scispace - formally typeset

Journal ArticleDOI

Development of microsatellite markers for the wetland grasshopper Stethophyma grossum

01 Jun 2012-Conservation Genetics Resources (Springer Netherlands)-Vol. 4, Iss: 2, pp 507-509

TL;DR: Ten polymorphic microsatellite markers were developed, one of which seems to be sex-chromosome X-linked and one showed high null allele frequencies, a phenomenon generally detected in micros satellite studies on grasshoppers.
Abstract: Stethophyma grossum is a threatened Eurosiberian grasshopper species. Since it is bound to wetlands, S. grossum is often used as indicator for extensive wet meadows. To study its movement capability and dispersal habitat in landscape genetic analyses, we developed ten polymorphic microsatellite markers, making use of next generation sequencing. Markers were tested on 75 individuals collected in five populations from Switzerland. We found four to 18 alleles per locus. Observed and expected heterozygosities varied between 0.215–0.893 and 0.397–0.831, respectively. One marker seems to be sex-chromosome X-linked and one showed high null allele frequencies, a phenomenon generally detected in microsatellite studies on grasshoppers.

Content maybe subject to copyright    Report

TECHNICAL NOTE
Development of microsatellite markers for the wetland
grasshopper Stethophyma grossum
Daniela Keller
Esther Jung
Rolf Holderegger
Received: 23 November 2011 / Accepted: 1 December 2011 / Published online: 16 December 2011
Springer Science+Business Media B.V. 2011
Abstract Stethophyma grossum is a threatened Eurosi-
berian grasshopper species . Since it is bound to wetlands,
S. grossum is often used as indicator for extensive wet
meadows. To study its movement capability and dispersal
habitat in landscape genetic analyses, we developed ten
polymorphic microsatellite markers, making use of next
generation sequencing. Markers were tested on 75 indi-
viduals collected in five populations from Switzerland.
We found four to 18 alleles per locus. Observed and
expected heterozygosities varied between 0.215–0.893 and
0.397–0.831, respectively. One marker seems to be sex-
chromosome X-linked and one showed high null allele
frequencies, a phenomenon gener ally detected in micro-
satellite studies on grasshoppers.
Keywords Conservation Next generation sequencing
Orthoptera SSRs Stethophyma grossum
The large marsh grasshopper Stethophyma grossum (Lin-
naeus, 1758; Acrididae) is distributed throughout Europe
and Siberia and is strictly bound to wetlands (Baur et al.
2006). Therefore, S. grossum is often used as an indicator
species for extensively managed wet meadows. Due to
the decline and fragmentation of wet mea dows during the
last decades, many populations of S. grossum have become
spatially isolated or extinct. In Switzerland, the species is
currently red listed as vulnerable (Mon nerat et al. 2007).
To plan effective conservation management strategies for
this threatened grasshopper, knowledge on its movement
capabilities and dispersal habitat is required. Landscape
genetic approaches can help investigating these issues
(Segelbacher et al. 2010). Microsatellites have widely been
used in these analyses, but no markers had been available
for species of the Stethophyma genus. Here, we describe
the development of ten polymorphic microsatellite markers
for S. grossum, making use of next generat ion sequencing
(Csencsics et al. 2010).
DNA of one individual (tibia and tarsus) was extracted
and shotgun sequenced (1/16th run) at Microsynth AG
(Balgach, Switzerland) using a Roche 454 Genome
Sequencer FLX with the Titanium sequencing kit XLR 70.
Details can be found in Margulies et al. (2005). We obtained
a total of 52,693 reads with an average read length of
355 bp. MSATCOMMANDER 0.8.2 (Faircloth 2008) was
used to search for di-, tri- and tetra-nucleotides in unas-
sembled sequences. We limited the search to dinucleotides
of at least eight, trinucleotides of at least ten and tetranu-
cleotides of at least six repeats. A large number of repeats
(1,059) matched with these crite ria, and primers were
designed for 121 repeats using PRIMER3 (Rozen and
Skaletsky 2000). CLC SEQUENCE VIEWER 6.0.2 (CLC
bio Anhus, Denmark) was used to check the 121 sequences
for possible duplicate microsatellite loci. Three sequence
pairs were matching and we thus removed all duplicates,
resulting in 118 repeats (84 di-, 21 tri-, 22 tetra-nucleo-
tides). Finally, fifty sequences were chosen for further
testing. DNA was extr acted from grasshopper legs (tibia
and tarsus), which were stored in 100% ethanol at -20Cin
the dark after collecting. Samples were first lyophilised,
ground with an MM30 0 mixer mill for 4 min (Retsch) and
then extracted using the DNeasy Blood and Tissue Kit
(Qiagen) accordi ng to the manufacturer’s protocol includ-
ing the changes recommended for insects. As tibiae of mid
legs were only small, half of the recommended quantities of
D. Keller (&) E. Jung R. Holderegger
WSL Swiss Federal Research Institute, Zu
¨
rcherstrasse 111,
8903 Birmensdorf, Switzerland
e-mail: daniela.keller@wsl.ch
123
Conservation Genet Resour (2012) 4:507–509
DOI 10.1007/s12686-011-9586-1

