scispace - formally typeset

Journal ArticleDOI

GALNS gene expression profiling in Morquio A patients' fibroblasts.

01 Nov 2008-Clinica Chimica Acta (Elsevier)-Vol. 397, Iss: 1, pp 72-76

TL;DR: The development of a real-time RT-PCR assay allows to absolutely quantify the GALNS mRNAs carrying mutations that lead to PTCs bearing transcripts, which escape the NMD process and are potentially suitable for the new therapeutic approach.

AbstractBackground Quantification studies of mutated mRNAs have not been carried out on Morquio A patients Such studies are very important for the determination of stability of premature termination codons (PTC) bearing transcripts in order to assess the appropriateness of introducing the newly developed therapeutic strategies such as “stop codon read-through therapy” Methods This paper focuses on the study of the GALNS gene and mRNAs in two severe forms of Morquio A patients' fibroblasts with development of a new and rapid real-time RT-PCR for detection and quantification of absolute mRNA copy number Results We identified two new mutations c385A > T (pK129X) and c899 − 1G > C) in Pt1 and a known splicing defect c120 + 1G > A in Pt2 Using RT-PCR and real-time RT-PCR in Pt2 we detected low levels of mRNAs, suggesting its instability; in Pt1, we detected three aberrant mRNAs introducing premature stop codons, suggesting that both the c385A > T and c899 − 1G > C mutations produce mRNAs capable of escaping the nonsense-mediated decay (NMD) pathway Conclusions The development of a real-time RT-PCR assay allows to absolutely quantify the GALNS mRNAs carrying mutations that lead to PTCs bearing transcripts, which escape the NMD process and are potentially suitable for the new therapeutic approach

Topics: Stop codon (54%)

Summary (2 min read)

1. Introduction

  • Classical forms are characterised by a lifespan of 20–30 years, short trunk dwarfism, spondyloepiphyseal dysplasia, coxa valga, odontoid hypo- ate sulfatase; MPS IVA, mucone-6-sulfate; KS, keratan sulain reaction; RT-PCR, reverse ure termination codon; NMD, se. 9 55 570380.
  • About 150 mutations have so far been identified, revealing a high degree of genetic heterogeneity that is probably responsible for the clinical variability in MPS IVA patients.
  • These mutations can cause very unstable mRNA transcripts or transcripts capable of escaping the nonsense-mediated decay (NMD) pathway, a molecular mechanism that reduces the amount of transcripts carrying premature termination codons (PTCs).

2.1. Patients

  • The clinical and biochemical findings of the two patients (Pt1 and Pt2) are shown in Table 1.
  • Deficiency of GALNS enzyme activity was confirmed on fibroblasts by the fluorogenic method previously reported by Van Diggelen et al. [13].
  • The molecular study was performed after informed consent, for genetic testing from patients' parents, was obtained.

2.2. Analysis of genomic DNA

  • To identify genetic lesions in the GALNS gene, genomic DNA was isolated from peripheral blood lymphocytes and fibroblasts.
  • The GALNS exons were amplified with the primers reported in Table 2. PCR products were visualized on a 2% agarose gel, excised and purified using Nucleospin Extract II extraction kit (MACHEREY-NAGEL, Duren, Germany).
  • About 100 ng of purified DNA was analyzed for mutation detection by nucleotide sequencing on ABI PRISM 310 Genetic Analyzer using BigDye terminator chemicals (Applied Biosystems, Foster City, CA).

2.3. RNA isolation and retrotranscription

  • Isolation of total RNA from cultured skin fibroblasts was performed with the TRIzol reagent (Life Technologies, Rockville, MD).
  • RNA integrity and concentrations were both checked by 1% agarose gel and Nanodrop® ND-1000 Spectrophotometer (Nanodrop technologies, Wilmington, USA).
  • RNA reverse transcription was carried out as follows: 1. 1–7 μg of total RNAs were reverse transcribed with Display THERMO-RT (Eppendorf, Hamburg, Germany) using the specific 3′ UTR primer 5′ GGAGGGTCCTGAAATCTGAGG 3′, according to the manufacturer.
  • The reverse transcripts obtained from the second method were used for quantitative real-time analysis.

2.4. RT-PCR analysis

  • Nucleotide numbers are derived from cDNA GALNS sequence (EMBL/Gen Bank/ DDBJ; accession number NM_000512).
  • The measurement of GALNS gene mRNA was performed using a quantitative realtime RT-PCR method, based on TaqMan™ technology.
  • Probe and primers were selected by the computer program “Primer Express” (Applied Biosystems, Foster City, USA).
  • Plasmid vector, carrying GALNS gene transcript (pCXN-GALNS), was tenfold serially diluted from a starting quantity of 11×106 plasmid copies to 11 plasmid copies and used as standard curve.

