Bidirectional introgressive hybridization between a cattle and human schistosome species.
TL;DR: In this article, nuclear and mitochondrial markers revealed unexpected natural interactions between a bovine and human Schistosoma species: S. bovis and S. haematobium.
Abstract: Schistosomiasis is a disease of great medical and veterinary importance in tropical and subtropical regions, caused by parasitic flatworms of the genus Schistosoma (subclass Digenea). Following major water development schemes in the 1980s, schistosomiasis has become an important parasitic disease of children living in the Senegal River Basin (SRB). During molecular parasitological surveys, nuclear and mitochondrial markers revealed unexpected natural interactions between a bovine and human Schistosoma species: S. bovis and S. haematobium, respectively. Hybrid schistosomes recovered from the urine and faeces of children and the intermediate snail hosts of both parental species, Bulinus truncatus and B. globosus, presented a nuclear ITS rRNA sequence identical to S. haematobium, while the partial mitochondrial cox1 sequence was identified as S. bovis. Molecular data suggest that the hybrids are not 1st generation and are a result of parental and/or hybrid backcrosses, indicating a stable hybrid zone. Larval stages with the reverse genetic profile were also found and are suggested to be F1 progeny. The data provide indisputable evidence for the occurrence of bidirectional introgressive hybridization between a bovine and a human Schistosoma species. Hybrid species have been found infecting B. truncatus, a snail species that is now very abundant throughout the SRB. The recent increase in urinary schistosomiasis in the villages along the SRB could therefore be a direct effect of the increased transmission through B. truncatus. Hybridization between schistosomes under laboratory conditions has been shown to result in heterosis (higher fecundity, faster maturation time, wider intermediate host spectrum), having important implications on disease prevalence, pathology and treatment. If this new hybrid exhibits the same hybrid vigour, it could develop into an emerging pathogen, necessitating further control strategies in zones where both parental species overlap.
Citations
More filters
01 Jun 2019
TL;DR: Understanding about the links between emerging infectious diseases and food production, finding strong associations worldwide is synthesized, to address the public health challenge posed by feeding 11 billion people.
Abstract: Infectious diseases are emerging globally at an unprecedented rate while global food demand is projected to increase sharply by 2100. Here, we synthesize the pathways by which projected agricultural expansion and intensification will influence human infectious diseases and how human infectious diseases might likewise affect food production and distribution. Feeding 11 billion people will require substantial increases in crop and animal production that will expand agricultural use of antibiotics, water, pesticides and fertilizer, and contact rates between humans and both wild and domestic animals, all with consequences for the emergence and spread of infectious agents. Indeed, our synthesis of the literature suggests that, since 1940, agricultural drivers were associated with >25% of all - and >50% of zoonotic - infectious diseases that emerged in humans, proportions that will likely increase as agriculture expands and intensifies. We identify agricultural and disease management and policy actions, and additional research, needed to address the public health challenge posed by feeding 11 billion people.
309 citations
TL;DR: Mass drug administration has already made significant improvements to global health and productivity and has the potential for further successes, particularly where incorporated into sanitation and education programmes, however logistical, financial and biological challenges remain.
Abstract: Mass drug administration (MDA) is a means of delivering safe and inexpensive essential medicines based on the principles of preventive chemotherapy, where populations or sub-populations are offered treatment without individual diagnosis. High-coverage MDA in endemic areas aims to prevent and alleviate symptoms and morbidity on the one hand and can reduce transmission on the other, together improving global health. MDA is the recommended strategy of the World Health Organisation to control or eliminate several neglected tropical diseases (NTDs). More than 700 million people now receive these essential NTD medicines annually. The combined cost of integrated NTD MDA has been calculated to be in the order of $0.50 per person per year. Activities have recently been expanded due, in part, to the proposed attempt to eliminate certain NTDs in the coming two decades. More than 1.9 billion people need to receive MDA annually across several years if these targets are to be met. Such extensive coverage will require additional avenues of financial support, expanded monitoring and evaluation focusing on impact and drug efficacy, as well as new diagnostic tools and social science strategies to encourage adherence. MDA is a means to help reduce the burden of disease, and hence poverty, among the poorest sector of populations. It has already made significant improvements to global health and productivity and has the potential for further successes, particularly where incorporated into sanitation and education programmes. However logistical, financial and biological challenges remain.
217 citations
University of Montpellier1, Institut national de la recherche agronomique2, Natural History Museum3, Katholieke Universiteit Leuven4, Royal Museum for Central Africa5, University of Valencia6, Spanish National Research Council7, University of Corsica Pascal Paoli8, University of Toulouse9, Institut de veille sanitaire10
TL;DR: The molecular data suggest that the parasites were imported into Corsica by individuals infected in west Africa, specifically Senegal, and hybridisation between S haematobium and the cattle schistosome S bovis had a putative role in this outbreak.
