsenical staining reagent FlAsH/Lumio Green accumulated in active mitochondria and led to mitochondrial swelling. This is indicative of toxic side effects caused by arsenic, which should be considered when this labeling system is to be used in live cell imaging. Mitochondrial accumulation of FlAsH/Lumio Green was reversed by addition of low concentrations of thiol-containing reagents during labeling and a subsequent high stringency thiol wash. Both ethanedithiol and β-mercaptoethanol proved to be effective. We therefore established a staining protocol using β-mercaptoethanol as thiol binding site competitor resulting in a specific staining of tetracysteine-tagged reggie-1/flotillin-2 of adequate signal to noise ratio, so that the more toxic and inconvenient ethanedithiol could be avoided. Furthermore, we show that staining efficiency was greatly enhanced by introducing a second tetracysteine sequence in tandem.

read more

Content maybe subject to copyright    Report

Matthi
as F. Langhorst Æ Selda Genisyuerek
Claudia A.O. Stuermer
Accumulation of FlAsH/Lumio Green in active mitochondria
can be reversed by b-mercaptoethanol for specific staining
of tetracysteine-tagged proteins
Abstract Recent advances in the field of small molecule
labels for live cell imaging promise to overcome some of
the limitations set by the size of fluorescent proteins. We
tested the tetracysteine–biarsenical labeling system in
live cell fluore scence microscopy of reggie-1/flotillin-2 in
HeLa and N2a cells. In both cell types, the biarsenical
staining reagent FlAsH/Lumio Green accumulated in
active mitochondria and led to mitochondrial swelling.
This is indicative of toxic side effects caused by arsenic,
which should be considered when this labeling system is
to be used in live cell imaging. Mitochondrial accumu-
lation of FlAsH/Lumio Green was reversed by addition
of low concentrations of thiol-containing reagents dur-
ing labeling and a subsequent high stringency thiol wash.
Both ethanedithiol and b-mercaptoethanol proved to be
effective. We therefore established a staining protocol
using b-mercaptoethanol as thiol binding site competitor
resulting in a specific staining of tetracysteine-tagged
reggie-1/flotillin-2 of adequate signal to noise ratio, so
that the more toxic and inconvenient ethanedithiol could
be avoided. Furthermore, we show that staining effi-
ciency was greatly enhanced by introducing a second
tetracysteine sequence in tandem.
Keywords Tetracysteine Æ Biarsenical fluorescent
ligands Æ Reggie/flotillin Æ Live cell imaging Æ
Fluorescence microscopy
Introduction
Investigating the distribution and dynamics of proteins
inside living cells by fluorescence microscopy has been
greatly simplified by genetically encoded recombinant
fusion proteins of green fluorescent protein and its
variants (Lippincott-Schwartz et al. 2001). However,
fusion to fluorescent proteins, which have a molecular
mass of 25–30 kDa, can severely impair the function
and/or localization especially of small proteins. Smaller
labels may overcome some of these problems by
reducing steric hindrance (reviewed by Chen and Ting
2005). Labeling of recombinant prote ins using the
tetracysteine–biarsenical system developed by Tsien
and coworkers (Griffin et al. 1998) appears to be
particularly promising. It is based on complex forma-
tion between a biarsenical variant of fluorescein
(fluorescein arsenical helix binder, FlAsH) or resorufin
(ReAsH) and a genetically encoded tetracysteine motif
of only 6–12 amino acids. This system cannot only be
used for fluorescence detection of proteins in living
cells, but also for correlative electron microscopy
(Gaietta et al. 2002), fluorophore-assisted light inacti-
vation (FALI) (Marek and Davis 2002; Tour et al.
2003) an d pulse-chase experiments (Gaietta et al.
2002). Furthermore, FlAsH and ReAsH are now
commercially available as Lumio Green and Lumio
Red from Invitrogen.
We are using the tetracysteine–biarsenical labeling
system to investigate the localization and dynamics of
reggie-1/flotillin-2. This protein of 47 kDa was discov-
ered in our lab as a protein upregulated in goldfish ret-
inal ganglion cells during axon regeneration after optic
nerve injury (Schulte et al. 1997; Lang et al. 1998). Its
exact function is still unknown, but it most probably
acts as a lipid raft-associated scaffolding protein, defin-
ing specialized microdomains for multiprotein complex
assembly at cellular membranes (reviewed in Langhorst
et al. 2005).
M.F. Langhorst and S. Genisyuerek contributed equally to this
work.
M. F. Langhorst (&) Æ S. Genisyuerek Æ C. A.O. Stuermer
Developmental Neurobiology Group, Department of Biology,
University of Konstanz, Universitaetsstr. 10, 78457 Konstanz,
Germany
E-mail: Matthiaslanghorst@email.de
Tel.: +49-7531-882128
Fax: +49-7531-883894
First Publ. in: Histochemistry and cell biology ; 125 (2006), 3. - S. 743-747
DOI: 10.1007/s00418-005-0136-3
Konstanzer Online-Publikations-System (KOPS)
URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-180729