2.8. Statistical analysis

  • Statistical analysis of different real-time assay measurement was carried out using the SPSS software package (SPSS INC, Chicago, IL).
  • Statistical differences between I° PCR GALNSc1F 5′ CAGCCCAGCCGGAAGGGCC.
  • B. Schematic representation of the aberrant transcripts detected in MPS IVA Pt1.
  • Black boxes mark the exons, white boxes indicate exonic sequence loss.
  • Differences with pb0.05 were considered statistically significant.

3. Results

  • The fibroblasts from patients with enzymatic diagnosis of MPS IVA disease underwent molecular characterisation (Table 1).
  • The new c.385ANT leading to the premature stop codon p. K129X and the c.899−1GNC splicing mutations were identified in Pt1 and the reported c.120+1GNA mutation was identified in a homozygous state in Pt2.
  • Quantitative analysis of GALNS gene mRNA was performed by absolute real-time PCR, using probe and primers encompassing exon 6–7 junction, present in all Pt1's GALNS transcripts.
  • Results, reported in Fig. 2, indicated that this assay effectively distinguished 10-fold differences in concentration from about 11 to 11×106 vectors' molecules per reaction mixture.
  • The authors analyzed total RNA from the fibroblasts of two MPS IVA patients and 15 normal controls.

4. Discussion

  • About 150 genetic lesions have been reported in the GALNS gene of mucopolysaccharidosis IVA (MPS IVA) patients, indicating remarkable genetic heterogeneity.
  • The real-time technology is now highly sensitive, accurate and simple enough to be adopted as a routine method for measuring gene levels.
  • The presence in Pt1 of normal GALNS transcripts levels, identified by the real-time assay technique the authors describe, suggests that such mRNAs are not sensitive to NMD, according to what conventional RTPCR analysis has indicated.
  • Such transcripts can be highly unstable and subject to NMD [12,21].
  • Pt 2, who was homozygous for the c.120+1GNA mutation, had consanguineous North African parents whowere heterozygous for the mutation.

Did you find this useful? Give us your feedback

...read more

Content maybe subject to copyright    Report

10 August 2022
GALNS gene expression profiling in Morquio A patients' fibroblasts / L. Carraresi; R. Parini; C. Filoni; A.
Caciotti; G. Sersale; S. Tomatsu; C. Orlando; E. Zammarchi; R. Guerrini; M.A. Donati; A. Morrone. - In:
CLINICA CHIMICA ACTA. - ISSN 0009-8981. - STAMPA. - 397(1-2)(2008), pp. 72-76.
[10.1016/j.cca.2008.07.021]
Original Citation:
GALNS gene expression profiling in Morquio A patients' fibroblasts
Published version:
10.1016/j.cca.2008.07.021
Terms of use:
Publisher copyright claim:
(Article begins on next page)
La pubblicazione è resa disponibile sotto le norme e i termini della licenza di deposito, secondo quanto
stabilito dalla Policy per l'accesso aperto dell'Università degli Studi di Firenze
(https://www.sba.unifi.it/upload/policy-oa-2016-1.pdf)
Availability:
This version is available at: 2158/345954 since: 2019-07-25T12:00:19Z
Questa è la Versione finale referata (Post print/Accepted manuscript) della seguente pubblicazione:
FLORE
Repository istituzionale dell'Università degli Studi
di Firenze
Open Access
DOI:

