Case Study: Prolonged Infectious SARS-CoV-2 Shedding from an Asymptomatic Immunocompromised Individual with Cancer.
TL;DR: The data indicate that certain immunocompromised patients may shed infectious virus for longer durations than previously recognized, and detection of subgenomic RNA is recommended in persistently SARS-CoV-2 positive individuals as a proxy for shedding of infectious virus.
About: This article is published in Cell.The article was published on 2020-12-23 and is currently open access. It has received 573 citations till now.
Citations
More filters
TL;DR: A review of the literature on mutations of the SARS-CoV-2 spike protein, the primary antigen, focusing on their impacts on antigenicity and contextualizing them in the protein structure is presented in this article.
Abstract: Although most mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome are expected to be either deleterious and swiftly purged or relatively neutral, a small proportion will affect functional properties and may alter infectivity, disease severity or interactions with host immunity. The emergence of SARS-CoV-2 in late 2019 was followed by a period of relative evolutionary stasis lasting about 11 months. Since late 2020, however, SARS-CoV-2 evolution has been characterized by the emergence of sets of mutations, in the context of ‘variants of concern’, that impact virus characteristics, including transmissibility and antigenicity, probably in response to the changing immune profile of the human population. There is emerging evidence of reduced neutralization of some SARS-CoV-2 variants by postvaccination serum; however, a greater understanding of correlates of protection is required to evaluate how this may impact vaccine effectiveness. Nonetheless, manufacturers are preparing platforms for a possible update of vaccine sequences, and it is crucial that surveillance of genetic and antigenic changes in the global virus population is done alongside experiments to elucidate the phenotypic impacts of mutations. In this Review, we summarize the literature on mutations of the SARS-CoV-2 spike protein, the primary antigen, focusing on their impacts on antigenicity and contextualizing them in the protein structure, and discuss them in the context of observed mutation frequencies in global sequence datasets. The evolution of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has been characterized by the emergence of mutations and so-called variants of concern that impact virus characteristics, including transmissibility and antigenicity. In this Review, members of the COVID-19 Genomics UK (COG-UK) Consortium and colleagues summarize mutations of the SARS-CoV-2 spike protein, focusing on their impacts on antigenicity and contextualizing them in the protein structure, and discuss them in the context of observed mutation frequencies in global sequence datasets.
2,047 citations
University of KwaZulu-Natal1, Oswaldo Cruz Foundation2, Universidade Federal de Minas Gerais3, University of Cape Town4, National Health Laboratory Service5, Centre for the AIDS Programme of Research in South Africa6, University of the Witwatersrand7, Stellenbosch University8, Max Planck Society9, University of the Free State10, Walter Sisulu University11, University of California, Riverside12, University of Oxford13, Temple University14, University of Washington15
TL;DR: A newly arisen lineage of SARS-CoV-2 (designated 501Y.V2) was identified in South Africa after the first wave of the epidemic in a severely affected metropolitan area (Nelson Mandela Bay) that is located on the coast of the Eastern Cape province.
Abstract: Continued uncontrolled transmission of SARS-CoV-2 in many parts of the world is creating conditions for substantial evolutionary changes to the virus1,2. Here we describe a newly arisen lineage of SARS-CoV-2 (designated 501Y.V2; also known as B.1.351 or 20H) that is defined by eight mutations in the spike protein, including three substitutions (K417N, E484K and N501Y) at residues in its receptor-binding domain that may have functional importance3-5. This lineage was identified in South Africa after the first wave of the epidemic in a severely affected metropolitan area (Nelson Mandela Bay) that is located on the coast of the Eastern Cape province. This lineage spread rapidly, and became dominant in Eastern Cape, Western Cape and KwaZulu-Natal provinces within weeks. Although the full import of the mutations is yet to be determined, the genomic data-which show rapid expansion and displacement of other lineages in several regions-suggest that this lineage is associated with a selection advantage that most plausibly results from increased transmissibility or immune escape6-8.