Materials and methods
Reagents
Lumio Green and Disperse Blue were purchased from
Invitrogen (Karlsruhe, Germany) as part of the ‘‘Lumio
in cell labeling kit’’. Mitotracker Orange and Rhoda-
mine 123 were from Molecular Probes (Leiden, Neth-
erlands). b-mercaptoethanol (2-ME), ethanedithiol
(EDT), formaldehy de and rotenone were from Sigma
(Munich, Germany). Oligonucleotides were from Oper-
on Biotechnology (Cologne, Germany). Enzymes for
molecular biology were from New England Biolabs
(Beverly, USA) or Fermentas (St. Leon-Rot, Germany).
Cloning of reggie-1-tetracy steine expression vectors
To construct expression vectors for reggie-1/flotillin-2 C-
terminally fused to one (R1FL-Cys
4
) or two tetracyste-
ine-sequences (R1FL-(Cys
4
)
2
) , we excised EGFP from
pR1FL-EGFP, a plasmid containing full-length rat
reggie-1 cloned into pEGF P-N1 (Clontech) (Neumann-
Giesen et al. 2004), using BamHI and NotI. By ligation
with annealed oligonucleotides (fw: 5¢-GATCCATT-
CCTGAACTGTTGTCCCGGCTGCTGCATGGAG-
CCTTGA-3¢; rv: 5¢-GGCCTCAA GGCTCCATGCAG
CAGCCGGGACAACAGTTCAGGAAT G-3¢) we then
introduced the first tetracysteine sequence coding for
FLNCCPGCCMEP*, a tetracysteine sequence with
optimized flanking amino acids for particularly high
affinity for biarsenical ligands (Martin et al. 2005). To
introduce a second tetracysteine sequence, we linearized
the resulting plasmid using BamHI, dephosphorylated
the ends using calf intestine alkaline phosphatase and
ligated phosphorylated, annealed oligonucleotides (fw:
Phos-5¢-GAT CACTC TCTTAACTGCTGCCCGGGG-
TGTTGTATGGAACCCGTAGTCCTT-3¢ , rv: Phos-
5¢-GATCAAGGACTACGG GTTCCATACAACACC-
CCGGGCAGCAGTTAAGAGAGT-3¢)encodingSLNC-
CPGCCMEP. The use of different codons made colony
PCR screening with a specific reverse primer (5¢-AT-
CAAGGACTACGGGTT-3¢) possible. All constructs
were finally sequenced for verifica tion. This strategy
proved to be a fast, reliable and versatile way to intro-
duce tetracysteine sequences wherever a restriction site
was available or could be introduced.
Cell culture and transfection
N2a and HeLa cells were cultured in MEM (Invitrogen)
supplemented with 100 units/ml Penicillin, 50 mg/ml
Streptavidin, 1 mM sodium pyruvate, 2 mM glutamine
and 10% foetal calf serum (all Invitrogen) at 37 C and
5% CO
2
. Cells were transfected using Lipofectamine
2000 according to the manufacturers instructions. For
