scispace - formally typeset
Search or ask a question
Journal ArticleDOI

Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors

11 Dec 2009-Science (American Association for the Advancement of Science)-Vol. 326, Iss: 5959, pp 1509-1512
TL;DR: The functionality of a distinct type of DNA binding domain is described and allows the design ofDNA binding domains for biotechnology.
Abstract: The pathogenicity of many bacteria depends on the injection of effector proteins via type III secretion into eukaryotic cells in order to manipulate cellular processes. TAL (transcription activator-like) effectors from plant pathogenic Xanthomonas are important virulence factors that act as transcriptional activators in the plant cell nucleus, where they directly bind to DNA via a central domain of tandem repeats. Here, we show how target DNA specificity of TAL effectors is encoded. Two hypervariable amino acid residues in each repeat recognize one base pair in the target DNA. Recognition sequences of TAL effectors were predicted and experimentally confirmed. The modular protein architecture enabled the construction of artificial effectors with new specificities. Our study describes the functionality of a distinct type of DNA binding domain and allows the design of DNA binding domains for biotechnology.
Citations
More filters
Journal ArticleDOI
15 Feb 2013-Science
TL;DR: The type II prokaryotic CRISPR (clustered regularly interspaced short palindromic repeats)/Cas adaptive immune system has been shown to facilitate RNA-guided site-specific DNA cleavage as discussed by the authors.
Abstract: Functional elucidation of causal genetic variants and elements requires precise genome editing technologies. The type II prokaryotic CRISPR (clustered regularly interspaced short palindromic repeats)/Cas adaptive immune system has been shown to facilitate RNA-guided site-specific DNA cleavage. We engineered two different type II CRISPR/Cas systems and demonstrate that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells. Cas9 can also be converted into a nicking enzyme to facilitate homology-directed repair with minimal mutagenic activity. Lastly, multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology.

12,265 citations

01 Feb 2013
TL;DR: Two different type II CRISPR/Cas systems are engineered and it is demonstrated that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology.
Abstract: Genome Editing Clustered regularly interspaced short palindromic repeats (CRISPR) function as part of an adaptive immune system in a range of prokaryotes: Invading phage and plasmid DNA is targeted for cleavage by complementary CRISPR RNAs (crRNAs) bound to a CRISPR-associated endonuclease (see the Perspective by van der Oost). Cong et al. (p. 819, published online 3 January) and Mali et al. (p. 823, published online 3 January) adapted this defense system to function as a genome editing tool in eukaryotic cells. A bacterial genome defense system is adapted to function as a genome-editing tool in mammalian cells. [Also see Perspective by van der Oost] Functional elucidation of causal genetic variants and elements requires precise genome editing technologies. The type II prokaryotic CRISPR (clustered regularly interspaced short palindromic repeats)/Cas adaptive immune system has been shown to facilitate RNA-guided site-specific DNA cleavage. We engineered two different type II CRISPR/Cas systems and demonstrate that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells. Cas9 can also be converted into a nicking enzyme to facilitate homology-directed repair with minimal mutagenic activity. Lastly, multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology.

10,746 citations


Cites background from "Breaking the Code of DNA Binding Sp..."

  • ...> U6-St_tracrRNA(7-97) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAA TTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATA ATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTA ACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTTACTT AAATCTTGCAGAAGCTACAAAGATAAGGCTTCATGCCGAAATCAACACCCTGTCATTTTATGGC AGGGTGTTTTCGTTATTTAA...

    [...]

Journal ArticleDOI
TL;DR: A set of tools for Cas9-mediated genome editing via nonhomologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, as well as generation of modified cell lines for downstream functional studies are described.
Abstract: Targeted nucleases are powerful tools for mediating genome alteration with high precision. The RNA-guided Cas9 nuclease from the microbial clustered regularly interspaced short palindromic repeats (CRISPR) adaptive immune system can be used to facilitate efficient genome engineering in eukaryotic cells by simply specifying a 20-nt targeting sequence within its guide RNA. Here we describe a set of tools for Cas9-mediated genome editing via nonhomologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, as well as generation of modified cell lines for downstream functional studies. To minimize off-target cleavage, we further describe a double-nicking strategy using the Cas9 nickase mutant with paired guide RNAs. This protocol provides experimentally derived guidelines for the selection of target sites, evaluation of cleavage efficiency and analysis of off-target activity. Beginning with target design, gene modifications can be achieved within as little as 1-2 weeks, and modified clonal cell lines can be derived within 2-3 weeks.