1,171 citations
TL;DR: In this article, a picture has begun to emerge that reveals that CD4+ T cells, CD8+ Tcells, and neutralizing antibodies all contribute to control SARS-CoV-2 in both non-hospitalized and hospitalized cases of COVID-19.
1,092 citations
Imperial College London1, University of São Paulo2, University of Oxford3, University of Edinburgh4, Federal University of Uberlandia5, Instituto Adolfo Lutz6, Universidade Federal de Minas Gerais7, State University of Campinas8, National Institute of Amazonian Research9, Harvard University10, University of California, Los Angeles11, Temple University12, University of Southampton13, University of Birmingham14, Katholieke Universiteit Leuven15, Royal Veterinary College16, University of Copenhagen17
TL;DR: In this article, the authors used a two-category dynamical model that integrates genomic and mortality data to estimate that P.1 may be 1.7-to 2.4-fold more transmissible and that previous (non-P.1) infection provides 54 to 79% of the protection against infection with P.
Abstract: Cases of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection in Manaus, Brazil, resurged in late 2020 despite previously high levels of infection. Genome sequencing of viruses sampled in Manaus between November 2020 and January 2021 revealed the emergence and circulation of a novel SARS-CoV-2 variant of concern. Lineage P.1 acquired 17 mutations, including a trio in the spike protein (K417T, E484K, and N501Y) associated with increased binding to the human ACE2 (angiotensin-converting enzyme 2) receptor. Molecular clock analysis shows that P.1 emergence occurred around mid-November 2020 and was preceded by a period of faster molecular evolution. Using a two-category dynamical model that integrates genomic and mortality data, we estimate that P.1 may be 1.7- to 2.4-fold more transmissible and that previous (non-P.1) infection provides 54 to 79% of the protection against infection with P.1 that it provides against non-P.1 lineages. Enhanced global genomic surveillance of variants of concern, which may exhibit increased transmissibility and/or immune evasion, is critical to accelerate pandemic responsiveness.
985 citations
University of KwaZulu-Natal1, Universidade Federal de Minas Gerais2, Oswaldo Cruz Foundation3, University of Cape Town4, National Health Laboratory Service5, Centre for the AIDS Programme of Research in South Africa6, University of the Witwatersrand7, Stellenbosch University8, Max Planck Society9, University of the Free State10, Walter Sisulu University11, University of California, Riverside12, University of Oxford13, Temple University14, University of Washington15
TL;DR: In this paper, the authors describe a new SARS-CoV-2 lineage (501Y.V2) characterised by eight lineage-defining mutations in the spike protein, including three at important residues in the receptor-binding domain (K417N, E484K and N501Y).
Abstract: Summary Continued uncontrolled transmission of the severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) in many parts of the world is creating the conditions for significant virus evolution. Here, we describe a new SARS-CoV-2 lineage (501Y.V2) characterised by eight lineage-defining mutations in the spike protein, including three at important residues in the receptor-binding domain (K417N, E484K and N501Y) that may have functional significance. This lineage emerged in South Africa after the first epidemic wave in a severely affected metropolitan area, Nelson Mandela Bay, located on the coast of the Eastern Cape Province. This lineage spread rapidly, becoming within weeks the dominant lineage in the Eastern Cape and Western Cape Provinces. Whilst the full significance of the mutations is yet to be determined, the genomic data, showing the rapid displacement of other lineages, suggest that this lineage may be associated with increased transmissibility.
980 citations
References
More filters
TL;DR: SAMtools as discussed by the authors implements various utilities for post-processing alignments in the SAM format, such as indexing, variant caller and alignment viewer, and thus provides universal tools for processing read alignments.
Abstract: Summary: The Sequence Alignment/Map (SAM) format is a generic alignment format for storing read alignments against reference sequences, supporting short and long reads (up to 128 Mbp) produced by different sequencing platforms. It is flexible in style, compact in size, efficient in random access and is the format in which alignments from the 1000 Genomes Project are released. SAMtools implements various utilities for post-processing alignments in the SAM format, such as indexing, variant caller and alignment viewer, and thus provides universal tools for processing read alignments.