labeling, transfected cells were plated onto chambered
coverslips (Nunc, Rochester, USA) coated with poly-
L-
lysine and laminin (both Sigma) 24 h after transfection
and labeled 48 h post transfection.
Labeling of HeLa and N2a cells
Cells were washed with Hepes-buffered salt solution
(HBSS) (135 mM NaCl, 4.5 mM KCl, 1.5 mM CaCl
2
,
0.5 mM MgCl
2
, 5.6 mM Glucose, 25 mM HEPES, pH
7.4) and incubated with 0.3–0.5 lM FlAsH/Lumio
Green and—if indicated—0.6–4 lM 2-ME or EDT in
HBSS for 1 h. After labeling, cells were thoroughly
washed with HBSS and either imaged immediately or
incubated with 100 lM 2-ME or EDT in HBSS for
30 min before microscopic analysis.
Fluorescence microscopy
Images were acquired on an Axiovert 200 M using a
Plan-Apochromat 63· objective (NA=1.4) and an
Axiocam MRm operated at full resolution (12 bit,
1,388·1,040 pixels; all Carl Zeiss, Jena, Germany).
Where indicated, the Apotome system (Carl Zeiss) was
used to acquire confocal images by structured illumi-
nation. Images were processed using AxioVision 4.4
(Carl Zeiss) and ImageJ (Abramoff et al. 2004).
Results and discussion
FlAsH/Lumio Green accumulates in active
mitochondria
In the absence of thiol reagents during labeling with
FlAsH/Lumio Green, we observed in both HeLa and
N2a cells a very bright staining of mitochondria, which
we verified by co-staining using the mitochondrial
marker Mitotracker Orange (Fig. 1 a). This bright
mitochondrial labeling by FlAsH/Lumio Green pre-
vented the identification of potentially present specific
staining of reggie-1/flotillin-2 in cells transfected with
R1FL-Cys
4
or R1FL-(Cys
4
)
2
. Furthermore, after
FlAsH/Lumio Green labeling we often observed a dis-
tinct change of mitochondria morphology towards a
round, swollen appearance (Fig. 1b) indicating that the
labeling procedure has a toxic effect on mitochondria.
Addition of low concentrations (1–2 lM) of the dithiol
ethanedithiol (EDT) during labeling and a 30 min wash
of the labeled cells with 100 lM EDT greatly reduced
the mitochondrial accumulation of FlAsH/Lumio
Green, but it did not completely prevent the morpho-
logical changes. Surprisingly, the monothiol b-mercap-
toethanol (2-ME) proved to be similarly effective in
reversing mitochondrial accumulation of FlAsH/Lumio
Green (Fig. 1c).
To test whether the accumulation of FlAsH/Lumio
Green in mitochondria is activity-dependent, we inhib-
744