extraction chemicals were taken, and elution was performed
twice with each 75 ll elution buffer. Seven samples, all
collected in different populations in central Switzerland,
were used for preliminary testing of all 50 microsatellite
markers. Microsatellite amplification was performed with
the M13 method (Schuelke 2000). PCR reaction volumes
(10 ll) contained approximately 0.7 ng of diluted genomic
DNA, 5 ll29 Multiplex Mix (Qiagen), ddH
2
O, 0.01 lMof
forward primer and 0.15 lM of each reverse and universal
FAM-labelled M13 primers (Schuelke 2000). Amplifica-
tions were run on ABI Verity thermocyclers (Applied
Biosystems) with polymerase activation at 94C for 15 min,
followed by 30 cycles of 94C for 30 s, 60C for 90 s and
72C for 60 s, and an additional eight cycles of 94C for
30 s, 53C for 90 s and 72C for 60 s, followed by a final
elongation step at 72C for 30 min. Fragments were ana-
lysed on an ABI 3130 sequencer (Applied Biosystems) and
electropherograms were scored with GENEMAPPER 3.7
(Applied Biosystems). Only 10 out of the 50 markers tested
were polymorphic and showed clear and reproducible pat-
terns. We tested these ten markers on fiv e populations with
15 individuals each, collected in central Switzerland in an
area of about 50 km
2
. Calculations of number of alleles per
locus, observed and expected heterozygosities and a test for
linkage disequilibrium were perform ed in FSTAT 2.9.3.2.
(Goudet 1995). Departure from Hardy–Weinberg equilib-
rium was tested in GENEPOP 4.0.10. (Raymond and
Rousset 1995) using Fisher’s exact test. Frequencies of null
alleles were estimated for each marker with FREENA
(Chapuis and Estoup 2007).
For the five populations tested, we found four to eighteen
alleles per locus (Table 1). Observed and expected hetero-
zygosities varied between 0.215–0.893 and 0.397–0.831,
respectively. Linkage disequilibrium was detected for
three primer combinations (P B 0.05), but they were no
longer significant after Bonferroni correction (P C 0.001).
Deviations from Hardy–Weinberg equilibrium were found
for locus Sgr07 and Sgr29. Locus Sgr29 seemed to be
sex-chromosome X-linked. At this locus, males were all
homozygous while appro ximately 50% of females were
heterozygous. Females of S. grossum are XX and males X0
(Perry and Jones 1974). For locus Sgr07, however, devia-
tions from Hardy–Weinberg equilibrium were probably
caused by the presence of null alleles (at a frequency C0.2;
Table 1). High frequencies of null alleles are often found in
orthopteran species (e.g. Ustinova et al. 2006; Chapuis et al.
Table 1 Characteristics of ten microsatellite loci developed for Stethophyma grossum and tested for a total of 75 individuals collected from five
locations in Switzerland
Locus Primer sequences (5
0
–3
0
) Repeat
motif
N
A
Size range
(bp)
H
o
H
e
HWE test Null allele
frequency
GenBank
accession
number
Sgr07 F: TATGCACAGGGATGGGAGC
R: TTGTCCTCGTCACATGCAG
(ATT)
12
10 289–319 0.307 0.736 \0.05 0.232 JQ026312
Sgr10 F: CTTTCCCGAAGCCCACAAG
R: TGCAACAAGTCTGCTTACCG
(AAT)
15
7 158–203 0.667 0.676 0.431 0.029 JQ026313
Sgr13 F: TGATGGCTGAACATCCCGC
R: CCAAATCCGCTTCACAACG
(AAT)
12
11 298–342 0.710 0.726 0.332 0.029 JQ026314
Sgr14 F: TTCCACAGAAAGGTGGGTC
R: AGTTTGCATATCACCCGTTTG
(AC)
12
16 264–344 0.597 0.673 0.087 0.047 JQ026315
Sgr15 F: CCACCGTGTGATACTTGGC
R: CGGCGTTTCCCGTCTATTTAC
(AG)
8
12 163–203 0.607 0.656 0.479 0.034 JQ026316
Sgr19 F: GATAGCTTTCAGGTTAGTTGGG
R: TCCTCCGACCTTCGAACTG
(ATT)
11
8 229–259 0.779 0.761 0.485 0.014 JQ026317
Sgr29 F: TCAAGTCCCTATCAAGCACG
R: ACGCAGTTCGGTGTTATCG
(AC)
8
7 312–324 0.215 0.538 \0.05* JQ026318
Sgr38 F: GGCCAATGTATGACGAGGG
R: CTGATGACCTCGCTGTTTGG
(GT)
8
18 186–290 0.893 0.831 0.971 0.002 JQ026319
Sgr40 F: TGTGACTTTATTTATCTGGTGGCTC
R: TATATCCGACGTGGCTCCC
(AAAT)
6
4 304–316 0.283 0.397 0.075 0.080 JQ026320
Sgr45 F: CTAGCCTGGTCATCAGTCCC
R: AGAGAGACACGCTATGTGC
(AC)
8
7 282–300 0.573 0.654 0.464 0.052 JQ026321
* X-linked marker primer sequence (F: forward, R: reverse), number of alleles (N
A
), observed heterozygosity (H
o
), expected heterozygosity (H
e
)
and P value of test for Hardy–Weinberg equilibrium (HWE)
508 Conservation Genet Resour (2012) 4:507–509
123