GALNS gene expression proling in Morquio A patients' broblasts
L. Carraresi
a
, R. Parini
b
, C. Filoni
a
, A. Caciotti
a
, G. Sersale
b
, S. Tomatsu
c
, C. Orlando
d
, E. Zammarchi
e,
,
R. Guerrini
a
, M.A. Donati
a
, A. Morrone
a
a
Metabolic and Muscular Unit, Clinic of Pediatric Neurology, AOU Meyer, Florence, Italy
b
Metabolic Unit, San Gerardo Hospital, Monza, Milan, Italy
c
Department of Pediatrics, Saint Louis University, St. Louis, USA
d
Department of Clinical Physiopatology University of Florence, Florence, Italy
e
Metabolic and Muscular Unit, Department of Pediatrics, University of Florence, Meyer Children's Hospital, Via L. Giordano 13, Florence, Italy
abstractarticle info
Article history:
Received 5 June 2008
Received in revised form 22 July 2008
Accepted 22 July 2008
Available online 25 July 2008
Keywords:
Morquio A
GALNS expression proling
Real-time RT-PCR
References to electronic databases:
HUGO-approved gene symbol, GALNS
GenBank Accession number, D17629
N-acetylgalactosamine-6-sulfate sulfatase E.C.
number 3.1.6.4
Mucopolysaccharidosis IVA (MPS IVA, Mor-
quio type A) OMIM disorder/gene accession
number, 25300 0
Background: Quantication studies of mutated mRNAs have not been carried out on Morquio A patients. Such
studies are very important for the determination of stability of premature termination codons (PTC) bearing
transcripts in order to assess the appropriateness of introducing the newly developed therapeutic strategies
such as stop codon read-through therapy.
Methods: This paper focuses on the study of the GALNS gene and mRNAs in two severe forms of Morquio A
patients' broblasts with development of a new and rapid real-time RT-PCR for detection and quantication
of absolute mRNA copy number.
Results: We identied two new mutations c.385A N T (p.K129X) and c.899 1GN C) in Pt1 and a known splicing
defect c.120 +1GN A in Pt2. Using RT-PCR and real-time RT-PCR in Pt2 we detected low levels of mRNAs,
suggesting its instability; in Pt1, we detected three aberrant mRNAs introducing premature stop codons,
suggesting that both the c.385A N T and c.899 1GN C mutations produce mRNAs capable of escaping the
nonsense-mediated decay (NMD) pathway.
Conclusions: The development of a real-time RT-PCR assay allows to absolutely quantify the GALNS mRNAs
carrying mutations that lead to PTCs bearing transcripts, which escape the NMD process and are potentially
suitable for the new therapeutic approach.
© 2008 Elsevier B.V. All rights reserved.
1. Introduction
Deciency of the lysosomal enzyme N-acetylgalactosamine-6-
sulfate sulfatase (GALNS; E.C. 3.1.6.4; OMIM 253000) leads to mucopo-
lysaccharidosis IVA (MPS IVA: Morquio type A). GALNS hydrolyses the
sulfate ester groups of galactose-6-sulfate at the nonreducing end of
keratan sulphate (KS) and of N-acetylgalactosamine-6-sulfate (Gal-
NAc6S) at the nonreducing end of condroitin-6-sulfate (C6S) [1,2].
MPS IVA patients show a broad spectrum of clinical severity,
ranging from classical (severe) forms to milder phenotypes. Classical
forms are characterised by a lifespan of 2030 years, short trunk
dwarsm, spondyloepiphyseal dysplasia, coxa valga, odontoid hypo-
plasia, corneal clouding, preservation of intelligence, hepatospleno-
megaly and an excessive urinary excretion of KS and C6S [3,4]. Mild
forms imply little bone and visceral organ involvement and a
relatively good quality of life until 5060 years of age [5,6].
The GALNS enzyme is encoded by the GALNS gene, the latter,
mapped on chromosome 16q24.3 [79], encompassing about 50 kb
and organized in 14 exons and 13 introns [10].
About 150 mutations have so far been identied, revealing a high
degree of genetic heterogeneity that is probably responsible for the
clinical variability in MPS IVA patients.
Only a few studies have been carried out on human GALNS mRNA
[10,11] none of which including mRNA quantication by real-time PCR.
However mRNAs quantication can be helpful in studying mutations
causing disease such as splicing and nonsense alterations. These
mutations can cause very unstable mRNA transcripts or transcripts
capable of escaping the nonsense-mediated decay (NMD) pathway, a
molecular mechanism that reduces the amount of transcripts carrying
premature termination codons (PTCs). Consequently toxic or gain-of-
function proteins would be generated [12], resulting in different
phenotypes. Here we report characterisation of GALNS gene mutations
Clinica Chimica Acta 397 (2008) 7276
Abbreviations: GALNS, N-acetylgalactosamine-6-sulfate sulfatase; MPS IVA, muco-
polysaccharidosis IVA; GalNAc6S, N-acetylgalactosamine-6-sulfate; KS, keratan sul-
phate; C6S, chondroitin-6-sulfate; PCR, polymerase chain reaction; RT-PCR, reverse
transcriptase polymerase chain reaction; PTC, premature termination codon; NMD,
nonsense-mediated decay; MRD, minimal residual disease.
Corresponding author. Tel.: +39 55 5662543; fax: +39 55 570380.
E-mail address: neuromet@meyer.it (E. Zammarchi).
0009-8981/$ see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.cca.2008.07.021
Contents lists available at ScienceDirect
Clinica Chimica Acta
journal homepage: www.elsevier.com/locate/clinchim