ited mitochondrial respiration by a short incubation
with 5 lM Rotenone (Lindahl and Oberg 1960). This
treatment abolished labeling of the mitochondria by
FlAsH/Lumio Green (Fig. 1d), suggesting that accu-
mulation and/or fluorescence of FlAsH/ Lumio Green in
mitochondria is somehow linked to mitochondrial
activity. Uptake of Rhodamine 123 into mitochondria,
which only occurs in active mitochondria and which
could readily be inhibited by rotenone treatment, was,
however, not affected by the 2-ME concentrations nec-
essary to reduce mitochondrial staining by FlAsH/Lu-
mio Green (data not shown), suggesting that the thiol
reagents act only by competing with cellular thiol
binding sites in mitochondria and do not impair mito-
chondrial function.
Several other treatments were reported to reduce
background staining while using the tetracysteine–biar-
senical system. Disperse Blue is a hydrophobic dye
which suppresses unspecific staining by blocking
hydrophobic binding sites (Griffin et al. 2000) and is part
of the labeling kit sold by Invitrogen. Addition of
pyruvate was also suggested as a means of reducing
background staining (Griffin et al. 2000). However, both
reagents had no discernible effect on mitochondrial
accumulation of FlAsH/Lumio Green.
The FlAsH/Lumio Green-induced morphological
changes of the mitochondria might reflect toxic effects of
arsenic, which is known to disrupt mitochondrial func-
tion by generating reactive oxygen species and perturb-
ing the GSH redox system (Dalton 2002). These side
effects might severely compromise the value of this
labeling system for live cell imaging. In our experiments,
including EDT or 2-ME in the labeling procedure was
mandatory, as a high stringency wash with EDT or 2-
ME prove d to be the only efficient way to reverse the
accumulation of FlAsH/Lumio Green in mitochondria.
Furthermore, addition of low concentrations of thiols
during labeling reduced morphological changes of the
mitochondria induced by FlAsH/Lumio Green at least
to a certain extent, probably by reversing the toxic effect
of arsenic on the GSH redox system (Zmuda and Frie-
denson 1983). Still, the toxic side effects of the biarsen-
Fig. 1 Mitochondrial
accumulation of FlAsH/Lumio
Green and toxic side effects a
Untransfected N2a cells were
labeled with 1 lM FlAsH/
Lumio Green and Mitotracker
Orange in the absence of thiol-
containing reagents for 1 h,
washed and analyzed by
fluorescence microscopy.
FlAsH/Lumio Green clearly
accumulated in mitochondria
stained by MitoTracker (a
confocal slice acquired by
structured illumination is
shown). b Many cells stained as
described above exhibited
aberrant mitochondria with a
round, swollen appearance c
Untransfected N2a cells were
stained with 1 lM FlAsH/
Lumio Green + 4 lM 2-ME
for 1 h, washed and incubated
with 100 lM 2-ME for 30 min.
This treatment reversed
mitochondrial accumulation of
FlAsH/Lumio Green and
resulted in a diffuse background
staining. d Cells were labeled
with 1 lM FlAsH/Lumio
Green for 1 h, washed and then
incubated with 5 lM rotenone
for 15 min. Inhibition of
mitochondrial respiration by
rotenone also reversed the
mitochondrial accumulation of
FlAsH/Lumio Green
fluorescence. All bars,10lm
745