8,663 citations

Journal ArticleDOI
15 Feb 2013-Science
TL;DR: The type II bacterial CRISPR system is engineer to function with custom guide RNA (gRNA) in human cells to establish an RNA-guided editing tool for facile, robust, and multiplexable human genome engineering.
Abstract: Bacteria and archaea have evolved adaptive immune defenses, termed clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems, that use short RNA to direct degradation of foreign nucleic acids. Here, we engineer the type II bacterial CRISPR system to function with custom guide RNA (gRNA) in human cells. For the endogenous AAVS1 locus, we obtained targeting rates of 10 to 25% in 293T cells, 13 to 8% in K562 cells, and 2 to 4% in induced pluripotent stem cells. We show that this process relies on CRISPR components; is sequence-specific; and, upon simultaneous introduction of multiple gRNAs, can effect multiplex editing of target loci. We also compute a genome-wide resource of ~190 K unique gRNAs targeting ~40.5% of human exons. Our results establish an RNA-guided editing tool for facile, robust, and multiplexable human genome engineering.

8,197 citations


Cites background from "Breaking the Code of DNA Binding Sp..."

  • ...This RNA-mediated editing process was notably rapid, with the first detectable GFP+ cells appearing ~20 hours post transfection compared with ~40 hours for the AAVS1 TALENs....

    [...]

  • ...Elucidating the frequency and underlying causes of offtarget nuclease activity (15, 16) induced by CRISPR, ZFN (17, 18), and TALEN (19, 20) genome-engineering tools will be of utmost importance for safe genome modification and perhaps for gene therapy....

    [...]

  • ...1B) and compared their activity to that of a previously described TAL effector nuclease heterodimer (TALEN) targeting the same region (11)....

    [...]

  • ...The ease of retargeting our system to modify genomic sequences greatly exceeds that of comparable ZFNs and TALENs, while offering similar or greater efficiencies (4)....

    [...]

  • ...Although we noted no apparent toxicity associated with Cas9/gRNA expression, work with zinc finger nucleases (ZFNs) and TALENs has shown that nicking only one strand further reduces toxicity....

    [...]

Journal ArticleDOI
28 Nov 2014-Science
TL;DR: The power of the CRISPR-Cas9 technology to systematically analyze gene functions in mammalian cells, study genomic rearrangements and the progression of cancers or other diseases, and potentially correct genetic mutations responsible for inherited disorders is illustrated.
Abstract: The advent of facile genome engineering using the bacterial RNA-guided CRISPR-Cas9 system in animals and plants is transforming biology. We review the history of CRISPR (clustered regularly interspaced palindromic repeat) biology from its initial discovery through the elucidation of the CRISPR-Cas9 enzyme mechanism, which has set the stage for remarkable developments using this technology to modify, regulate, or mark genomic loci in a wide variety of cells and organisms from all three domains of life. These results highlight a new era in which genomic manipulation is no longer a bottleneck to experiments, paving the way toward fundamental discoveries in biology, with applications in all branches of biotechnology, as well as strategies for human therapeutics.

4,774 citations

References
More filters
Journal ArticleDOI
16 Nov 2006-Nature
TL;DR: A detailed understanding of plant immune function will underpin crop improvement for food, fibre and biofuels production and provide extraordinary insights into molecular recognition, cell biology and evolution across biological kingdoms.
Abstract: Many plant-associated microbes are pathogens that impair plant growth and reproduction. Plants respond to infection using a two-branched innate immune system. The first branch recognizes and responds to molecules common to many classes of microbes, including non-pathogens. The second responds to pathogen virulence factors, either directly or through their effects on host targets. These plant immune systems, and the pathogen molecules to which they respond, provide extraordinary insights into molecular recognition, cell biology and evolution across biological kingdoms. A detailed understanding of plant immune function will underpin crop improvement for food, fibre and biofuels production.

