scispace - formally typeset

Journal ArticleDOI

Complete genome sequence of a novel ourmia-like mycovirus infecting the phytopathogenic fungus Botryosphaeria dothidea.

19 May 2021-Archives of Virology (Springer Science and Business Media LLC)-Vol. 166, Iss: 12, pp 3461-3465

TL;DR: Phylogenetic analysis based on the RdRp amino acid sequences showed that BdOLV1 is grouped with oomycete-infecting unclassified viruses closely related to the genus Botoulivirus in Botourmiaviridae.

AbstractHere, we describe the full-length genome sequence of a novel ourmia-like mycovirus, tentatively named "Botryosphaeria dothidea ourmia-like virus 1" (BdOLV1), isolated from the phytopathogenic fungus Botryosphaeria dothidea strain 8A, associated with apple ring rot in Shanxi province, China. The complete BdOLV1 genome is comprised of a 2797-nucleotide positive-sense (+) single-stranded RNA (ssRNA) with a single open reading frame (ORF). The ORF putatively encodes a 642-amino-acid polypeptide with conserved RNA-dependent RNA polymerase (RdRp) motifs related to those of viruses of the family Botourmiaviridae. Phylogenetic analysis based on RdRp amino acid sequences showed that BdOLV1 is grouped with unclassified oomycete-infecting viruses closely related to members of the genus Botoulivirus in the family Botourmiaviridae. This is the first report of a novel (+)ssRNA virus in B. dothidea related to members of the genus Botoulivirus in the family Botourmiaviridae.

Topics: Botryosphaeria dothidea (66%), Mycovirus (55%)

Summary (1 min read)

Introduction

  • Botryosphaeria dothidea is a notorious canker pathogen that infects a wide range of trees worldwide [1] .
  • This fungus is the principal causal agent of apple ring rot in China and is distributed across almost every apple planting region [2] .
  • Several other mycoviruses have since been experimentally proven capable of introducing hypovirulence into their host fungi [5] .
  • The partial viral sequence and all terminal sequences were assembled and analyzed using DNAMAN version 9.0 (Lynnon Biosoft).
  • The complete genome of BdOLV1 was submitted to GenBank under accession no.

Sequence properties:

  • The tree topology showed that BdOLV1 grouped (100% bootstrap support) with previously reported ourmia-like viruses from the oomycete Plasmopara viticola and ascomycete fungi B. dothidea and Phaeoacremonium minimum (Fig. 2 ).
  • At present, it is phylogenetically di cult to conclude whether BdOLV1 and its closely related viruses are novel species within the genus Botoulivirus or whether they constitute a new genus in the family Botourmiaviridae.
  • Highly and less conserved amino acid positions are indicated by black shading and white lettering, and gray shading and black lettering, respectively.

Did you find this useful? Give us your feedback

...read more

Content maybe subject to copyright    Report

Page 1/8
Complete Genome Sequence of a Novel Ourmia-like
Mycovirus Infecting the Phytopathogenic Fungus
Botryosphaeria Dothidea
Liying Sun ( sunliying@nwsuaf.edu.cn )
Northwest Agriculture and Forestry University https://orcid.org/0000-0003-2538-6096
Ziqian Lian
Northwest Agriculture and Forestry University College of Plant Protection
Subha Das
Northwest Agriculture and Forestry University College of Plant Protection
Jingxian Luo
Northwest Agriculture and Forestry University College of Plant Protection
Ida Bagus Andika
Qingdao Agricultural University School of Agriculture and Plant Protection
Research Article
Keywords: Mycovirus, Ourmia-like virus, Botourmiaviridae, Botryosphaeria dothidea, Ascomycete, Fungi,
Apple ring rot
Posted Date: May 19th, 2021
DOI: https://doi.org/10.21203/rs.3.rs-505029/v1
License: This work is licensed under a Creative Commons Attribution 4.0 International License.
Read Full License