ical labeling reagent on mitochondria have to be con-
sidered when choosing a labeling system, especially for
long-term live cell imaging.
Specific staining of tetracysteine-tagged reggie in the
presence of b-mercaptoetha nol
So far, all publications using the tetracysteine–biar-
senical labeling system utilized EDT to suppress
unspecific binding of the biarsenical fluorescent staining
reagent to cellular thiols. EDT is highly toxic, not
readily soluble in physiological salt solutions and even
after extensive washing, the stench emanating from
EDT-treated samples is almost unbearable. Encouraged
by our observation that the mitochon drial accumula-
tion of FlAsH/Lumio Green was efficiently inhibited by
addition of 2-ME, we tested whether we could establish
conditions for specific labeling of tetracysteine-tagg ed
reggie-1/flotillin-2 in the presence of 2-ME only. Incu-
bation of cells transiently transfected with R1FL-Cys
4
with 0.3–0.5 lM FlAsH/Lumio Green in the presence
of an 4–6· excess of 2-ME for 1 h, followed by a
30 min wash with 100 lM 2-ME resulted in a clear,
reggie-1/flotillin-2-specific staining of the plasma
membrane and intracellular vesicles (Fig. 2a), very
much comparable to the localization observed in
R1FL-EGFP expressing cells (Fig. 2c). This clearly
demonstrates that specific labeling using the tetracy-
steine–biarsenical system can be achieved by replacing
EDT with the less toxic, easier to handle 2-ME. This
suggests that the bivalency of EDT is not indispensable
and that an excess of a monothiol like 2-ME can also
efficiently suppress unspecific binding of the biarsenical
fluorescent ligand to cellular thiols.
The staining efficiency using R1FL-Cys
4
with a
single tetracysteine-sequence was relatively low, but
introducing a second tetracysteine sequence in tandem
improved staining efficiency significa ntly (Fig. 2b).
Although all constructs were expressed at similar levels
(data not shown), the staining efficiency could be more
than doubled by a second tetracysteine sequence. We
therefore suggest testing different constructs with
variable numbers and localizations of tetracysteine
sequences, as not only localization of the tag seems to
be crucial (N-terminal tagging of reggie-1/flotillin-2 for
example results in a mislocalized fusion protein most
probably because myristoylation of Gly2 is inhibited),
but staining efficiency and intensity might also be
influenced. A prev ious report on FlAsH-labeling in
yeast cells stated that introducing a tandem tetracy-
steine sequence increased the photostability of the
labeling (Andresen et al. 2004).
The signal to noise ratio obtained by our staining
procedure was adequate for many applications, but in
comparison with R1FL-EGFP expressing cells (Fig. 2c)
clearly inferior. The lower signal to noise ratio was
caused by a diffuse FlAsH/Lumio Green staining of the
whole cell, whic h is most probably due to binding of the
biarsenical reage nt to intracellular cysteine-rich proteins
as previously described (Stroffekova et al. 2001). This
background staining was further reduced by increasing
the 2-ME concentration during the high stringency
wash, but this led to a severe loss of cells due to
detachment from the coverslip, as similarly observed for
EDT-treatment.
The fact that the FlAsH/Lumio Green label was
subject to photobleaching was another problem. FlAsH/
Lumio Green is a biarsenical variant of fluorescein,
which is known to photoblea ch rapidly (Song et al.
1995). The recent description of a rational design of new
fluorescein variants with improved properties (Urano
et al. 2005) might allow the development of more
photostable variants, which would greatly facilitate live
cell imaging of FlAsH/Lumio Green labeled proteins.
In summary we have demonstrated that specific
staining of tetracysteine-tagged proteins using biarseni-
cal fluorescent ligands is possible without ethanedithiol,
which we replaced by b-mercaptoethanol, which is less
toxic and more convenient to handle. A thiol-rea gent
proved to be mandatory in the labeling procedure to
reverse the accumulation of FlAsH/Lumio Green in
active mitochondria. The mitochondrial accumulation
of the biarsenical labeling reagent was accompanied by
mitochondrial swelling, which could only partly reversed
by thiol-containing reagents. These toxic side effects
might limit the usefulness of the tetracysteine–biarseni-
cal labeling system for live cell imaging.
Fig. 2 R1FL-Cys
4
/ R1FL-(Cys
4
)
2
labeling in N2a cells using b-
mercaptoethanol: N2a cells were transiently transfected with
R1FL-Cys
4
(a), R1FL-(Cys
4
)
2
(b) or R1FL-EGFP (c). R1FL-
Cys
4
/R1FL-(Cys
4
)
2
expressing cells were stained with 0.3 lM
FlAsH/Lumio Green + 1.2 lM 2-ME with a subsequent wash
with 100 lM 2-ME and analyzed by fluorescence microscopy. All
bars,10lm
746

