Evaluation of a rapid bacteriophage-based method for the detection of Mycobacterium tuberculosis in clinical samples
TL;DR: FASTPlaqueTB proved to be sensitive, cheap relative to the PCR and rapid, able to detect M. tuberculosis in clinical samples within 1 day, reducing the time to diagnosis in comparison with culture.
Abstract: Rapid, sensitive and low-cost methods are needed urgently for the detection of Mycobacterium tuberculosis in clinical samples, especially in developing countries. To this end, the clinical performance of FASTPlaqueTBTM (a bacteriophage-based method) has been studied in parallel with microscopy, standard microbiological culture and in-house IS6110-based PCR methods. A total of 64 samples, including 42 sputum samples and 22 urine samples, were tested in this study. The sensitivity, specificity and overall accuracy values for the FASTPlaqueTB assay relative to that of culture were respectively 76.5, 95 and 90 %. The corresponding values for the in-house IS6110-based PCR assay were 88, 91 and 90 % and, for Ziehl–Neelsen staining, were 59, 95 and 85 %. FASTPlaqueTB gave better clinical performance with urine samples than with sputum samples (sensitivity, specificity and overall accuracy were 100 % with urine samples and 64, 93 and 84 % with sputum samples). The 100 % sensitivity of FASTPlaqueTB was higher than that of the corresponding values for PCR (67 %) with urine samples. In conclusion, FASTPlaqueTB proved to be sensitive, cheap relative to the PCR and rapid. It is able to detect M. tuberculosis in clinical samples within 1 day, reducing the time to diagnosis in comparison with culture.
Citations
More filters
TL;DR: The need for better TB tests is defined and technologies being developed to meet that need are described, to help support TB control in HIV-infected populations.
Abstract: Although the human immunodeficiency virus (HIV) infection pandemic has had a catastrophic impact on tuberculosis (TB) control efforts, especially in sub-Saharan Africa, most of the fundamental concepts reflected in the directly observed treatment, short course (DOTS) strategy still hold true in the HIV era. What has changed, and dramatically, is the importance of speedy and accurate TB diagnosis and the difficulty of achieving this. The disproportionate amount of smear-negative disease in sub-Saharan Africa, which shoulders two-thirds of the global burden of HIV infection and acquired immunodeficiency syndrome, has greatly complicated TB case detection and disease control. Now, 15 years after TB rates began to soar in countries where HIV infection is prevalent, we have learned that the conventional approach -- passively waiting for patients with advanced symptomatic disease to make their way to microscopy centers for diagnosis -- has disastrous consequences. Without better diagnostic tools for TB and effective strategies for their implementation, transmission will not be interrupted, mortality will not be checked, and TB will not be controlled in areas where HIV infection is prevalent. Fortunately, a number of technical opportunities exist for the creation of improved diagnostic tests. Developing and exploiting such tests to support TB control in HIV-infected populations is an urgent priority. A substantial public sector effort is under way to work in partnership with the biotechnology industry to accelerate progress toward that goal. In this article, we will define the need for better TB tests and describe technologies being developed to meet that need.
305 citations
TL;DR: Commercial NAATs can be confidently used to exclude TB in patients with smear positive samples in which environmental mycobacteria infection is suspected and to confirm TB in a proportion of smear negative cases.