Abstract: Summary Background Schistosomiasis is a snail-borne parasitic disease endemic in several tropical and subtropical countries. However, in the summer of 2013, an unexpected outbreak of urogenital schistosomiasis occurred in Corsica, with more than 120 local people or tourists infected. We used a multidisciplinary approach to investigate the epidemiology of urogenital schistosomiasis in Corsica, aiming to elucidate the origin of the outbreak. Methods We did parasitological and malacological surveys at nine potential sites of infection. With the snails found, we carried out snail–parasite compatibility experiments by exposing snails to schistosome larvae recovered from the urine of a locally infected Corsican patient. Genetic analysis of both mitochondrial ( cox1 ) and nuclear (internal transcribed spacer) DNA data from the Schistosoma eggs or miracidia recovered from the infected patients was conducted to elucidate the epidemiology of this outbreak. Findings We identified two main infection foci along the Cavu River, with many Bulinus truncatus snails found in both locations. Of the 3544 snails recovered across all sites, none were naturally infected, but laboratory-based experimental infections confirmed their compatibility with the schistosomes isolated from patients. Molecular characterisation of 73 eggs or miracidia isolated from 12 patients showed infection with Schistosoma haematobium, S haematobium–Schistosoma bovis hybrids, and S bovis . Further sequence data analysis also showed that the Corsican schistosomes were closely related to those from Senegal in west Africa. Interpretation The freshwater swimming pools of the Cavu River harbour many B truncatus snails, which are capable of transmitting S haematobium -group schistosomes. Our molecular data suggest that the parasites were imported into Corsica by individuals infected in west Africa, specifically Senegal. Hybridisation between S haematobium and the cattle schistosome S bovis had a putative role in this outbreak, showing how easily and rapidly urogenital schistosomiasis can be introduced and spread into novel areas where Bulinus snails are endemic, and how hybridisation could increase the colonisation potential of schistosomes. Furthermore our results show the potential risk of schistosomiasis outbreaks in other European areas, warranting close monitoring and surveillance of all potential transmission foci. Funding WHO, ANSES, RICET, and the Ministry of Health and Consumption.
207 citations
TL;DR: There is a wealth of immunologic studies that have been carried out in experimental and human schistosomiasis that can be classified into three main areas: immunopathogenesis, resistance to reinfection and diagnostics, which contribute to the public health response to humanSchistosome infections.
Abstract: There is a wealth of immunologic studies that have been carried out in experimental and human schistosomiasis that can be classified into three main areas: immunopathogenesis, resistance to reinfection and diagnostics. It is clear that the bulk of, if not all, morbidity due to human schistosomiasis results from immune-response-based inflammation against eggs lodged in the body, either as regulated chronic inflammation or resulting in fibrotic lesions. However, the exact nature of these responses, the antigens to which they are mounted and the mechanisms of the critical regulatory responses are still being sorted out. It is also becoming apparent that protective immunity against schistosomula as they develop into adult worms develops slowly and is hastened by the dying of adult worms, either naturally or when they are killed by praziquantel. However, as with anti-egg responses, the responsible immune mechanisms and inducing antigens are not clearly established, nor are any potential regulatory responses known. Finally, a wide variety of immune markers, both cellular and humoral, can be used to demonstrate exposure to schistosomes, and immunologic measurement of schistosome antigens can be used to detect, and thus diagnose, active infections. All three areas contribute to the public health response to human schistosome infections.
199 citations
TL;DR: An update of the latest developments in schistosomiasis diagnosis, including microscopic techniques, rapid diagnostic tests for antigen detection, polymerase chain reaction (PCR) assays and proxy markers for morbidity assessments, is provided.
183 citations
References
More filters
TL;DR: Version 4 of MEGA software expands on the existing facilities for editing DNA sequence data from autosequencers, mining Web-databases, performing automatic and manual sequence alignment, analyzing sequence alignments to estimate evolutionary distances, inferring phylogenetic trees, and testing evolutionary hypotheses.
Abstract: We announce the release of the fourth version of MEGA software, which expands on the existing facilities for editing DNA sequence data from autosequencers, mining Web-databases, performing automatic and manual sequence alignment, analyzing sequence alignments to estimate evolutionary distances, inferring phylogenetic trees, and testing evolutionary hypotheses. Version 4 includes a unique facility to generate captions, written in figure legend format, in order to provide natural language descriptions of the models and methods used in the analyses. This facility aims to promote a better understanding of the underlying assumptions used in analyses, and of the results generated. Another new feature is the Maximum Composite Likelihood (MCL) method for estimating evolutionary distances between all pairs of sequences simultaneously, with and without incorporating rate variation among sites and substitution pattern heterogeneities among lineages. This MCL method also can be used to estimate transition/transversion bias and nucleotide substitution pattern without knowledge of the phylogenetic tree. This new version is a native 32-bit Windows application with multi-threading and multi-user supports, and it is also available to run in a Linux desktop environment (via the Wine compatibility layer) and on Intel-based Macintosh computers under the Parallels program. The current version of MEGA is available free of charge at (http://www.megasoftware.net).