and mRNA stability verifying a genotype/phenotype correlation in two
MPS IVA patients with a severe form.
2. Materials and methods
2.1. Patients
The clinical and biochemical ndings of the two patients (Pt1 and Pt2) are shown in
Table 1.Deciency of GALNS enzyme activity was conrmed on broblasts by the
uorogenic method previously reported by Van Diggelen et al. [13].
The molecular study was performed after informed consent, for genetic testing
from patients' parents, was obtained.
2.2. Analysis of genomic DNA
To identify genetic lesions in the GALNS gene, genomic DNA was isolated from
peripheral blood lymphocytes and broblasts. The GALNS exons were amplied with
the primers reported in Table 2.
Amplication of genomic fragments was performed on 400 ng of genomic DNA and
PCR conditions for all the exons were: denaturation at 94 °C for 5 min, 28 cycles at 94 °C
for 1 min, 65 °C for 1 min, 72 °C for 1 min, and a nal extension cycle at 72 °C for 10 min.
PCR products were visualized on a 2% agarose gel, excised and puried using
Nucleospin Extract II extraction kit (MACHEREY-NAGEL, Duren, Germany). About
100 ng of puried DNA was analyzed for mutation detection by nucleotide sequencing
on ABI PRISM 310 Genetic Analyzer using BigDye terminator chemicals (Applied
Biosystems, Foster City, CA).
2.3. RNA isolation and retrotranscription
Isolation of total RNA from cultured skin broblasts was performed with the TRIzol
reagent (Life Technologies, Rockville, MD). RNA integrity and concentrations were both
checked by 1% agarose gel and Nanodrop
®
ND-10 00 Spectrophotometer (Nanodrop
technologies, Wilmington, USA).
RNA reverse transcription was carried out as follows:
1. 17 μg of total RNAs were reverse transcribed with Display THERMO-RT (Eppendorf,
Hamburg, Germany) using the specic3 UTR primer 5 GGAGGGTCCTGAAA-
TCTGAGG 3, according to the manufacturer.
2. 400 ng total RNAs we re re verse transcribed in 80 μlofnal volume in a reaction
mixture containi ng 10 μl TaqMan RT buffer 1×, 5.5 mM MgCl
2
,500μMeachdNTP,
2.5 μM random hexamers, 0. 4 U/μl RNase Inhibitor and 1.25 U/μlMulti-
Scribe Reverse transcriptase provided by Applied Biosystems. The prole of the
one-step reverse transcriptase was: 10 min at 25 °C, 30 min at 48 °C and 2 min at
95 °C.
The reverse transcripts obtained from the second method were used for
quantitative real-time analysis.
2.4. RT-PCR analysis
A rst full length reverse transcriptase PCR (RT-PCR) was performed with the
following amplication primers:
PCR Primer forward GALNS c1F 5 CAGCCCAGCCGGAAGGGCC 3 or
GALNS OMF139 5 CGGGGCTCCGCGGCTCCCGTGGTTG 3
Primer reverse GALNS c6R 5 GGCAAAGCTGAGGGGGAACC 3
13 μlofrst RT-PCR amplication was used as a template in a nested PCR using the
following primers:
II° PCR (nested) Primer forward GALNS c1F 5 CAGCCCAGCCGGAAGGGCC 3 or
GALNS c2F 5 GGACCGGATGGCTGCAGAA 3 or
GALNS c3F 5 CAAGGCCAGGCCCAACATCC 3
Primer reverse GALNS c3R 5 CGCCGTTGTCCGACGTGAAG 3 or
GALNS c5R 5 ACACGTTGAGCTGGGGCTGC 3
Cycle conditions were the same as those used for the analysis of genomic DNA.