Abstract: Background: Even though commercial nucleic acid amplification tests (NAATs) have become the most frequently used molecular tests for laboratory diagnosis of pulmonary tuberculosis (TB), published studies report variable estimates of their diagnostic accuracy. We analysed the accuracy of commercial NAATs for the diagnosis of pulmonary TB in smear positive and smear negative respiratory samples using culture as a reference standard. Methods: English language studies reporting data sufficient for calculating sensitivity and specificity of commercial NAATs on smear positive and/or smear negative respiratory samples were included. Meta-regression was used to analyse associations with reference test quality, the prevalence of TB, sample and test type. Predictive values for different levels of pre-test probability were quantified using Bayes' approach. Results: Sixty three journal articles published between 1995 and 2004 met the inclusion criteria. Pooled sensitivity and specificity were 0.96 and 0.85 among smear positive samples and 0.66 and 0.98 among smear negative samples. The number of culture media used as reference test, the inclusion of bronchial samples, and the TB prevalence were found to influence the reported accuracy. The test type had no effect on the diagnostic odds ratio but seemed to be correlated with sensitivity or specificity, probably via a threshold effect. Conclusions: Commercial NAATs can be confidently used to exclude TB in patients with smear positive samples in which environmental mycobacteria infection is suspected and to confirm TB in a proportion of smear negative cases. The methodological characteristics of primary studies have a considerable effect on the reported diagnostic accuracy.
175 citations
TL;DR: Targeting multiple sites of the TB genome using conventional PCR did not increase the number of positive cases and real-time PCR was more sensitive.
115 citations
01 Apr 2012
TL;DR: The phage-based platforms that are currently used for the detection of Mycobacterium tuberculosis, Yersinia pestis, Bacillus anthracis and Staphylococcus aureus in the clinical field are reviewed.
Abstract: Bacteriophages (phages) have been utilized for decades as a means for uniquely identifying their target bacteria. Due to their inherent natural specificity, ease of use, and straightforward production, phage possess a number of desirable attributes which makes them particularly suited as bacterial detectors. As a result, extensive research has been conducted into the development of phage, or phage-derived products to expedite the detection of human pathogens. However, very few phage-based diagnostics have transitioned from the research lab into a clinical diagnostic tool. Herein we review the phage-based platforms that are currently used for the detection of Mycobacterium tuberculosis, Yersinia pestis, Bacillus anthracis and Staphylococcus aureus in the clinical field. We briefly describe the disease, the current diagnostic options, and the role phage diagnostics play in identifying the cause of infection, and determining antibiotic susceptibility.
111 citations
TL;DR: Overall accuracy of phage-based assays is slightly higher than smear microscopy in direct head-to-head comparisons, and their performance characteristics are similar to sputum microscopy.
Abstract: Background: Sputum microscopy, the most important conventional test for tuberculosis, is specific in settings with high burden of tuberculosis and low prevalence of non tuberculous mycobacteria. However, the test lacks sensitivity. Although bacteriophage-based tests for tuberculosis have shown promising results, their overall accuracy has not been systematically evaluated. Methods: We did a systematic review and meta-analysis of published studies to evaluate the accuracy of phage-based tests for the direct detection of M. tuberculosis in clinical specimens. To identify studies, we searched Medline, EMBASE, Web of science and BIOSIS, and contacted authors, experts and test manufacturers. Thirteen studies, all based on phage amplification method, met our inclusion criteria. Overall accuracy was evaluated using forest plots, summary receiver operating (SROC) curves, and subgroup analyses. Results: The data suggest that phage-based assays have high specificity (range 0.83 to 1.00), but modest and variable sensitivity (range 0.21 to 0.88). The sensitivity ranged between 0.29 and 0.87 among smear-positive, and 0.13 to 0.78 among smear-negative specimens. The specificity ranged between 0.60 and 0.88 among smear-positive and 0.89 to 0.99 among smear-negative specimens. SROC analyses suggest that overall accuracy of phage-based assays is slightly higher than smear microscopy in direct head-to-head comparisons. Conclusion: Phage-based assays have high specificity but lower and variable sensitivity. Their performance characteristics are similar to sputum microscopy. Phage assays cannot replace conventional diagnostic tests such as microscopy and culture at this time. Further research is required to identify methods that can enhance the sensitivity of phage-based assays without compromising the high specificity.
84 citations
Cites background or methods or result from "Evaluation of a rapid bacteriophage..."
...Although some phage-based studies proved to be more sensitive than smear microscopy [5-7,10], others were not [8,9,12,13,15]....
[...]
...Of the two studies [7,12] that reported head to head comparisons of molecular tests with phage – based assays against a common reference test (i....