29,021 citations
Book•
30 Jan 1997
TL;DR: This chapter discusses natural hybridization in the context of reproductive parameters, species concepts, and the role that technology has played in shaping human evolution.
Abstract: Chapter 1 Natural Hybridization: Definitions and History Chapter 2 Natural Hybridization and Species Concepts Chapter 3 Natural Hybridization: Frequency Chapter 4 Reproductive Parameters and Natural Hybridization Chapter 5 Natural Hybridization: Concepts and Theory Chapter 6 Natural Hybridization: Outcomes Chapter 7 Natural Hybridization: Emerging Patterns
2,053 citations
"Bidirectional introgressive hybridi..." refers background in this paper
...The increasing use of molecular techniques in ecological studies has revealed many cases of hybridization and introgression in plants and animals [1–3], but examples in metazoan parasites are rare [2]....
[...]
TL;DR: This work surveys studies of natural interspecific hybridization in plants and a variety of animals to show that limited invasions of the genome are widespread, with potentially important consequences in evolutionary biology, speciation, biodiversity, and conservation.
Abstract: Hybridization between species is commonplace in plants, but is often seen as unnatural and unusual in animals. Here, I survey studies of natural interspecific hybridization in plants and a variety of animals. At least 25% of plant species and 10% of animal species, mostly the youngest species, are involved in hybridization and potential introgression with other species. Species in nature are often incompletely isolated for millions of years after their formation. Therefore, much evolution of eventual reproductive isolation can occur while nascent species are in gene-flow contact, in sympatry or parapatry, long after divergence begins. Although the relative importance of geographic isolation and gene flow in the origin of species is still unknown, many key processes involved in speciation, such as 'reinforcement' of post-mating isolation by the evolution of assortative mating, will have ample opportunity to occur in the presence of continuing gene flow. Today, DNA sequence data and other molecular methods are beginning to show that limited invasions of the genome are widespread, with potentially important consequences in evolutionary biology, speciation, biodiversity, and conservation.
1,897 citations
TL;DR: A concept that reconciles views of hybridization and ecological speciation theory is developed and adds a new twist to this debate, which predisposes colonizing populations to rapid adaptive diversification under disruptive or divergent selection.
Abstract: Whether interspecific hybridization is important as a mechanism that generates biological diversity is a matter of controversy. Whereas some authors focus on the potential of hybridization as a source of genetic variation, functional novelty and new species, others argue against any important role, because reduced fitness would typically render hybrids an evolutionary dead end. By drawing on recent developments in the genetics and ecology of hybridization and on principles of ecological speciation theory, I develop a concept that reconciles these views and adds a new twist to this debate. Because hybridization is common when populations invade new environments and potentially elevates rates of response to selection, it predisposes colonizing populations to rapid adaptive diversification under disruptive or divergent selection. I discuss predictions and suggest tests of this hybrid swarm theory of adaptive radiation and review published molecular phylogenies of adaptive radiations in light of the theory.
1,599 citations
"Bidirectional introgressive hybridi..." refers background in this paper
...Hybridization can have a major impact on adaptive radiation and diversification of the species under study [2,4], and in the case of parasites, this may also have an impact on the host and the epidemiology of disease....
[...]
TL;DR: The sequence of a region of the rapidly evolving mitochondrial genome is useful as a marker of species and strain identity and as a preliminary indication of evolutionary divergence within the genus Echinococcus.
984 citations
"Bidirectional introgressive hybridi..." refers background in this paper
...5 mM MgCl2 (Eurogentec), 200 mM of each dNTP (Amersham Pharmacia Biotech, Sweden), 1 mM of each primer (Eurogentec; Asmit1 TTTTTTGGTCATCCTGAGGTGTAT [41] and Schisto 39 TAATGCATMGGAAA-AAAACA [42], ITS4: TCCTCCGCTTATTGATATGC and ITS5: GGAAGTAAAAGTCGTAACAAG [43], 1 unit Taq polymerase (Eurogentec), milli-Q water and the individual purified FTA disc....
[...]
...Multiplex PCR and sequencing at the KUL The complete ITS rRNA (981 bp)+partial cox1 mtDNA (585 bp) multiplex PCR amplifications were performed in a total reaction volume of 25 ml and consisted of 16 PCR buffer (Eurogentec), 1.5 mM MgCl2 (Eurogentec), 200 mM of each dNTP (Amersham Pharmacia Biotech, Sweden), 1 mM of each primer (Eurogentec; Asmit1 TTTTTTGGTCATCCTGAGGTGTAT [41] and Schisto 39 TAATGCATMGGAAA-AAAACA [42], ITS4: TCCTCCGCTTATTGATATGC and ITS5: GGAAGTAAAAGTCGTAACAAG [43], 1 unit Taq polymerase (Eurogentec), milli-Q water and the individual purified FTA disc....
[...]