Page 2/8
Abstract
In this study, we describe the full-length genome sequence of a novel ourmia-like mycovirus, tentatively
designated Botryosphaeria dothidea ourmia-like virus 1 (BdOLV1), isolated from the phytopathogenic
fungus,
Botryosphaeria dothidea
strain P8, associated with apple ring rot in Shanxi province, China. The
complete BdOLV1 genome is comprised of 2797 nucleotides, a positive-sense (+) single-stranded RNA
(ssRNA) with a single open reading frame (ORF). The ORF putatively encodes a 642-amino acid
polypeptide with conserved RNA-dependent RNA polymerase (RdRp) motifs, related to viruses of the
family
Botourmiaviridae
. Phylogenetic analysis based on the RdRp amino acid sequences showed that
BdOLV1 is grouped with oomycete-infecting unclassied viruses closely related to the genus
Botoulivirus
in
Botourmiaviridae
. This is the rst report of a novel (+)ssRNA virus in
B. dothidea
related to the genus
Botoulivirus
in the family
Botourmiaviridae
.
Introduction
Botryosphaeria dothidea
is a notorious canker pathogen that infects a wide range of trees worldwide [1].
This fungus is the principal causal agent of apple ring rot in China and is distributed across almost every
apple planting region [2].
B. dothidea
causes cankerous lesions on stems and brown rings on leaves and
fruits, thereby ultimately hampering the apple yield and quality [3]. While fungicides are regularly applied
for controlling this disease, the indiscriminate use of chemicals negatively impacts the environment and
poses a threat to human health [3, 4]. These concerns necessitate the development of alternative,
environmentally friendly management strategies for preventing apple ring rot.
Mycoviruses or viruses that infect fungi are present throughout all major fungal taxa [5]. Mycoviruses are
predicted to lack an extracellular phase, with their transmission occurring either vertically through conidia
or spores, or horizontally via hyphal fusion followed by cytoplasmic mixing between compatible fungal
strains [5]. Mycovirus genomes primarily consist of single- or double-stranded RNAs (ssRNA or dsRNA),
although the recent discovery of circular ssDNA mycoviruses has increased their diversity [5, 6].
In general, mycoviruses cryptically infect their hosts, although some can diminish host virulence upon
infection [7]. These viruses have the potential to be used asvirocontrol” agents for managing fungal
diseases of plants. Mycovirus-infected debilitated strains can be introduced into a eld to undergo hyphal
fusion with their virulent counterparts, making them hypovirulent upon viral transmission. The rst
successful example of such mycovirus-mediated biocontrol was using
Cryphonectria hypovirus 1
(CHV1)
to control chestnut blight caused by
Cryphonectria parasitica
[7]. Several other mycoviruses have since
been experimentally proven capable of introducing hypovirulence into their host fungi [5]. To explore
mycoviral diversity in
B. dothidea
, extensive virus hunting in this pathogen has been conducted by
numerous research groups. Such expeditions discovered several novel viruses in this fungus including
members of the families
Narnaviridae
,
Chrysoviridae
,
Fusariviridae
,
Totiviridae
,
Partitiviridae
, and
Botourmiaviridae
[8–13].