10,539 citations

Journal ArticleDOI
TL;DR: A novel approach for enhancing the accumulation of natural products based on activation tagging by Agrobacterium-mediated transformation with a T-DNA that carries cauliflower mosaic virus 35S enhancer sequences at its right border is reported.
Abstract: Plants produce a wide array of natural products, many of which are likely to be useful bioactive structures. Unfortunately, these complex natural products usually occur at very low abundance and with restricted tissue distribution, thereby hindering their evaluation. Here, we report a novel approach for enhancing the accumulation of natural products based on activation tagging by Agrobacterium-mediated transformation with a T-DNA that carries cauliflower mosaic virus 35S enhancer sequences at its right border. Among ∼5000 Arabidopsis activation-tagged lines, we found a plant that exhibited intense purple pigmentation in many vegetative organs throughout development. This upregulation of pigmentation reflected a dominant mutation that resulted in massive activation of phenylpropanoid biosynthetic genes and enhanced accumulation of lignin, hydroxycinnamic acid esters, and flavonoids, including various anthocyanins that were responsible for the purple color. These phenotypes, caused by insertion of the viral enhancer sequences adjacent to an MYB transcription factor gene, indicate that activation tagging can overcome the stringent genetic controls regulating the accumulation of specific natural products during plant development. Our findings suggest a functional genomics approach to the biotechnological evaluation of phytochemical biodiversity through the generation of massively enriched tissue sources for drug screening and for isolating underlying regulatory and biosynthetic genes.

1,345 citations

Journal ArticleDOI
08 May 2009-Science
TL;DR: It turns out that the important contribution of PTI to disease resistance is masked by pathogen virulence effectors that have evolved to suppress it.
Abstract: For many years, research on a suite of plant defense responses that begin when plants are exposed to general microbial elicitors was underappreciated, for a good reason: There has been no critical experimental demonstration of their importance in mediating plant resistance during pathogen infection. Today, these microbial elicitors are named pathogen- or microbe-associated molecular patterns (PAMPs or MAMPs) and the plant responses are known as PAMP-triggered immunity (PTI). Recent studies provide an elegant explanation for the difficulty of demonstrating the role of PTI in plant disease resistance. It turns out that the important contribution of PTI to disease resistance is masked by pathogen virulence effectors that have evolved to suppress it.

900 citations

Journal ArticleDOI
21 May 2009-Nature
TL;DR: High-frequency ZFN-stimulated gene targeting at endogenous plant genes, namely the tobacco acetolactate synthase genes (ALS SuRA and SuRB), for which specific mutations are known to confer resistance to imidazolinone and sulphonylurea herbicides are demonstrated.
Abstract: An efficient method for making directed DNA sequence modifications to plant genes (gene targeting) is at present lacking, thereby frustrating efforts to dissect plant gene function and engineer crop plants that better meet the world's burgeoning need for food, fibre and fuel. Zinc-finger nucleases (ZFNs)-enzymes engineered to create DNA double-strand breaks at specific loci-are potent stimulators of gene targeting; for example, they can be used to precisely modify engineered reporter genes in plants. Here we demonstrate high-frequency ZFN-stimulated gene targeting at endogenous plant genes, namely the tobacco acetolactate synthase genes (ALS SuRA and SuRB), for which specific mutations are known to confer resistance to imidazolinone and sulphonylurea herbicides. Herbicide-resistance mutations were introduced into SuR loci by ZFN-mediated gene targeting at frequencies exceeding 2% of transformed cells for mutations as far as 1.3 kilobases from the ZFN cleavage site. More than 40% of recombinant plants had modifications in multiple SuR alleles. The observed high frequency of gene targeting indicates that it is now possible to efficiently make targeted sequence changes in endogenous plant genes.

739 citations

Journal ArticleDOI
26 Oct 2007-Science
TL;DR: It is shown that AvrBs3 induces the expression of a master regulator of cell size, upa20, which encodes a transcription factor containing a basic helix-loop-helix domain that provokes developmental reprogramming of host cells by mimicking eukaryotic transcription factors.
Abstract: Pathogenicity of many Gram-negative bacteria relies on the injection of effector proteins by type III secretion into eukaryotic cells, where they modulate host signaling pathways to the pathogen's benefit. One such effector protein injected by Xanthomonas into plants is AvrBs3, which localizes to the plant cell nucleus and causes hypertrophy of plant mesophyll cells. We show that AvrBs3 induces the expression of a master regulator of cell size, upa20, which encodes a transcription factor containing a basic helix-loop-helix domain. AvrBs3 binds to a conserved element in the upa20 promoter via its central repeat region and induces gene expression through its activation domain. Thus, AvrBs3 and likely other members of this family provoke developmental reprogramming of host cells by mimicking eukaryotic transcription factors.

648 citations