Availability: http://samtools.sourceforge.net
Contact: [email protected]
45,957 citations
TL;DR: Bowtie 2 combines the strengths of the full-text minute index with the flexibility and speed of hardware-accelerated dynamic programming algorithms to achieve a combination of high speed, sensitivity and accuracy.
Abstract: As the rate of sequencing increases, greater throughput is demanded from read aligners. The full-text minute index is often used to make alignment very fast and memory-efficient, but the approach is ill-suited to finding longer, gapped alignments. Bowtie 2 combines the strengths of the full-text minute index with the flexibility and speed of hardware-accelerated dynamic programming algorithms to achieve a combination of high speed, sensitivity and accuracy.
37,898 citations
"Case Study: Prolonged Infectious SA..." refers methods in this paper
...1) reference genome using bowtie2 with –no-mixed –no-unal -X 1500 options (Langmead and Salzberg, 2012)....
[...]
TL;DR: This version of MAFFT has several new features, including options for adding unaligned sequences into an existing alignment, adjustment of direction in nucleotide alignment, constrained alignment and parallel processing, which were implemented after the previous major update.
Abstract: We report a major update of the MAFFT multiple sequence alignment program. This version has several new features, including options for adding unaligned sequences into an existing alignment, adjustment of direction in nucleotide alignment, constrained alignment and parallel processing, which were implemented after the previous major update. This report shows actual examples to explain how these features work, alone and in combination. Some examples incorrectly aligned by MAFFT are also shown to clarify its limitations. We discuss how to avoid misalignments, and our ongoing efforts to overcome such limitations.
27,771 citations
"Case Study: Prolonged Infectious SA..." refers background or methods in this paper
...(B) Full SARS-CoV-2 genomeswere subsampled fromWashington state, representing NextStrain clade 19B, including the four full-genome sequences recovered from the individual and the Wuhan-Hu-1/2019 sequence and aligned using MAFFT v.1.4 (Katoh and Standley, 2013; Katoh et al., 2002) implemented in Geneious Prime v.2020.1.2 (https://www.geneious.com/)....
[...]
...0.3 (https:// pangolin.cog-uk.io/), and aligned using MAFFT v. 1.4 (Katoh and Standley, 2013; Katoh et al., 2002)....
[...]
...…with four of the full genome sequences recovered from the persistently infected individual, the USA/WA1/2020 genome sequence, and the Wuhan-Hu-1/2019 genome sequence with MAFFT v.1.4 (Katoh and Standley, 2013; Katoh et al., 2002) implemented in Geneious Prime v.2020.1.2 (https://www.geneious.com/)....
[...]
...F ThermoFisher Cat# R79007; RRID CVCL_D603 VeroE6 Ralph Baric ATCC CRL-1586 MatTek EpiAlveolar MatTek Life Sciences (https://www.mattek.com/ products/epialveolar/) Cat# ALV-100-FT-PE12 Oligonucleotides Primer to E genomic (E_Sarbeco_F1) AACAGGTACGTTAATAGTTAATAGCGT Corman et al., 2020; Integrated DNA Technologies https://www.who.int/docs/defaultsource/coronaviruse/wuhan-virus-assayv1991527e5122341d99287a1b17c111902.pdf Primer to E subgenomic (sgLeadSARS2-F) CGATCTCTTGTAGATCTGTTCTC Wölfel et al., 2020; Integrated DNA Technologies N/A Reverse primer to E (E_Sarbeco_R2) ATATTGCAGCAGTACGCACACA Corman et al., 2020; Integrated DNA Technologies https://www.who.int/docs/defaultsource/coronaviruse/wuhan-virus-assayv1991527e5122341d99287a1b17c111902.pdf Probe for E (E_Sarbeco_P1) FAMACACTAGCCATCCTTACTGCGCTTCGZEN-IBHQ Corman et al., 2020; Integrated DNA Technologies https://www.who.int/docs/defaultsource/coronaviruse/wuhan-virus-assayv1991527e5122341d99287a1b17c111902.pdf Recombinant DNA paH SARS-CoV-2 spike plasmid Kizzemekia Corrbett and Barney GrahamVaccine Research Center, NIH, Bethesda, USA (Wrapp et al., 2020) N/A pCAGGS SARS-CoV-2 receptor binding domain plasmid Florian KrammerIcahn School of Medicine at Mt. Sinai, New York, USA (Amanat et al., 2020) N/A Software and Algorithms MAFFT align (Katoh and Standley, 2013, Katoh et al., 2002) Geneious Prime 2020.1.2 plugin Multalin sequence alignment (Corpet, 1988) http://multalin.toulouse.inra.fr/multalin/ ESPript 3.0 (Robert and Gouet, 2014) http://espript.ibcp.fr/ESPript/ESPript/ Geneious Prime 2020.1.2 Geneious https://www.geneious.com PhyML 3.320180621 Guindon et al., 2010 Geneious Prime 2020.1.2 plugin FigTree v1....