Acknowledgements We thank Gonzalo Solis and Alexander Reuter
for their help with cloning of the R1-Cys
4
-expression vectors. This
work was supported by grants from the Deutsche Forschungs-
gemeinschaft DFG (SFB-TR11), the Ministerium Forschung,
Wissenschaft und Kunst Baden-Wu
¨
rttemberg (TSE program) and
the Fonds der Chemischen Industrie.
References
Abramoff MD, Magelhaes PJ, Ram SJ (2004) Image processing
with image. J Biophotonics Int 11:36–42
Andresen M, Schmitz-Salue R, Jakobs S (2004) Short tetracysteine
tags to beta-tubulin demonstrate the significance of small labels
for live cell imaging. Mol Biol Cell 15:5616–5622
Chen I, Ting AY (2005) Site-specific labeling of proteins with small
molecules in live cells. Curr Opin Biotechnol 16:35–40
Dalton WS (2002) Targeting the mitochondria: an exciting new
approach to myeloma therapy. Commentary re: Bahlis NJ
et al. (2002) Feasibility and correlates of arsenic trioxide
combined with ascorbic acid-mediated depletion of intracel-
lular glutathione for the treatment of relapsed/refractory
multiple myeloma. Clin Cancer Res 8:3658–3668. Clin Cancer
Res 8:3643–3645
Gaietta G, Deerinck TJ, Adams SR, Bouwer J, Tour O, Laird DW,
Sosinsky GE, Tsien RY, Ellisman MH (2002) Multicolor and
electron microscopic imaging of connexin trafficking. Science
296:503–507
Griffin BA, Adams SR, Jones J, Tsien RY (2000) Fluorescent
labeling of recombinant proteins in living cells with FlAsH.
Methods Enzymol 327:565–578
Griffin BA, Adams SR, Tsien RY (1998) Specific covalent labeling
of recombinant protein molecules inside live cells. Science
281:269–272
Lang DM, Lommel S, Jung M, Ankerhold R, Petrausch B, Laes-
sing U, Wiechers MF, Plattner H, Stuermer CA (1998) Identi-
fication of reggie-1 and reggie-2 as plasmamembrane-associated
proteins which cocluster with activated GPI-anchored cell
adhesion molecules in non-caveolar micropatches in neurons.
J Neurobiol 37: 502–523
Langhorst MF, Reuter A, Stuermer CA (2005) Scaffolding micr-
odomains and beyond: the function of reggie/flotillin proteins.
Cell Mol Life Sci 62:2228–2240
Lindahl PE, Oberg KE (1960) Mechanism of the physiological
action of rotenone. Nature 187:784
Lippincott-Schwartz J, Snapp E, Kenworthy A (2001) Studying
protein dynamics in living cells. Nat Rev Mol Cell Biol 2:
444–456
Marek KW, Davis GW (2002) Transgenically encoded protein
photoinactivation (FlAsH-FALI): acute inactivation of syn-
aptotagmin I. Neuron 36:805–813
Martin BR, Giepmans BN, Adams SR, Tsien RY (2005) Mam-
malian cell-based optimization of the biarsenical-binding tet-
racysteine motif for improved fluorescence and affinity. Nat
Biotechnol 23(10):1308–1314
Neumann-Giesen C, Falkenbach B, Beicht P, Claasen S, Luers G,
Stuermer CA, Herzog V, Tikkanen R (2004) Membrane and
raft association of reggie-1/flotillin-2: role of myristoylation,
palmitoylation and oligomerization and induction of filopodia
by overexpression. Biochem J 378:509–518
Schulte T, Paschke KA, Laessing U, Lottspeich F, Stuermer CA
(1997) Reggie-1 and reggie-2, two cell surface proteins ex-
pressed by retinal ganglion cells during axon regeneration.
Development 124:577–87
Song L, Hennink EJ, Young IT, Tanke HJ (1995) Photobleaching
kinetics of fluorescein in quantitative fluorescence microscopy.
Biophys J 68:2588–600
Stroffekova K, Proenza C, Beam KG (2001) The protein-labeling
reagent FLASH-EDT2 binds not only to CCXXCC motifs but
also non-specifically to endogenous cysteine-rich proteins.
Pflugers Arch 442:859–66
Tour O, Meijer RM, Zacharias DA, Adams SR, Tsien RY (2003)
Genetically targeted chromophore-assisted light inactivation.
Nat Biotechnol 21:1505–1508
Urano Y, Kamiya M, Kanda K, Ueno T, Hirose K, Nagano T
(2005) Evolution of fluorescein as a platform for finely tunable
fluorescence probes. J Am Chem Soc 127:4888–4894
Zmuda J, Friedenson B (1983) Changes in intracellular glutathione
levels in stimulated and unstimulated lymphocytes in the pres-
ence of 2-mercaptoethanol or cysteine. J Immunol 130:362–364
747

