Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice
Citations
4,774 citations
2,930 citations
1,451 citations
Cites background or methods from "Demonstration of CRISPR/Cas9/sgRNA-..."
...For Gibson Assembly cloning, home-made 23 isothermal in vitro recombination master mixture was prepared as previously described (Jiang et al., 2013a, 2013b)....
[...]
...CRISPR/Cas9 editing systems have enabled genomic targeting in many organisms, including plants (Cong et al., 2013; Jiang et al., 2013a, 2013b; Li et al., 2013; Mao et al., 2013; Miao et al., 2013; Shan et al., 2013b; Xie and Yang, 2013; Fauser et al., 2014; Zhang et al., 2014; Zhou et al., 2014)....
[...]
...…expression cassettes can be combined into a single T-DNA region, current plant CRISPR/Cas9 vector systems can only target one or few genomic sites (Jiang et al., 2013a, 2013b; Li et al., 2013; Mao et al., 2013; Shan et al., 2013a, 2013b; Xie and Yang, 2013; M Fauser et al., 2014; Feng et al.,…...
[...]
1,021 citations
Cites background from "Demonstration of CRISPR/Cas9/sgRNA-..."
...The CRISPR/Cas system has been harnessed to achieve efficient genome editing in a variety of organisms, including bacteria, yeast, plants, and animals, as well as human cell lines [12-27]....
[...]
948 citations
Cites background from "Demonstration of CRISPR/Cas9/sgRNA-..."
...Subsequent work focused on additional crop species such as sorghum (Jiang et al., 2013b), wheat (Upadhyay et al., 2013; Wang et al., 2014b) andmaize (Liang et al., 2014)....
[...]
...…it was later shown that only the 8–12 nt at the 3′ end (the seed sequence) is needed for target site recognition and cleavage (Cong et al., 2013; Jiang et al., 2013a; Jinek et al., 2012), whereas multiple mismatches in the PAM-distal region can be tolerated, depending on the total number and…...
[...]
...…of CRISPR/Cas9 One of the few criticisms of the CRISPR/Cas9 technology is the relatively high frequency of off-target mutations reported in some of the earlier studies (Cong et al., 2013; Fu et al., 2013; Hsu et al., 2013; Jiang et al., 2013a; Mali et al., 2013; Pattanayak et al., 2013)....
[...]
...…under the control of diverse promoters, including those recognized by RNA polymerase II and III (Fauser et al., 2014; Feng et al., 2014; Gao et al., 2014; Jiang et al., 2013b; Mao et al., 2013; Miao et al., 2013; Sugano et al., 2014; Upadhyay et al., 2013; Zhang et al., 2014; Zhou et al., 2014)....
[...]
References
12,865 citations
"Demonstration of CRISPR/Cas9/sgRNA-..." refers background or methods in this paper
...Because it is reported that Cas9 nucleases cleave 3 nt upstream of the PAM sequence (27), it is likely that our ApaLI-mediated enrichment for GFP target site mutations may well have resulted in lack of recovery of a number of target region mutations....
[...]
...An important innovation was the development of single guide RNAs (sgRNAs) that are fusions of critical portions of tracrRNA with the ‘guide’ and PAM domains of crRNAs (27,29) (Figure 1)....
[...]
...The deletion is located in close proximity to the predicted cleavage site of the Cas9/sgRNA complex [3-bp downstream of PAM sequence (27)], indicating the association of the mutation with Cas9/sgRNA-directed DNA cleavage....
[...]
...Constructs for Cas9 and sgRNA gene expression in rice The S. pyogenes Cas9 (SpCas9) coding sequence from plasmid pMJ806 (Jinek et al., 2012, obtained from Addgene, http://www.addgene.org/) was PCR amplified with primers Cas9-F1 and Cas9-R1 (Supplementary Information) that contain restriction sites…...
[...]
12,265 citations
10,746 citations
Additional excerpts
...in bacteria (30,32), yeast (33), zebrafish (34–36), fruit fly (37) and human cells (28,29,38)]....
[...]
8,197 citations
"Demonstration of CRISPR/Cas9/sgRNA-..." refers background or methods in this paper
...An important innovation was the development of single guide RNAs (sgRNAs) that are fusions of critical portions of tracrRNA with the ‘guide’ and PAM domains of crRNAs (27,29) (Figure 1)....
[...]
...The coding region of Cas9 was fused in frame with a 2XFLAG (GA TTACAAGGACGATGATGACAAGAAAGACTATA AAGATGACGATGATAAGCAT) at the 50 terminus immediately downstream of the ATG start codon and with a SV40 nuclear localization sequence (CCGAAGAAGAAG CGCAAGGTGTAA) at the 30 end of the gene (29)....
[...]
...The 50 end of the transcript contained a 20-bp target sequence (GCGCTTCAAGGTGCACAT GG) complementary to the target site in the 50 coding region of a nonfunctional GFP gene (see description later in the text) and was followed the sgRNA scaffold (GTTTT AGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG GTGCTTTTTTT) (29)....
[...]
...in bacteria (30,32), yeast (33), zebrafish (34–36), fruit fly (37) and human cells (28,29,38)]....
[...]
4,282 citations
Additional excerpts
...in bacteria (30,32), yeast (33), zebrafish (34–36), fruit fly (37) and human cells (28,29,38)]....
[...]