2008; Blanchet et al. 2010). Thus, it is important to care-
fully check loci for the presence of null alleles in each study
and to exclude loci with high frequencies of null alleles.
Of the presented microsatellites, eight (excluding Sgr07
and Sgr29 for previously mentioned reasons) will serve as
markers for a landscape genetic study focussing on the
dispersal of S. grossum in a fragmented landscape. Results
will help to develop guidelines for the conservation man-
agement of this grasshopper species.
Acknowledgments We want to thank Maarten van Strien for help
with field work, the CCES-ENHANCE project of the ETH domain for
financial support and the Swiss Cantons of Berne, Solothurn, Aargau
and Lucerne for sampling permissions.
References
Baur B, Baur H, Roesti C, Roesti D (2006) Die Heuschrecken der
Schweiz. Haupt, Bern
Blanchet E, Pages C, Blondin L, Billot C, Rivallan R, Vassal JM, Lecoq
M, Risterucci AM (2010) Isolation of microsatellite markers in the
Calliptamus genus (Orthoptera, Acrididae). J Insect Sci 10:133
Chapuis MP, Estoup A (2007) Microsatellite null alleles and
estimation of population differentiation. Mol Biol Evol 24:
621–631. doi:10.1093/molbev/msl191
Chapuis MP, Popple JA, Simpson SJ, Estoup A, Martin JF, Steinbauer
M, McCulloch L, Sword GA (2008) Eight polymorphic microsat-
ellite loci for the Australian plague locust, Chortoicetes terminif-
era. Mol Ecol Resour 8:1414–1416. doi:10.1111/j.1755-0998.
2008.02204.x
Csencsics D, Brodbeck S, Holderegger R (2010) Cost-effective,
species-specific microsatellite development for the endangered
dwarf bulrush (Typha minima) using next-generation sequencing
technology. J Hered 101:789–793. doi:10.1093/jhered/esq069
Faircloth BC (2008) MSATCOMMANDER: detection of microsat-
ellite repeat arrays and automated, locus-specific primer design.
Mol Ecol Resour 8:92–94. doi:10.1111/j.1471-8286.2007.
01884.x
Goudet J (1995) FSTAT (version 1.2): a computer program to
calculate F-statistics. J Hered 86:485–486
Margulies M, Egholm M, Altman WE et al (2005) Genome sequencing in
microfabricated high-density picolitre reactors. Nature 437:376–380.
doi:10.1038/nature03959
Monnerat C, Thorens P, Walter T, Gonseth Y (2007) Rote Liste der
gefa
¨
hrdeten Arten der Schweiz: Heuschrecken. BAFU, Bern
Perry PE, Jones GH (1974) Male and female meiosis in grasshoppers
I. Stethophyma grossum. Chromosoma 47:227–236. doi:10.1007/
BF00328858
Raymond M, Rousset F (1995) GENEPOP (version 1.2). Population
genetics software for exact tests and ecumenicism. J Hered 86:
248–249
Rozen S, Skaletsky H (2000) PRIMER3 on the www for general users
and for biologist programmers. In: Krawetz S, Misener S (eds)
Bioinformatics methods and protocols: methods in molecular
biology. Humana Press, Totowa, pp 365–386
Schuelke M (2000) An economic method for the fluorescent labeling
of PCR fragments. Nat Biotechnol 18:233–234. doi:10.1038/
72708
Segelbacher G, Cushman SA, Epperson BK, Fortin MJ, Francois O,
Hardy OJ, Holderegger R, Taberlet P, Waits LP, Manel S (2010)
Applications of landscape genetics in conservation biology: con-
cepts and challenges. Conserv Genet 11:375–385. doi:10.1007/
s10592-009-0044-5
Ustinova J, Achmann R, Cremer S, Mayer F (2006) Long repeats in a
huge genome: microsatellite loci in the grasshopper Chorthippus
biguttulus. J Mol Evol 62:158–167. doi:10.1007/s00239-005-
0022-6
Conservation Genet Resour (2012) 4:507–509 509
123
Citations
More filters