[...]
...The assay could offer new tools for the rapid diagnosis of TB in both the developed and developing world [3-18]....
[...]
...The study design was cross-sectional in 11 of 13 (85%) [5-13,15], and case-control in 2 studies (15%) [11,17]....
[...]
...Six studies [6,9,11-13,15] had used LJ cultures as the reference standard; three studies [5,7,10] used BACTEC 460; three studies [8,17] used LJ and BACTEC methods and one study [13] used LJ and AMTD tests....
[...]
References
More filters
Book•
15 Jan 2001
TL;DR: Molecular Cloning has served as the foundation of technical expertise in labs worldwide for 30 years as mentioned in this paper and has been so popular, or so influential, that no other manual has been more widely used and influential.
Abstract: Molecular Cloning has served as the foundation of technical expertise in labs worldwide for 30 years. No other manual has been so popular, or so influential. Molecular Cloning, Fourth Edition, by the celebrated founding author Joe Sambrook and new co-author, the distinguished HHMI investigator Michael Green, preserves the highly praised detail and clarity of previous editions and includes specific chapters and protocols commissioned for the book from expert practitioners at Yale, U Mass, Rockefeller University, Texas Tech, Cold Spring Harbor Laboratory, Washington University, and other leading institutions. The theoretical and historical underpinnings of techniques are prominent features of the presentation throughout, information that does much to help trouble-shoot experimental problems. For the fourth edition of this classic work, the content has been entirely recast to include nucleic-acid based methods selected as the most widely used and valuable in molecular and cellular biology laboratories. Core chapters from the third edition have been revised to feature current strategies and approaches to the preparation and cloning of nucleic acids, gene transfer, and expression analysis. They are augmented by 12 new chapters which show how DNA, RNA, and proteins should be prepared, evaluated, and manipulated, and how data generation and analysis can be handled. The new content includes methods for studying interactions between cellular components, such as microarrays, next-generation sequencing technologies, RNA interference, and epigenetic analysis using DNA methylation techniques and chromatin immunoprecipitation. To make sense of the wealth of data produced by these techniques, a bioinformatics chapter describes the use of analytical tools for comparing sequences of genes and proteins and identifying common expression patterns among sets of genes. Building on thirty years of trust, reliability, and authority, the fourth edition of Mol
215,169 citations
TL;DR: A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR) and may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
Abstract: A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
746 citations
"Evaluation of a rapid bacteriophage..." refers result in this paper
...Extraction procedures employing multiple steps to purify DNA from respiratory samples appear to have lower rates of inhibition (Eisenach et al., 1990) compared with those with fewer steps (Forbes & Hicks, 1993)....
[...]
TL;DR: Investigation of the use of DNA amplification by the polymerase chain reaction reaction (PCR) for detection of Mycobacterium tuberculosis from clinical specimens found that no patient who had three of more sputum specimens tested would have been misdiagnosed.
Abstract: We investigated the use of DNA amplification by the polymerase chain reaction reaction (PCR) for detection of Mycobacterium tuberculosis from clinical specimens. Two-thirds of each sample was processed for smear and culture by standard methods, and one-third was submitted for DNA extraction, amplification of a 317-bp segment within the insertion element IS6110, and detection by agarose gel electrophoresis, hybridization, or both. DNA was prepared from over 5,000 samples, with 623 samples being culture positive for acid-fast bacilli. Of 218 specimens that were identified as M. tuberculosis, 181 (85%) were positive by PCR. In the M. tuberculosis culture-positive group, PCR was positive for 136 of 145 (94%) and 45 of 73 (62%) of the fluorochrome smear-positive and -negative specimens, respectively. Of 948 specimens that were either culture positive for mycobacteria other than M. tuberculosis or culture negative, 937 specimens were negative by PCR and 11 (1%) specimens initially appeared to be false positive for M. tuberculosis. The reason for discrepant results varied; some errors were traced to the presence of an inhibitor in the specimen (7.3% in unselected specimens), nucleic acid contamination, low numbers of organisms in the specimen antituberculosis therapy, and possible low-level nonspecific hybridization. In comparison with culture, the sensitivity, specificity, and positive predictive value were 83.5, 99.0, and 94.2%, respectively, for PCR. When PCR was corrected for DNA contamination, the presence of inhibitor, and culture-negative disease, the values became 86.1, 99.7, and 98.4%, respectively. If the results for multiple specimens submitted from the same patient are considered, no patient who had three of more sputum specimens tested would have been misdiagnosed. Images
344 citations
"Evaluation of a rapid bacteriophage..." refers methods in this paper
...A 317 bp DNA segment specific for IS6110 of M. tuberculosis was amplified using a DNA Thermal Cycler (Perkin Elmer-Cetus) according to the method described by Clarridge et al. (1993)....