2.5. Mutation nomenclature
The reported mutations are described according to mutation nomenclature (http://
www.hgvs.org/mutnomen/recs.html) considering nucleotide + 1 the A of the rst ATG
Table 1
Clinical, biochemical and molecular data of MPS IV A patients
Patient 1 Patient 2
Sex F F
Age at diagnosis (y) 1 2
Qualitative urinary MPS Keratan excretion Keratan excretion
GALNS activity (broblasts)
(105380 nmol/mg/17h)
0.2 1.1
Genotype
a
Allele 1 c.385AN T (p.K129X)
[This study]
c.120 +1G N A
[36]
Allele 2 c.899 1GN C
[This study]
c.120 +1G N A
[36]
Parents' consanguinity No Yes
At present Age (y) 9 7
Height(cm) 91 89
Weight (kg) 22.8 14
Spondylo-Epiphyseal-
dysplasia
Yes Yes
Chest deformity Yes Yes
Hearing loss Yes Yes
Corneal clouding Yes Yes
Coxa valga Yes Yes
Odontoid hypoplasia Yes Yes
Visceromegaly Yes Yes
Cardiac involvement
(left ventricular hypertrophy/
valva disease)
Mitral, aortic and
tricuspidal
regurgitation
Mitral
regurgitation
y= year; na = not available.
a
In square brackets, citation refers to the rst report.
Table 2
Primers for PCR amplication of GALNS gene
Primer
name
Segment
a
Oligonucleotide Fragment
length
Exon 1
galns 1F Sense 168/ 148 nt
b
5 CTGGTCACGAGGCAGTCCAG3 351
galns 1R Antisense +46/+64 nt 5 CTCCATCCGCCCCTCCCCT 3
Exon 2
galns 2F Sense 54/ 34 nt 5 CCAGAAGCACCTGCAGAAGGC 3 231
galns 2R Antisense +34/+53 nt 5 CCTCGGCCTGTTGGGCTCAC 3
Exon 3
galns 3F Sense 65/ 46 nt 5 GTTGACGCCCGGGGTCTGAG 3 208
galns 3R Antisense +49/+68 nt 5 CACCACCCGTAGCCCACCTG 3
Exon 4
galns 4F Sense 66/ 46 nt 5 GTTAGGATGGGGTTGGTGGCA 3 231
galns 4R Antisense +42/+62 nt 5 GGAACCAAGGCCAGGAAGTGG 3
Exon 5
galns 5F Sense 51/ 33 nt 5 CCGAGTGTCCCCACGTGGG 3 245
galns 5R Antisense +31/+50 nt 5 CGGGCACAGCAGTTCAGGAC 3
Exon 6
galns 6F Sense 71/ 51 nt 5 GGTGAAATCAGGGAGAACGGG 3 205
galns 6R Antisense +48/+67 nt 5 GGATGAGGTTGGTGCGGTCC 3
Exon 7
galns 7F Sense 67/ 49 nt 5 GGGGACCGTGGGAGGCATG 3 279
galns 7R Antisense +48/+68 nt 5 CCCATCTCTGGAGTCAAGCAC 3
Exon 8
galns 8F Sense 70/ 51 nt 5 GCCGTTGGCTGCCTGATCCA 3
277
galns 8R Antisense +48/+67 nt 5 GGTCCAGGCACTCTTCGCTG 3
Exon 9
galns 9F Sense 107/ 88 nt 5 CCGGGCCCTTTGTCCCTATG 3 284
galns 9R Antisense +55/+73 nt 5 GAGGGGCGCACACACCCTG 3
Exon 10
galns 10F Sense 72/ 54 nt 5 CCCAGGGATTGGCCCCCAG 3 292
galns 10R Antisense +65/+83 nt 5 GGCCTGGGGGTTGCACCTG 3
Exon 11
galns 11F Sense 69/ 51 nt 5 CCCAGAGCCTCCAGGTGGC 3 239
galns 11R Antisense +49/+ 67 nt 5 GCTCAGGGGCCACGTCTGG 3
Exon 12
galns 12F Sense 120/ 101 nt 5 CTCTGTCCCTGTGGAGCCTG 3 321
galns 12R Antisense +60/+ 79 nt 5 CTCTGTCCCTGTGGAGCCTG 3
Exon 13
galns 13F Sense 69/ 51 nt 5 GTCCAGGCCAGCCCCTCTC 3 261
galns 13R Antisense +56/+74 nt 5 CGGTTCATCCTGGGCCCCG 3
Exon 14
galns 14F Sense 67/ 49 nt 5 CCGCTGCTGCTGGGTCCAG 3 533
galns
14R-int
Antisense +361/
+379 nt
c
5 CCCAGCCACCTCGGCACC 3
a
Numbered from each intron/exon junction according to den Dunnen et al. [14,15].
b
1 is the adenine of the initiator Met.
c
1 is the guanine of the stop codon.
73L. Carraresi et al. / Clinica Chimica Acta 397 (2008) 7276