Journal ArticleDOI
TL;DR: It is shown that depending on the species, a different amount of 454 pyrosequencing data might be required for successful identification of a sufficient number of microsatellite markers for ecological genetic studies.
Abstract: Microsatellites, also known as simple sequence repeats (SSRs), are among the most commonly used marker types in evolutionary and ecological studies. Next Generation Sequencing techniques such as 454 pyrosequencing allow the rapid development of microsatellite markers in nonmodel organisms. 454 pyrosequencing is a straightforward approach to develop a high number of microsatellite markers. Therefore, developing microsatellites using 454 pyrosequencing has become the method of choice for marker development. Here, we describe a user friendly way of microsatellite development from 454 pyrosequencing data and analyse data sets of 17 nonmodel species (plants, fungi, invertebrates, birds and a mammal) for microsatellite repeats and flanking regions suitable for primer development. We then compare the numbers of successfully lab-tested microsatellite markers for the various species and furthermore describe diverse challenges that might arise in different study species, for example, large genome size or nonpure extraction of genomic DNA. Successful primer identification was feasible for all species. We found that in species for which large repeat numbers are uncommon, such as fungi, polymorphic markers can nevertheless be developed from 454 pyrosequencing reads containing small repeat numbers (five to six repeats). Furthermore, the development of microsatellite markers for species with large genomes was also with Next Generation Sequencing techniques more cost and time-consuming than for species with smaller genomes. In this study, we showed that depending on the species, a different amount of 454 pyrosequencing data might be required for successful identification of a sufficient number of microsatellite markers for ecological genetic studies.

75 citations


Cites background from "Development of microsatellite marke..."