Page 3/8
Botourmiaviridae
is a recently established linear positive-sense (+) ssRNA virus family comprising four
recognized genera:
Ourmiavirus
,
Botoulivirus
,
Scleroulivirus
, and
Magoulivirus
[14]. The genus
Ourmiavirus
consists of plant-infecting viruses with encapsidated trisegmented genomes, where each
segment separately encodes a movement protein, capsid protein, and RNA-dependent RNA polymerase
(RdRp). In contrast, viruses belonging to the other three genera infect specically fungi and oomycetes
and are monosegmented with a single open reading frame (ORF) encoding an RdRp [14]
In this study, we report a novel (+) ssRNA ourmia-like mycovirus from
B. dothidea
strain 8A, which is
associated with apple ring rot in China. Sequence comparison and phylogenetic analyses suggested that
this virus is related to members of
Botoulivirus
in the family
Botourmiaviridae
and has been provisionally
named Botryosphaeria dothidea Ourmia-like virus 1 (BdOLV1).
Provenance of the virus in
B. dothidea
:
B. dothidea
strain 8A was originally isolated from an infected apple tree in Shanxi province, China. Upon
establishing pure culture, the strain was maintained on potato dextrose agar (PDA) at 25°C under dark
conditions. Strain identication was performed by internal transcribed spacer (ITS) sequencing as
described by Xu and colleagues [15]. Total dsRNA (the replicative form of the virus) was extracted from a
three-day-old mycelial culture grown on cellophane-overlaid PDA as described by Eusebio-Cope and
Suzuki and visualized by 1% agarose gel electrophoresis in 1x TAE buffer [16].
The partial cDNA sequence of BdOLV1 was initially obtained through RNA deep sequencing of ribosomal
RNA depleted total RNA from strain 8A using Illumina platform. The full-length cDNA sequence of
BdOLV1 was then obtained by amplifying its terminal regions adopting a 3' RNA ligase-mediated rapid
amplication of cDNA ends (3' RLM-RACE) method. Briey, a linker primer PC3-T7-loop (5'-p-
GGATCCCGGGAATTCGGTAATACGACTCACTATATTTTTATAGTGAGTCGTATTA-OH-3') was ligated to the 3'
ends of heat-denatured (95 for 4 min) viral dsRNA at 4 for 24 h using T4 RNA Ligase (Takara)
following the manufacturer’s instructions. The loop primer-linked puried dsRNA was then subjected to
rst-strand cDNA synthesis using SuperScript™ III Reverse Transcriptase (Invitrogen) with linker primer
PC2 (5'-CCGAATTCCCGGGATCC-3'), complementary to the 5' side of the PC3-T7-loop primer. To amplify 5'
and 3' viral terminal regions, the resulting cDNA was then amplied using 2×Es Taq MasterMix (CWBIO)
with complementary primer PC2 (5’-CCGAATTCCCGGGATCC-3’) and gene-specic primers 406R (5’-
AAACCAGGGGCGAAAGCACGAC-3’) and 2546F (CGAACTGCTGAGTCGGGGTGAT), respectively. The PCR
products were subsequently cloned using pGEM®-T Easy Vector System I (Promega). For each RACE
reaction, a minimum of three recombinant plasmids was sequenced in both directions using universal
primers M13F and M13R.
The partial viral sequence and all terminal sequences were assembled and analyzed using DNAMAN
version 9.0 (Lynnon Biosoft). The identity of BdOLV1 and its similarity to other viruses was determined
via online BLAST analyses (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The position of the ORF on the
BdOLV1 genome and its corresponding putative polypeptide were determined using the ORF nder
program (http://www.ncbi.nlm.nih.gov/gorf/org.cgi). Sequence alignments and phylogenetic analyses

Page 4/8
were performed using the MEGA version 10.1.7 software package [17]. The complete genome of BdOLV1
was submitted to GenBank under accession no. MZO73729.
Sequence properties:
The complete genome of BdOLV1 is 2797 nucleotides (nt) in length with a GC content of 54.06%
(Fig.1a). The 5'- and 3'-untranslated regions (UTRs) are 68 and 800 nt long, respectively (Fig.1a).
BdOLV1 contains a single ORF of 1929 nt, putatively encoding a 642-amino acid polypeptide with a
deduced molecular mass of 76.62 kDa (Fig.1a).
A BLASTP analysis showed that this polypeptide is related to the RdRps of several ourmia-like viruses
characterized from oomycetes and fungi. BdOLV1 RdRp was found to share 98.91%, 56.94%, and 46.51%
sequence identity with the corresponding regions of
Botryosphaeria dothidea
Ourmia-like virus (BdOLV,
unpublished partial genome sequence),
Plasmopara viticola
lesion associated ourmia-like virus 54, and
Plasmopara viticola
lesion associated ourmia-like virus 2, respectively. Despite a lack of conserved
domains in CD-Search, multiple sequence alignment of the putative RdRp region from BdOLV1 with
corresponding regions of other
Botourmiaviridae
members showed the presence of eight conserved RdRp
motifs including a highly conserved GDD signature (on motif VI) on the BdOLV1 polypeptide (Fig.1b).
Collectively, the ndings suggest that BdOLV1 is a novel ourmia-like virus in the family
Botourmiaviridae
.
The generic identity of BdOLV1 was further determined using a Maximum Likelihood phylogenetic tree
constructed from partially conserved RdRp sequences (Fig.2). The tree topology showed that BdOLV1
grouped (100% bootstrap support) with previously reported ourmia-like viruses from the oomycete
Plasmopara viticola
and ascomycete fungi
B. dothidea
and
Phaeoacremonium minimum
(Fig.2).
Interestingly, this group of viruses showed phylogenetic relatedness to another ourmia-like viruses group
(99% bootstrap support) belonging to the genus
Botoulivirus
in the family
Botourmiaviridae
(Fig.2).
Notably, pairwise sequence alignment of full-length RdRp amino acid sequences between BdOLV1 and
Botrytis ourmia-like virus
(
Botrytis botoulivirus
), an exemplar strain of the genus
Botoulivirus
, showed
only 34.85% sequence identity, far below the current set species criteria ( 90%) within this genus.
Moreover, the complete RdRp sequences for members of different genera within
Botourmiaviridae
differ
by > 70% [14]. At present, it is phylogenetically dicult to conclude whether BdOLV1 and its closely
related viruses are novel species within the genus
Botoulivirus
or whether they constitute a new genus in
the family
Botourmiaviridae
.
In this study, we characterized BdOLV1 from an apple-infecting ascomycete fungus
B. dothidea
showing
no apparent disease symptoms. BdOLV1 differs from the previously characterized ourmia-like virus,
Botryosphaeria dothidea botourmiavirus 1 (BdBOV-1), which was isolated from a hypovirulent pear-
infecting
B. dothidea
strain [10]. While BdBOV-1 is phylogenetically related to the genus
Magoulivirus
,
BdOLV1 is related to the genus
Botoulivirus
in the family
Botourmiaviridae
. Interestingly, BdOLV1 shares a
close association with several ourmia-like viruses infecting oomycete
P. viticola
, suggesting a probable
exchange of such ourmia-like viruses between fungi and oomycetes. Notably, both
B. dothidea
and
P.