[...]
TL;DR: The potential of DNA amplification for early diagnosis of mycobacterial infections is confirmed and pre-treatment of samples with guanidium thiocyanate reduced the proportion of false-negative results and of samples that contained inhibitors.
304 citations
"Evaluation of a rapid bacteriophage..." refers result in this paper
...…PCR. Sensitivity results of our in-house PCR according to culture were comparable with those reported in different studies using IS6110-based PCR (Brisson-Noel et al., 1991; Lalande et al., 1996; Schirm et al., 1995) and those using the Amplicor test, with sensitivity ranging from 67 to 87 %…...
[...]
...To this end, the clinical performance of FASTPlaqueTBTM (a bacteriophage-based method) has been studied in parallel with microscopy, standard microbiological culture and in-house IS6110-based PCR methods....
[...]
...This study showed specificities of 95 % for both FASTPlaqueTB and ZN stain and 91 % for PCR. Sensitivity results of our in-house PCR according to culture were comparable with those reported in different studies using IS6110-based PCR (Brisson-Noel et al., 1991; Lalande et al., 1996; Schirm et al., 1995) and those using the Amplicor test, with sensitivity ranging from 67 to 87 % (Moore & Curry, 1995; Vuorinen et al., 1995)....
[...]
...We therefore aimed in this study to assess the clinical performance of a novel, rapid, commercial bacteriophagebased technique (FASTPlaqueTB) in parallel with in-house IS6110-based PCR, ZN staining and culture....
[...]
...Sensitivity results of our in-house PCR according to culture were comparable with those reported in different studies using IS6110-based PCR (Brisson-Noel et al., 1991; Lalande et al., 1996; Schirm et al., 1995) and those using the Amplicor test, with sensitivity ranging from 67 to 87 % (Moore & Curry, 1995; Vuorinen et al....
[...]
TL;DR: A preliminary clinical laboratory study of a medium containing 4 microCi palmitic-1-14C acid per ml showed that this method might provide the basis for practical laboratory use.
Abstract: The formulation of media for selective, automatable, radiometric detection of growth of Mycobacterium tuberculosis in vitro is described. Palmitic-1 acid labeled with carbon-14 and formic-14C acid were compared as substrate sources of [14C]O2 in media deficient in carbohydrate and containing appropriate antimicrobial agents that are not active against tubercle bacilli. A preliminary clinical laboratory study of a medium containing 4 µCi palmitic-1-14C acid per ml showed that this method might provide the basis for practical laboratory use.
243 citations
"Evaluation of a rapid bacteriophage..." refers background or methods in this paper
...Although new, more rapid diagnostic methods have been developed that are based either on liquid culture techniques such as BACTEC (Middlebrook et al., 1977) or on molecular techniques (Sandin, 1996), their expense plus the requirement for specialist personnel and equipment have limited their use in…...
[...]
...Although new, more rapid diagnostic methods have been developed that are based either on liquid culture techniques such as BACTEC (Middlebrook et al., 1977) or on molecular techniques (Sandin, 1996), their expense plus the requirement for specialist personnel and equipment have limited their use in many routine diagnostic laboratories, especially in developing countries....
[...]