  • ...Primers for A. alpina (Buehler et al., 2011), F. sultana (Hartikainen & Jokela, 2012), L. pulmonaria (Werth et al., in press), S. grossum (Keller et al., 2012) and T. minima (Csencsics et al., 2010) are published....

    [...]


Journal ArticleDOI
11 Jan 2015-Heredity
TL;DR: It is argued that in landscape genetics, separate analyses should be performed to either assess IBD or the landscape effects on gene flow, which is strongly influenced by habitat configuration and maximum migration distance.
Abstract: In landscape genetics, isolation-by-distance (IBD) is regarded as a baseline pattern that is obtained without additional effects of landscape elements on gene flow. However, the configuration of suitable habitat patches determines deme topology, which in turn should affect rates of gene flow. IBD patterns can be characterized either by monotonically increasing pairwise genetic differentiation (for example, FST) with increasing interdeme geographic distance (case-I pattern) or by monotonically increasing pairwise genetic differentiation up to a certain geographical distance beyond which no correlation is detectable anymore (case-IV pattern). We investigated if landscape configuration influenced the rate at which a case-IV pattern changed to a case-I pattern. We also determined at what interdeme distance the highest correlation was measured between genetic differentiation and geographic distance and whether this distance corresponded to the maximum migration distance. We set up a population genetic simulation study and assessed the development of IBD patterns for several habitat configurations and maximum migration distances. We show that the rate and likelihood of the transition of case-IV to case-I FST–distance relationships was strongly influenced by habitat configuration and maximum migration distance. We also found that the maximum correlation between genetic differentiation and geographic distance was not related to the maximum migration distance and was measured across all deme pairs in a case-I pattern and, for a case-IV pattern, at the distance where the FST–distance curve flattens out. We argue that in landscape genetics, separate analyses should be performed to either assess IBD or the landscape effects on gene flow.

58 citations


Cites background from "Development of microsatellite marke..."

  • ...Although Robledo-Arnuncio and Rousset (2010) found that effective population density (De) and effective dispersal rate ðs2e Þ ‘depend in a complex way on the spatial and temporal demographic heterogeneities of the population,’ in equilibrium situations, their product ðDes2e Þ was still related to…...

    [...]

  • ...Fluctuations in population size may not only affect the number of emigrants leaving a deme, but also the rate at which new alleles establish in a deme, which might complicate the interpretation of IBD patterns (Bjorklund et al., 2010)....

    [...]


Journal ArticleDOI
01 May 2013-Molecular Ecology
TL;DR: The results suggest that spatial scale and potentially population network topology should be more explicitly considered in future landscape genetic analyses.
Abstract: Most landscape genetic studies assess the impact of landscape elements on species' dispersal and gene flow. Many of these studies perform their analysis on all possible population pairs in a study area and do not explicitly consider the effects of spatial scale and population network topology on their results. Here, we examined the effects of spatial scale and population network topology on the outcome of a landscape genetic analysis. Additionally, we tested whether the relevant spatial scale of landscape genetic analysis could be defined by population network topology or by isolation-by-distance (IBD) patterns. A data set of the wetland grasshopper Stethophyma grossum, collected in a fragmented agricultural landscape, was used to analyse population network topology, IBD patterns and dispersal habitats, using least-cost transect analysis. Landscape genetic analyses neglecting spatial scale and population network topology resulted in models with low fits, with which a most likely dispersal habitat could not be identified. In contrast, analyses considering spatial scale and population network topology resulted in high model fits by restricting landscape genetic analysis to smaller scales (0-3 km) and neighbouring populations, as represented by a Gabriel graph. These models also successfully identified a likely dispersal habitat of S. grossum. The above results suggest that spatial scale and potentially population network topology should be more explicitly considered in future landscape genetic analyses.

58 citations


Cites methods from "Development of microsatellite marke..."

  • ...Eight polymorphic microsatellite markers were used for PCR amplifications (Sgr10, Sgr13, Sgr14, Sgr15, Sgr19, Sgr38, Sgr40 and Sgr45; Keller et al. 2012)....

    [...]