[...]
...MAFFT multiple sequence alignment software version 7: improvements in performance and usability....
[...]
TL;DR: The GATK programming framework enables developers and analysts to quickly and easily write efficient and robust NGS tools, many of which have already been incorporated into large-scale sequencing projects like the 1000 Genomes Project and The Cancer Genome Atlas.
Abstract: Next-generation DNA sequencing (NGS) projects, such as the 1000 Genomes Project, are already revolutionizing our understanding of genetic variation among individuals. However, the massive data sets generated by NGS—the 1000 Genome pilot alone includes nearly five terabases—make writing feature-rich, efficient, and robust analysis tools difficult for even computationally sophisticated individuals. Indeed, many professionals are limited in the scope and the ease with which they can answer scientific questions by the complexity of accessing and manipulating the data produced by these machines. Here, we discuss our Genome Analysis Toolkit (GATK), a structured programming framework designed to ease the development of efficient and robust analysis tools for next-generation DNA sequencers using the functional programming philosophy of MapReduce. The GATK provides a small but rich set of data access patterns that encompass the majority of analysis tool needs. Separating specific analysis calculations from common data management infrastructure enables us to optimize the GATK framework for correctness, stability, and CPU and memory efficiency and to enable distributed and shared memory parallelization. We highlight the capabilities of the GATK by describing the implementation and application of robust, scale-tolerant tools like coverage calculators and single nucleotide polymorphism (SNP) calling. We conclude that the GATK programming framework enables developers and analysts to quickly and easily write efficient and robust NGS tools, many of which have already been incorporated into large-scale sequencing projects like the 1000 Genomes Project and The Cancer Genome Atlas.
20,557 citations
"Case Study: Prolonged Infectious SA..." refers background or methods in this paper
...Variant calling was performed using Genome Analysis Toolkit (GATK, version 4.1.2) HaplotypeCaller with ploidy set to 2 (McKenna et al., 2010)....
[...]
...2) HaplotypeCaller with ploidy set to 2 (McKenna et al., 2010)....
[...]
...…2016 https://github.com/MikkelSchubert/ adapterremoval Picard 2.18.7 Broad Institute, 2018 https://broadinstitute.github.io/picard/ GATK 4 v 4.1.2.0 McKenna et al., 2010 https://github.com/broadinstitute/ gatk/releases Other Ni Sepharose 6 Fast Flow GE Lifesciences Cat# 17531802 NiNTA Agarose…...
[...]
TL;DR: The command-line tool cutadapt is developed, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features.
Abstract: When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features. Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/
20,255 citations
"Case Study: Prolonged Infectious SA..." refers methods in this paper
...20.0.422, Illumina, Inc. San Diego, CA) and trimmed of adaptor sequences using cutadapt version 1.12 (Martin, 2011)....
[...]