Page 5/8
viticola
are tree pathogens, suggesting that both organisms may have acquired such viruses from a
common source, and viruses thereafter evolved with their respective hosts.
Declarations
Acknowledgments:
We greatly thank Dr. Guangyu Sun for kindly providing research materials. This work was supported in
part by National Natural Science Foundation of China (30970163) to LY. Sun and (31970159), to IB.
Andika.
Compliance with ethical standards
Conict of interest:
All authors declare that they have no conicts of interest.
Ethical approval:
This article does not contain any studies with human participants or animals performed by any of the
authors.
References
1. Marsberg A, Kemler M, Jami F, et al (2017)
Botryosphaeria dothidea
: a latent pathogen of global
importance to woody plant health. Mol Plant Pathol 18:477–488.
2. Tang W, Ding Z, Zhou ZQ, et al (2011) Phylogenetic and pathogenic analyses show that the causal
agent of apple ring rot in China is
Botryosphaeria dothidea
. Plant Dis 96:486–496.
3. Brown-Rytlewski DE, McManus PS (2000) Virulence of
Botryosphaeria dothidea
and
Botryosphaeria
obtusa
on apple and management of stem cankers with fungicides. Plant Dis 84:1031–1037.
4. Nicolopoulou-Stamati P, Maipas S, Kotampasi C, et al (2016) Chemical Pesticides and Human
Health: The urgent need for a new concept in agriculture. Front public Heal 4:148.
5. Ghabrial SA, Castón JR, Jiang D, et al (2015) 50-plus years of fungal viruses. Virology 479–
480:356–368.
. Li P, Wang S, Zhang L, et al (2020) A tripartite ssDNA mycovirus from a plant pathogenic fungus is
infectious as cloned DNA and puried virions. Sci Adv 6:eaay9634.
7. Nuss DL (1992) Biological control of chestnut blight: an example of virus-mediated attenuation of
fungal pathogenesis. Microbiol Rev 56:561– 576
. Wang H, Liu H, Lu X, et al (2021) A novel mitovirus isolated from the phytopathogenic fungus
Botryosphaeria dothidea
. Arch Virol 166:1507–1511.

Figures (2)
References
More filters

Journal ArticleDOI
TL;DR: The Molecular Evolutionary Genetics Analysis (Mega) software implements many analytical methods and tools for phylogenomics and phylomedicine and has additionally been upgraded to use multiple computing cores for many molecular evolutionary analyses.
Abstract: The Molecular Evolutionary Genetics Analysis (Mega) software implements many analytical methods and tools for phylogenomics and phylomedicine. Here, we report a transformation of Mega to enable cross-platform use on Microsoft Windows and Linux operating systems. Mega X does not require virtualization or emulation software and provides a uniform user experience across platforms. Mega X has additionally been upgraded to use multiple computing cores for many molecular evolutionary analyses. Mega X is available in two interfaces (graphical and command line) and can be downloaded from www.megasoftware.net free of charge.