  • ...DNA extraction and genotyping were performed following the procedures described in Keller et al. (2012)....

    [...]


Journal ArticleDOI
TL;DR: This study demonstrates the use of predictive landscape-genetic models in conservation and landscape planning by predicting gene flow under several landscape-change scenarios, which simulated construction, rezoning or restoration projects, and the establishment of a new population.
Abstract: For conservation managers, it is important to know whether landscape changes lead to increasing or decreasing gene flow. Although the discipline of landscape genetics assesses the influence of landscape elements on gene flow, no studies have yet used landscape-genetic models to predict gene flow resulting from landscape change. A species that has already been severely affected by landscape change is the large marsh grasshopper (Stethophyma grossum), which inhabits moist areas in fragmented agricultural landscapes in Switzerland. From transects drawn between all population pairs within maximum dispersal distance (<3 km), we calculated several measures of landscape composition as well as some measures of habitat configuration. Additionally, a complete sampling of all populations in our study area allowed incorporating measures of population topology. These measures together with the landscape metrics formed the predictor variables in linear models with gene flow as response variable (FST and mean pairwise a...

36 citations


Cites background or methods from "Development of microsatellite marke..."

  • ...In the genetic analysis, seven polymorphic microsatellite markers (Sgr10, Sgr13, Sgr15, Sgr19, Sgr38, Sgr40, and Sgr45 [Keller et al. 2012a]) were amplified, analyzed on an ABI 3730xl sequencer (Applied Biosystems; Life Technologies, Carlsbad, California, USA) and scored with GENEMAPPER 3.7…...

    [...]

  • ...In a four-step landscape-genetic approach, (1) we created a set of potential predictor variables by determining the proportion of several landscape elements within transects drawn between pairs of populations (Emaresi et al. 2011, Keller et al. 2012b)....

    [...]

  • ...…2014 329LANDSCAPE GENETICS IN CONSERVATION 2011; Swisstopo; DV033594; available online),5 we then calculated the proportion of landscape elements in the transects as measures of landscape composition (Pavlacky et al. 2009, Angelone et al. 2011, Emaresi et al. 2011, Keller et al. 2012b)....

    [...]

  • ...Recently, several studies have used straight-line interpopulation transects of a certain width, from which several landscape predictor variables are calculated (Pavlacky et al. 2009, Angelone et al. 2011, Emaresi et al. 2011, Keller et al. 2012b)....

    [...]


Journal ArticleDOI
04 Oct 2014-BMC Genomics
TL;DR: A novel approach that uses standard Illumina barcoding primers and a single Illumina HiSeq run to target polymorphic STR fragments to develop and test STR markers is presented, which constitutes a significant improvement over existing STR identification software packages.
Abstract: Illumina sequencing with its high number of reads and low per base pair cost is an attractive technology for development of molecular resources for non-model organisms. While many software packages have been developed to identify short tandem repeats (STRs) from next-generation sequencing data, these methods do not inform the investigator as to whether or not candidate loci are polymorphic in their target populations. We provide a python program iMSAT that uses the polymorphism data obtained from mapping individual Illumina sequence reads onto a reference genome to identify polymorphic STRs. Using this approach, we identified 9,119 candidate polymorphic STRs for use with the parasitoid wasp Trioxys pallidus and 2,378 candidate polymorphic STRs for use with the aphid Chromaphis juglandicola. For both organisms we selected 20 candidate tri-nucleotide STRs for validation. Using fluorescent-labeled oligonucleotide primers, we genotyped 91 female T. pallidus collected in nine localities and 46 female C. juglandicola collected in 4 localities and found 15 of the examined markers to be polymorphic for T. pallidus and 12 of the examined markers to be polymorphic for C. juglandicola. We present a novel approach that uses standard Illumina barcoding primers and a single Illumina HiSeq run to target polymorphic STR fragments to develop and test STR markers. We validate this approach using the parasitoid wasp T. pallidus and its aphid host C. juglandicola. This approach, which would also be compatible with 454 Sequencing, allowed us to quickly identify markers with known variability. Accordingly, our method constitutes a significant improvement over existing STR identification software packages.