translation initiation codon [14,15]. Nucleotide numbers are derived from cDNA GALNS
sequence (EMBL/Gen Bank/ DDBJ; accession number NM_000512).
2.6. Quantication of GALNS mRNA
The measurement of GALNS gene mRNA was performed using a quantitative real-
time RT-PCR method, based on TaqMan technology. Probe and primers were selected
by the computer program Primer Express (Applied Biosystems, Foster City, USA). For
the detection of GALNS mRNA the following probe and primers were chosen on GALNS
cDNA (1569 bp): probe 635/649 nt: 5 AAGCCCTGGACTTCA 3 labeled with FAM, located
on exon 7, forward primer 608/629 nt: 5 CCAACCTCACCCAGATCTACCT 3 which
hybridizes on exon 6, reverse primer 664/651 nt: 5 GGTGCCGTGCTTGTCTCTTA 3
located on exon 7. PCR analysis was performed using 25 ng of cDNA in a reaction
mixture containing 300 nM of forward and reverse primers and 200 nM of the
uorescent probe, and 12.5 μl Universal master Mix. Plates were treated 2 min at 50 °C,
10 min at 95 °C and then submitted to 40 cycles of amplication at 95 °C for 15 s, 60 °C
for 1 min in the ABI Prism 7000 Sequence Detector PE Applied Biosystems (Foster City,
USA). Plasmid vector, carrying GALNS gene transcript (pCXN-GALNS), was tenfold
serially diluted from a starting quantity of 11 ×10
6
plasmid copies to 11 plasmid copies
and used as standard curve. The absolute values of GALNS gene mRNA products were
expressed as copy/μg total RNA (mean ± SD).
2.7. Splice site score calculation
A numerical score expressing adherence to the consensus sequences was calculated
by the http://www.fruity.org/.
2.8. Statistical analysis
Statistical analysis of different real-time assay measurement was carried out using
the SPSS software package (SPSS INC, Chicago, IL). Statistical differences between
groups were assessed by t-test. Differences with p b 0.05 were considered statistically
signicant.
3. Results
The broblasts from patients with enzymatic diagnosis of MPS IVA
disease underwent molecular characterisation (Table 1). Exons and
exonintron boundaries of the GALNS gene were amplied and
directly sequenced on both strands.
Sequence analyses of the GALNS gene of the MPS IVA patients led
to the identication of two new alterations and a known splicing
mutation. The new c.385AN T leading to the premature stop codon p.
K129X and the c.899 1G N C splicing mutations were identied in Pt1
and the reported c.120+ 1G N A mutation was identied in a homo-
zygous state in Pt2.
The splice acceptor site mutation c.899 1GN C, located in intron 8,
led to the detection, by RT-PCR, of two aberrantly spliced transcripts
(Fig. 1A): transcript 1, devoid of exon 9, and transcript 2, lacking the
entire exon 9 and the rst 120 bp of exon 10 (Fig. 1B). Sequence
analysis showed that both transcripts led to a frameshift, introducing a
premature stop codon.
The new c.385AN T nucleotide change, in exon 4, leading to the p.
K129X nonsense mutation, was also detected in the mRNA by
conventional RT-PCR and sequence analyses.
The known c.120+ 1G N A splicing mutation was identied at a
homozygous state in Pt 2 with North African background. In this
patient conventional RT-PCR analysis, performed with different
amplication primers (by both specic3 UTR primer and random
hexamers), on agarose gel, failed to detect, any aberrant transcript
(Fig. 1A).
Quantitative analysis of GALNS gene mRNA was performed by
absolute real-time PCR, using probe and primers encompassing exon
67 junction, present in all Pt1's GALNS transcripts. To determine the
quantity of mRNA in patients' specimens, pCXN-GALNS vector was
used to generate the standard curve. Results, reported in Fig. 2,
indicated that this assay effectively distinguished 10-fold differences
Fig. 1. A. RT-PCR analysis of MPS IVA patients. The PCR products, run on 2% agarose gel,
were obtained after total RNA retrotranscription with random hexamers and two
subsequent ampli cations with the following primers:
PCR GALNSc1F 5 CAGCCCAGCCGGAAGGGCC 3
GALNSc6R 5 GGCAAAGCTGAGGGGGAACC 3
II° PCR (nested) GALNSc3F 5 CAAGGCCAGGCCCAACATCC 3
GALNSc5R 5 ACACGTTGAGCTGGGGCTGC 3
1. Molecular weight marker, 2. Pt 1, 3. Pt 2, 4. Normal control. B. Schematic
representation of the aberrant transcripts detected in MPS IVA Pt1. Black boxes mark
the exons, white boxes indicate exonic sequence loss.
Fig. 2. Real-time standard curve. Amplication plot showing the standard curve of
plasmid vector pCXN-GALNS, generated by seven tenfold serial dilution from a starting
quantity of 11 × 10
6
plasmid copies, and controls, Pt1 and Pt2 samples.
74 L. Carraresi et al. / Clinica Chimica Acta 397 (2008) 7276