11,718 citations


Journal ArticleDOI
TL;DR: It is more obvious than ever that the society needs the implementation of a new agricultural concept regarding food production, which is safer for man and the environment, and to this end, steps such as the declaration of Nyéléni have been taken.
Abstract: The industrialization of the agricultural sector has increased the chemical burden on natural ecosystems. Pesticides are agrochemicals used in agricultural lands, public health programs and urban green areas in order to protect plants and humans from various diseases. However, due to their known ability to cause a large number of negative health and environmental effects, their side effects can be an important environmental health risk factor. The urgent need for a more sustainable and ecological approach has produced many innovative ideas, among them agriculture reforms and food production implementing sustainable practice evolving to food sovereignty. It is more obvious than ever that the society needs the implementation of a new agricultural concept regarding food production which is safer for man and the environment, and to this end, steps such as the declaration of Nyeleni have been taken.

587 citations


Journal ArticleDOI
01 May 2015-Virology
TL;DR: Although many mycoviruses do not have marked effects on their hosts, those that reduce the virulence of their phytopathogenic fungal hosts are of considerable interest for development of novel biocontrol strategies.
Abstract: Mycoviruses are widespread in all major taxa of fungi. They are transmitted intracellularly during cell division, sporogenesis, and/or cell-to-cell fusion (hyphal anastomosis), and thus their life cycles generally lack an extracellular phase. Their natural host ranges are limited to individuals within the same or closely related vegetative compatibility groups, although recent advances have established expanded experimental host ranges for some mycoviruses. Most known mycoviruses have dsRNA genomes packaged in isometric particles, but an increasing number of positive- or negative-strand ssRNA and ssDNA viruses have been isolated and characterized. Although many mycoviruses do not have marked effects on their hosts, those that reduce the virulence of their phytopathogenic fungal hosts are of considerable interest for development of novel biocontrol strategies. Mycoviruses that infect endophytic fungi and those that encode killer toxins are also of special interest. Structural analyses of mycoviruses have promoted better understanding of virus assembly, function, and evolution.

341 citations


Journal ArticleDOI
Donald L. Nuss1
TL;DR: Developments have significantly improved the prospects of using this system to identify molecular determinants of virulence and elucidate signal transduction pathways involved in pathogenic responses, and novel approaches are now available for extending the application of transmissible hypovirulence for management of chestnut blight and possibly other fungal diseases.
Abstract: Environmental concerns have focused attention on natural forms of disease control as potentially safe and effective alternatives to chemical pesticides. This has led to increased efforts to develop control strategies that rely on natural predators and parasites or that involve genetically engineered microbial pest control agents. This review deals with a natural form of biological control in which the virulence of a fungal pathogen is attenuated by an endogenous viral RNA genetic element: the phenomenon of transmissible hypovirulence in the chestnut blight fungus, Cryphonectria parasitica. Recent progress in the molecular characterization of a hypovirulence-associated viral RNA has provided an emerging view of the genetic organization and basic expression strategy of this class of genetic elements. Several lines of evidence now suggest that specific hypovirulence-associated virus-encoded gene products selectively modulate the expression of subsets of fungal genes and the activity of specific regulatory pathways. The construction of an infectious cDNA clone of a hypovirulence-associated viral RNA represents a major advancement that provides exciting new opportunities for examining the molecular basis of transmissible hypovirulence and for engineering hypovirulent strains for improved biocontrol. These developments have significantly improved the prospects of using this system to identify molecular determinants of virulence and elucidate signal transduction pathways involved in pathogenic responses. In addition, novel approaches are now available for extending the application of transmissible hypovirulence for management of chestnut blight and possibly other fungal diseases.

252 citations


Journal ArticleDOI
TL;DR: This pathogen profile synthesizes the current understanding of B. dothidea pertaining to its distribution, host associations and role as a pathogen in managed and natural woody environments, as well as elucidating previously unknown aspects of the species, including mating and host infection strategies.
Abstract: The National Research Foundation (NRF) of South Africa and members of the Tree Protection Co-operative Programme (TPCP).

112 citations


Frequently Asked Questions (1)
Q1. What contributions have the authors mentioned in the paper "Complete genome sequence of a novel ourmia-like mycovirus infecting the phytopathogenic fungus" ?

Liying Sun et al. this paper proposed the Northwest Agriculture and Forestry University 's College of Plant Protection.