10 citations


Cites background from "Development of microsatellite marke..."

  • ...For example, the development of short tandem repeat (STR or microsatellite) markers in non-model organisms is currently undergoing a complete paradigm shift in regards to the techniques and methods used to isolate potential markers, particularly for insects [5-8]....

    [...]


References
More filters

Book ChapterDOI
Steve Rozen1, Helen Skaletsky1Institutions (1)
TL;DR: This chapter assumes acquaintance with the principles and practice of PCR, as outlined in, for example, refs.
Abstract: 1. Introduction Designing PCR and sequencing primers are essential activities for molecular biologists around the world. This chapter assumes acquaintance with the principles and practice of PCR, as outlined in, for example, refs. 1–4. Primer3 is a computer program that suggests PCR primers for a variety of applications, for example to create STSs (sequence tagged sites) for radiation hybrid mapping (5), or to amplify sequences for single nucleotide polymor-phism discovery (6). Primer3 can also select single primers for sequencing reactions and can design oligonucleotide hybridization probes. In selecting oligos for primers or hybridization probes, Primer3 can consider many factors. These include oligo melting temperature, length, GC content , 3′ stability, estimated secondary structure, the likelihood of annealing to or amplifying undesirable sequences (for example interspersed repeats), the likelihood of primer–dimer formation between two copies of the same primer, and the accuracy of the source sequence. In the design of primer pairs Primer3 can consider product size and melting temperature, the likelihood of primer– dimer formation between the two primers in the pair, the difference between primer melting temperatures, and primer location relative to particular regions of interest or to be avoided.

16,058 citations


"Development of microsatellite marke..." refers methods in this paper

  • ...A large number of repeats (1,059) matched with these criteria, and primers were designed for 121 repeats using PRIMER3 (Rozen and Skaletsky 2000)....

    [...]


Journal ArticleDOI
Michel Raymond1, François Rousset1Institutions (1)

15,376 citations


Journal ArticleDOI
15 Sep 2005-Nature
TL;DR: A scalable, highly parallel sequencing system with raw throughput significantly greater than that of state-of-the-art capillary electrophoresis instruments with 96% coverage at 99.96% accuracy in one run of the machine is described.
Abstract: The proliferation of large-scale DNA-sequencing projects in recent years has driven a search for alternative methods to reduce time and cost. Here we describe a scalable, highly parallel sequencing system with raw throughput significantly greater than that of state-of-the-art capillary electrophoresis instruments. The apparatus uses a novel fibre-optic slide of individual wells and is able to sequence 25 million bases, at 99% or better accuracy, in one four-hour run. To achieve an approximately 100-fold increase in throughput over current Sanger sequencing technology, we have developed an emulsion method for DNA amplification and an instrument for sequencing by synthesis using a pyrosequencing protocol optimized for solid support and picolitre-scale volumes. Here we show the utility, throughput, accuracy and robustness of this system by shotgun sequencing and de novo assembly of the Mycoplasma genitalium genome with 96% coverage at 99.96% accuracy in one run of the machine.

8,233 citations


Journal ArticleDOI

7,310 citations


Additional excerpts

  • ...(Goudet 1995)....

    [...]


Journal ArticleDOI
Markus Schuelke1Institutions (1)
TL;DR: A poor man's approach to genotyping for research and high-throughput diagnostics and how it can be applied to medicine and science.
Abstract: A poor man's approach to genotyping for research and high-throughput diagnostics.

3,217 citations


"Development of microsatellite marke..." refers background or methods in this paper

  • ...PCR reaction volumes (10 ll) contained approximately 0.7 ng of diluted genomic DNA, 5 ll 29Multiplex Mix (Qiagen), ddH2O, 0.01 lMof forward primer and 0.15 lM of each reverse and universal FAM-labelled M13 primers (Schuelke 2000)....

    [...]

  • ...Microsatellite amplification was performed with the M13 method (Schuelke 2000)....

    [...]

  • ...15 lM of each reverse and universal FAM-labelled M13 primers (Schuelke 2000)....

    [...]