in concentration from about 11 to 11×10
6
vectors' molecules per
reaction mixture.
We analyzed total RNA from the broblasts of two MPS IVA
patients and 15 normal controls. With respect to the standard
deviation, the mean value of GALNS control mRNAs was not
signicantly different from that of Pt 1 sample (normal mean value:
6.76× 10
5
±3.17×10
5
, patient's mean value 5.59×10
5
±2.8×10
5
mole-
cules). Pt 2, homozygous for the c.120 + 1G N A mutation, showed an
almost complete absence of the GALNS mRNA (only 8.46×10
2
±
2.61 × 10
2
molecules of GALNS mRNA were detected), conrming
conventional RT-PCR data (Fig. 2 and Table 3).
In Table 4 we report the s plice site s core calculated for
physiological and cryptic sites for the splicing of exon 1 and exon 9.
4. Discussion
About 150 genetic lesions have been reported in the GALNS gene of
mucopolysaccharidosis IVA (MPS IVA) patients, indicating remarkable
genetic heterogeneity.
Here we report two Mediterranean patients affected by a severe
form of the disease. We identied one known and two new mutations
causing severe genetic lesions and contributing to the wide spectrum
of allelic heterogeneity of this disease.
Computational analysis showed that these two splicing mutations
dramatically decrease the numerical score of the invariant affected
motifs (Table 4). Conventional GALNS RT-PCR analysis showed the
almost complete absence of transcripts in Pt2 while in Pt1 the
presence of three different transcripts was identied. One of such
transcripts takes advantage of a cryptic splice site inside exon 10,
whose computational score resulted to be very high (0.97).
Anyhow such end-point analysis was not precise enough to
quantify the mRNAs. We therefore developed a real-time RT-PCR
assay to quantify absolute mRNA copy numbers and to determine
whether the GALNS transcripts of Pt1 were subject to NMD
degradation.
NMD is a mechanism that, with some exceptions [1620], down-
regulates spliced mRNAs presenting premature termination codons
about 50 to 55 nucleotides upstream of the subsequent exonexon
junction. Consequently, it prevents the production of the potentially
toxic truncated proteins they encode [12,21].
Quantitative real-time PCR has been used in hematology and
oncology to monitor response to treatment and detect minimal
residual disease (MRD) in leukemia and lymphoma [2224]. This
accurate quantication of mRNAs expression levels can also be utilised
for genotypephenotype correlation and for investigating the patho-
genetic mechanism of diseases. The real-time technology is now
highly sensitive, accurate and simple enough to be adopted as a
routine method for measuring gene levels. However, although a
number of studies on real-time mRNA quantication of lysosomal
genes have been performed [2532], only one did reported on
absolute mRNA copy number detection [33].
The presence in Pt1 of normal GALNS transcripts levels, identied
by the real-time assay technique we describe, suggests that such
mRNAs are not sensitive to NMD, according to what conventional RT-
PCR analysis has indicated.
These results increase the number of known cases in which the
nonsense-mediated mRNA decay surveillance system is bypassed
[16,20,31,34,35]. Only the c.385A N T (p.K129X) mutation, which is 38
nucleotides upstream of the donor splice site of intron 4, ful
lled the
condition that PTCs located within a distance of 50 to 55 nucleotides
from the subsequent exonexon junction do not trigger NMD. The
reason why mRNAs, such as aberrant transcripts 1 and 2, caused by Pt
1's c.899 1G N C mutation, escape mRNA surveillance is unknown, but
a modulation of NMD sensitivity mediated by additional, unidentied
factors cannot be excluded [36].
Conventional RT-PCR analysis performed on Pt 2, who carried the
c.120+ 1G N A at a homozygous level, failed to detect any aberrant
transcript and the more sensitive and accurate real-time RT-PCR
analysis showed very low GALNS transcript levels: only 8.46 × 10
2
±
2.61× 10
2
copies compared to the 6.76×10
5
±3.17×10
5
copies of
normal controls.
In Pt2 a constitutive 5 splice donor site is mutated with a
signicant reduction of splice site score (0.99 vs b 0.40). It is known
that mutations affecting constitutive 5 splice site lead to the complete
exon skipping or to the use of a nearby cryptic site. This could lead, in
Pt2, to aberrant transcripts resulting in frame shift products contain-
ing PTCs. Such transcripts can be highly unstable and subject to NMD
[12,21]. This could explain the almost complete absence of GALNS
mRNA in this patient.
Pt 2, who was homozygous for the c.120+ 1G N A mutation, had
consanguineous North African parents who were heterozygous for the
mutation. The c.120 + 1G N A mutation has also been described in ve
Tunisian patients, with the classical form of MPS IVA, segregating in
three families [37]. These results suggest a common ancestor in North
African populations, as suggested by Laradi et al. [36].
Detection of severe mutations in these patients, leading to
truncated proteins, with potentially deleterious activities, indicates a
correlation between the genotype and severe phenotype severity.
We believe that it is important to determine the stability of PTC
bearing transcripts in MPS IVA patients in order to assess the
appropriateness of new therapeutic strategies. Recent studies indicate
that it may be possible to correct the negative effect of mutations
causing in-frame nonsense codons (stop codon read-through) using
aminoglycoside antibiotics which, by virtue of their low molecular
weight, are able to enter, by diffusion, cells, tissues and organs that are
otherwise not easily accessible [38,39]. High levels of nonsense
containing mRNAs, able to escape NMD, will result in an enhanced
level of drug-induced read-through, making transcripts, from the
allele with the c.385A N T mutation good candidates for this kind of
therapy.
Acknowledgements
The authors thank the patients' families for their collaboration.
This paper was partially nanced by grants: MIUR-PRIN 20 06, Fondi
Ateneo (MURST ex 60%), Azienda Ospedaliero-Universitaria Meyer,
Association AMMEC and MPS Italy.
Table 3
Number of GALNS copies detected in MPS IVA patients and control samples
Patient Number of copies GALNS±SD
1 5.59× 10
5
±2.8 × 10
5
2 8.46× 10
2
±2.61× 10
2
Normal mean value 6.76× 10
5
±3.17×10
5
Table 4
Score calculation of canonical and cryptic splice sites by the http://www.fruity.org/
Patient Transcript Sequence Splice site
score
Pt1 Normal INT8 acaagggcccctctctcccaggtggcagcaacggccccttt
EX9
0.94
Mutant INT8 acaagggcccctctctcccacgtggcagcaacggccccttt
EX9
b 0.40
Aberrant
transcript 1
INT tgttgctgccatgtgtttcaggtgagccaccagctgggcag EX 0.87
Aberrant
transcript 2
INT ctcctccccaccctcctgcagggccggctgatggacaggtt EX 0.97
Pt2 Normal EX1 ggacgacgtgagtgc INT1 0.99
Mutant EX1 ggacgacatgagtgc INT1 b 0.40
75L. Carraresi et al. / Clinica Chimica Acta 397 (2008) 7276