Citations
More filters
Journal ArticleDOI

Selective Labeling of Proteins with Chemical Probes in Living Cells

TL;DR: This work has shown that selective labeling of proteins with small molecules introduces novel chemical and physical properties into proteins, enabling the target protein to be investigated or manipulated with various techniques.
Journal ArticleDOI

Surveying protein structure and function using bis-arsenical small molecules.

TL;DR: This Account describes recent progress in the development of small-molecule tools with improved utility in living cells, and highlights studies that have explored how broadly bipartite tetracysteine display can be employed and that have navigated the conformational boundary conditions favoring success.
Journal ArticleDOI

Coumarin-Based Fluorogenic Probes for No-Wash Protein Labeling

TL;DR: A fluorescent protein-labeling strategy was developed in which a protein of interest is genetically tagged with a short peptide sequence presenting two Cys residues that can selectively react with synthetic fluorogenic reagents, allowing the rapid and specific labeling of intracellular POIs.
Journal ArticleDOI

Reggies/flotillins regulate cytoskeletal remodeling during neuronal differentiation via CAP/ponsin and Rho GTPases

TL;DR: In this paper, a trans-negative reggie-1/flotillin-2 deletion mutant, R1EA, was found to interfere with oligomerization of the reggies and flotillins, inhibited insulin-like growth factor (IGF)-induced neurite outgrowth in N2a neuroblastoma cells and impaired in vitro differentiation of primary rat hippocampal neurons.
Journal ArticleDOI

Specific biarsenical labeling of cell surface proteins allows fluorescent- and biotin-tagging of amyloid precursor protein and prion proteins.

TL;DR: A novel technique, Instant with DTT, EDT, And Low temperature (IDEAL)-labeling, is reported, for rapid and specific FlAsH-labeling of tetracysteine-tagged cell surface proteins by using prion protein (PrP) and amyloid precursor protein (APP) as models.
References
More filters

Image processing with ImageJ

TL;DR: ImageJ is an open source Java-written program that is used for many imaging applications, including those that that span the gamut from skin analysis to neuroscience, and can read most of the widely used and significant formats used in biomedical images.
Journal ArticleDOI

Specific Covalent Labeling of Recombinant Protein Molecules Inside Live Cells

TL;DR: This system provides a recipe for slightly modifying a target protein so that it can be singled out from the many other proteins inside live cells and fluorescently stained by small nonfluorescent dye molecules added from outside the cells.
Journal ArticleDOI

Studying protein dynamics in living cells.

TL;DR: Live cell imaging, in combination with photobleaching, energy transfer or fluorescence correlation spectroscopy are providing unprecedented insights into the movement of proteins and their interactions with cellular components.
Journal ArticleDOI

Multicolor and Electron Microscopic Imaging of Connexin Trafficking

TL;DR: This approach was used to show that newly synthesized connexin43 was transported predominantly in 100- to 150-nanometer vesicles to the plasma membrane and incorporated at the periphery of existing gap junctions, whereas older connexins were removed from the center of the plaques into pleiomorphic vesicle of widely varying sizes.
Journal ArticleDOI

Photobleaching kinetics of fluorescein in quantitative fluorescence microscopy

TL;DR: Both the theoretical simulation and experimental data show that photobleaching of fluorescein in microscopy is, in general, not a single-exponential process.
Related Papers (5)