Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors
Citations
12,265 citations
10,746 citations
Cites background from "Breaking the Code of DNA Binding Sp..."
...> U6-St_tracrRNA(7-97) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAA TTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATA ATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTA ACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTTACTT AAATCTTGCAGAAGCTACAAAGATAAGGCTTCATGCCGAAATCAACACCCTGTCATTTTATGGC AGGGTGTTTTCGTTATTTAA...
[...]
8,663 citations
8,197 citations
Cites background from "Breaking the Code of DNA Binding Sp..."
...This RNA-mediated editing process was notably rapid, with the first detectable GFP+ cells appearing ~20 hours post transfection compared with ~40 hours for the AAVS1 TALENs....
[...]
...Elucidating the frequency and underlying causes of offtarget nuclease activity (15, 16) induced by CRISPR, ZFN (17, 18), and TALEN (19, 20) genome-engineering tools will be of utmost importance for safe genome modification and perhaps for gene therapy....
[...]
...1B) and compared their activity to that of a previously described TAL effector nuclease heterodimer (TALEN) targeting the same region (11)....
[...]
...The ease of retargeting our system to modify genomic sequences greatly exceeds that of comparable ZFNs and TALENs, while offering similar or greater efficiencies (4)....
[...]
...Although we noted no apparent toxicity associated with Cas9/gRNA expression, work with zinc finger nucleases (ZFNs) and TALENs has shown that nicking only one strand further reduces toxicity....
[...]
4,774 citations
References
10,539 citations
1,345 citations
900 citations
739 citations
648 citations