Análise de diferentes primers utilizados na PCR visando ao diagnóstico da tuberculose no Estado do Amazonas
01 Aug 2004-Jornal Brasileiro De Pneumologia (Sociedade Brasileira de Pneumologia e Tisiologia)-Vol. 30, Iss: 4, pp 343-349
TL;DR: The protocol for processing the clinical samples prior to PCR analysis and the specific primers used to amplify the 123bp IS6110 fragment showed a greater efficiency in diagnosing pulmonary (paucibacillary) tuberculosis in comparison to published data.
Abstract: INTRODUCAO: Ha diferentes primers sendo testados para a deteccao do DNA do Mycobacterium tuberculosis. A acuidade da reacao em cadeia da polimerase (PCR) depende da existencia da sequencia alvo no bacilo e de os testes serem realizados em cepas isoladas ou em amostras clinicas. OBJETIVO: Verificar a presenca das sequencias de DNA alvo mais relatadas na literatura para o diagnostico da tuberculose em amostras clinicas usando como controle positivo as respectivas cepas de M. tuberculosis isoladas. METODO: Oitenta e uma amostras clinicas de pacientes com suspeita de tuberculose foram submetidas a baciloscopia e cultivo. A tecnica de PCR foi realizada nas amostras clinicas e cepas isoladas com primers especificos para os seguintes alvos: IS6110, 65 kDa, 38 kDa e MPB64. RESULTADOS: Em 24 amostras com baciloscopia e cultivo negativos, a PCR tambem foi negativa com todos os primers testados. Em 19 amostras com baciloscopia positiva e nas cepas isoladas obteve-se 100% de resultados positivos nas PCR, exceto nas PCR em amostras clinicas com os primers para a sequencia MPB64 (89,4%). Em 38 amostras com baciloscopia negativa e cultivo positivo, as PCR tiveram resultados variaveis, sendo que os primers especificos que amplificam o fragmento de 123 pb da sequencia IS6110 foram os que forneceram os maiores percentuais de positividade (92,1%), concordância diagnostica (0,9143), co-positividade (94,7%) e co-negatividade (100%). CONCLUSAO: As sequencias IS6110, 38 kDa, MPB64 e 65 kDa foram encontradas no genoma de todas as cepas de M. tuberculosis isoladas desses pacientes do Estado do Amazonas. O protocolo utilizado no processamento das amostras clinicas e os primers especificos utilizados para amplificacao do fragmento de 123 pb da sequencia IS6110 demonstraram maior eficiencia no diagnostico da tuberculose pulmonar (paucibacilar) em comparacao com a literatura.
Citations
More filters
TL;DR: The data suggest that the presence of IS6110 correlates more closely with the diagnosis of clinical tuberculosis than that of 65kDa, 38kDa and 85B proteins.
69 citations
TL;DR: This HGMS-enabled extraction method provides a robust instrument-free method for magnetic bead-based nucleic acids extraction, potentially suitable for field implementation of nucleic acid testing.
Abstract: Nucleic acid-based diagnostic tests often require isolation and concentration of nucleic acids from biological samples. Commercial purification kits are difficult to use in low-resource settings be...
40 citations
Journal Article•
TL;DR: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis.
Abstract: Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB) is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR) in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS) 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ) method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF), 12 fine needle aspiration (FNA), 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN) for acid fast bacilli (AFB) and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB). Results: Of the 178 specimens, 10 (5.61%) were ZN smear positive for AFB, six (3.37%) were L-J culture positive from 10 AFB smear positive cases and 48 (26.96%) were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.
35 citations
TL;DR: Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis when compared to patients with the pulmonary form of the disease, regardless of the type of biological sample used.
24 citations
Cites background from "Análise de diferentes primers utili..."
...In the literature, only sputum, blood and cerebrospinal fluid (CSF) have been shown to represent good substrates for PCR analysis (20)....
[...]
TL;DR: 16s rRNA sequencing on DNA extracted from FFPE tissue can help make an etiological diagnosis in some cases where only paraffin blocks are available, and culture using routine media with prolonged incubation is often adequate to isolate the organism.
Abstract: Cystic neutrophilic granulomatous mastitis (CNGM) is a histologically characterized variant of granulomatous lobular mastitis that is associated with lipophilic Corynebacterium species. It remains a largely underrecognized entity in India. Our aim was to study CNGM in the Asian Indian population and explore if 16s rRNA sequencing could be used on formalin-fixed paraffin-embedded (FFPE) tissue to identify the causative organism. We studied 24 cases with histological features of CNGM with hematoxylin and eosin, Gram, Ziehl-Neelsen, and Periodic acid-Schiff stains. Tuberculosis-polymerase chain reaction and 16s rRNA gene sequencing on DNA extracted from FFPE was attempted (N = 23). Gram-positive bacilli were seen in 20/24 cases. Routine culture with prolonged incubation yielded Corynebacterium species in 8 cases; 7 of these cases were evaluated by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for species identification. C matruchotti was identified in one case by BD Phoenix. MALDI-TOF MS identified the remaining 7 cases as C kroppenstedtii (N = 4) and C tuberculostearicum (N = 2), with no identification in one. Corynebacteria were identified by 16s rRNA sequencing on DNA extracted from FFPE in 12/23 cases using a primer targeting the V5-V6 region that was found to be more conserved in Corynebacterium species. All cases were negative for the diagnosis of tuberculosis. CNGM can be identified by routine stains. Culture using routine media with prolonged incubation is often adequate to isolate the organism. 16s rRNA sequencing on DNA extracted from FFPE tissue can help make an etiological diagnosis in some cases where only paraffin blocks are available.
19 citations
References
More filters
TL;DR: A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR) and may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
Abstract: A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
746 citations
"Análise de diferentes primers utili..." refers background in this paper
...This characteristic helps increase the sensitivity of PCR over that obtained in the amplification of single DNA sequences(4)....
[...]
...433 Jornal Brasileiro de Pneumologia 30(4) - Jul/Ago de 2004...
[...]
...Two distinct pairs of primers were tested for the detection of the IS6110 region: one that promotes amplification of a 123-bp fragment(4) and another that promotes that of a 541-bp fragment(13)....
[...]
...437 Jornal Brasileiro de Pneumologia 30(4) - Jul/Ago de 2004...
[...]
...435 Jornal Brasileiro de Pneumologia 30(4) - Jul/Ago de 2004...
[...]
TL;DR: Five different genetic elements have been found to be associated with genetic rearrangements in Mycobacterium tuberculosis complex strains and the insertion sequence IS6110 is presently the most frequently used genetic marker for strain differentiation of M. tuberculosis.
Abstract: Five different genetic elements have been found to be associated with genetic rearrangements in Mycobacterium tuberculosis complex strains. Of these elements, the insertion sequence IS6110 is presently the most frequently used genetic marker for strain differentiation of M. tuberculosis. In the present study we compared five genetic elements for their potentials to differentiate a given cluster of M. tuberculosis strains. Because of the presence of only a single copy of IS6110 or two IS6110 copies at the same chromosomal locus, a large number of strains could not be differentiated by IS6110 fingerprinting. Most strains, including the low-copy-number IS6110 strains, could be differentiated by fingerprinting with the 36-bp direct repeat or the polymorphic GC-rich repetitive DNA element. Less discriminative power was obtained with the major polymorphic tandem repeat and the insertion element IS1081. One strain which did not contain IS6110 DNA was encountered. Until now, this element has invariantly been found to be present in all M. tuberculosis complex strains. On the basis of classical taxonomic criteria and sequencing of the 16S rRNA gene, this strain was shown to be a genuine M. tuberculosis strain. Therefore, the use of this element as a target for polymerase chain reaction-facilitated detection of M. tuberculosis should be reconsidered.
512 citations
"Análise de diferentes primers utili..." refers background in this paper
...However, the IS6110 sequence was reported to be absent from an Mtb strain isolated in India(5), and homologous sequences have been detected in potentially pathogenic mycobacterium strains such as M....
[...]
...However, the IS6110 sequence was reported to be absent from an Mtb strain isolated in India(5), and homologous sequences have been detected in potentially pathogenic mycobacterium strains such as M. intracellulare, M. fortuitum, M. kansasii, M. xenopi, M. malmoense and M. chelonae(6,7)....
[...]
TL;DR: Although uncommon in children, multidrug-resistant tuberculosis is also increasing and treatment will often involve longer courses of therapy with second-line antituberculosis drugs, which is a major determinant of the success of drug treatment.
Abstract: There has been a recent global resurgence of tuberculosis in both resource-limited and some resource-rich countries. Several factors have contributed to this resurgence, including HIV infection, overcrowding, and immigration. Childhood tuberculosis represents a sentinel event in the community suggesting recent transmission from an infectious adult. The diagnosis of tuberculosis in children is traditionally based on chest radiography, tuberculin skin testing, and mycobacterial staining/culture although these investigations may not always be positive in children with tuberculosis. Newer diagnostic methods, such as PCR and immune-based methods, are increasingly being used although they are not widely available and have a limited role in routine clinical practice. Diagnostic approaches have been developed for use in resource-limited settings; however, these diagnostic methods have not been standardised and few have been validated. Short-course, multidrug treatment has been adopted as standard therapy for adults and children with tuberculosis, with or without directly observed therapy. Compliance is a major determinant of the success of drug treatment. Although uncommon in children, multidrug-resistant tuberculosis is also increasing and treatment will often involve longer courses of therapy with second-line antituberculosis drugs. Treatment of latent infection and chemoprophylaxis of young household contacts is also recommended for tuberculosis prevention, although this may not always be carried out, particularly in high incidence areas.
293 citations
"Análise de diferentes primers utili..." refers background in this paper
...However, the use of PCR in the detection of Mycobacterium tuberculosis (Mtb) has produced varying results, especially in relation to the sensitivity of the test(1,2,3)....
[...]
TL;DR: PCR was the most sensitive technique; it detected 15 of 20 cases of highly probable TBM (based on clinical features), 4 of 7 probable cases, and 3 of 7 possible cases, while ELISA detected 11 of the highly probable cases and 2 each of the probable and possible cases.
260 citations
TL;DR: In this article, the authors evaluated the performance of two methods for detection of tuberculosis in clinical sputum specimens, namely, the polymerase chain reaction (PCR) using oligonucleotides based on the repetitive sequence (IS986) of Mycobacterium tuberculosis as a primer, and the Gen-Probe Amplified mycobacteria Tuberculosis Direct Test (MTD), which combines an M. tuberculosis rRNA amplification method with the hybridization protection assay format.
Abstract: The polymerase chain reaction (PCR) using oligonucleotides based on the repetitive sequence (IS986) of Mycobacterium tuberculosis as a primer and the Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test (MTD), which combines an M. tuberculosis rRNA amplification method with the hybridization protection assay format, were evaluated for detection of M. tuberculosis in clinical samples. The detection limits of these two assay systems based on nucleic acid amplification for cultured M. tuberculosis were less than 10 cells per reaction. A total of 135 sputum specimens were examined by the two assay systems. The PCR and the MTD systems for detection of M. tuberculosis gave overall positivity rates of 84.2% (32 of 38) and 91.9% (34 of 37), respectively, as compared with 71.9% (23 of 32) by smear and 96.9% (31 of 32) by culture in the liquid medium MB-Check. Procedures for sample preparation used in the two methods were different. Although the sensitivities of the PCR and MTD appeared to be similar to that of culture with the MB-Check system, the two methods based on nucleic acid amplification should be very useful for rapid detection of M. tuberculosis infections without the long time required for culture of M. tuberculosis.
194 citations