Citations
More filters

Journal ArticleDOI
TL;DR: The three-dimensional structure of human GALNS is reported, which establishes the molecular basis for MPS IV A and for the larger MPS family of diseases.
Abstract: Lysosomal enzymes catalyze the breakdown of macromolecules in the cell. In humans, loss of activity of a lysosomal enzyme leads to an inherited metabolic defect known as a lysosomal storage disorder. The human lysosomal enzyme galactosamine-6-sulfatase (GALNS, also known as N-acetylgalactosamine-6-sulfatase and GalN6S; E.C. 3.1.6.4) is deficient in patients with the lysosomal storage disease mucopolysaccharidosis IV A (also known as MPS IV A and Morquio A). Here, we report the three-dimensional structure of human GALNS, determined by X-ray crystallography at 2.2A resolution. The structure reveals a catalytic gem diol nucleophile derived from modification of a cysteine side chain. The active site of GALNS is a large, positively charged trench suitable for binding polyanionic substrates such as keratan sulfate and chondroitin-6-sulfate. Enzymatic assays on the insect-cell-expressed human GALNS indicate activity against synthetic substrates and inhibition by both substrate and product. Mapping 120 MPS IV A missense mutations onto the structure reveals that a majority of mutations affect the hydrophobic core of the structure, indicating that most MPS IV A cases result from misfolding of GALNS. Comparison of the structure of GALNS to paralogous sulfatases shows a wide variety of active-site geometries in the family but strict conservation of the catalytic machinery. Overall, the structure and the known mutations establish the molecular basis for MPS IV A and for the larger MPS family of diseases.

97 citations


Journal ArticleDOI
TL;DR: A molecular testing algorithm designed to help diagnosing MPS IVA and foreseeing disease progression is defined and two new large deletions are characterized and their corresponding breakpoints are characterized.
Abstract: Morquio A syndrome (MPS IVA) is a systemic lysosomal storage disorder caused by the deficiency of N-acetylgalactosamine-6-sulfatase (GALNS), encoded by the GALNS gene. We studied 37 MPS IV A patients and defined genotype-phenotype correlations based on clinical data, biochemical assays, molecular analyses, and in silico structural analyses of associated mutations. We found that standard sequencing procedures, albeit identifying 14 novel small GALNS genetic lesions, failed to characterize the second disease-causing mutation in the 16% of the patients' cohort. To address this drawback and uncover potential gross GALNS rearrangements, we developed molecular procedures (CNV [copy-number variation] assays, QF-PCRs [quantitative fluorescent-PCRs]), endorsed by CGH-arrays. Using this approach, we characterized two new large deletions and their corresponding breakpoints. Both deletions were heterozygous and included the first exon of the PIEZO1 gene, which is associated with dehydrated hereditary stomatocitosis, an autosomal-dominant syndrome. In addition, we characterized the new GALNS intronic lesion c.245-11C>G causing m-RNA defects, although identified outside the GT/AG splice pair. We estimated the occurrence of the disease in the Italian population to be approximately 1:300,000 live births and defined a molecular testing algorithm designed to help diagnosing MPS IVA and foreseeing disease progression.

22 citations


Cites background or methods from "GALNS gene expression profiling in ..."

  • ...RNA reverse transcription was carried out as previously described [Carraresi et al., 2008]....

    [...]

  • ...The normalizations were performed by relatively quantizations, determined by the Ct ([FAM Ct- VIC Ct] sample—[FAM Ct–VIC Ct] calibrator) method as previously reported [Livak and Schmittgen, 2001]. mRNA Analyses Total mRNA quantitation was performed as previously described [Carraresi et al., 2008]....

    [...]

  • ...Only a few studies to date have focused on characterizing human GALNS mRNA [Nakashima et al., 1994; Tomatsu et al., 2004] in the diagnosis of MPS IVA, and we reported the first study on mRNA quantification by real-time PCR [Carraresi et al., 2008]....

    [...]


Journal ArticleDOI
TL;DR: The LSD Morquio A syndrome is added for the first time to the list of conditions that can be caused by UPD, and the possibility of UPD is relevant when giving genetic counseling to couples since the recurrent risk in future pregnancies is dramatically reduced.
Abstract: Morquio A syndrome (MPS IVA) is a recessive lysosomal storage disorder (LSD) caused by mutations in the GALNS gene leading to the deficiency of lysosomal enzyme N-acetylgalactosamine-6-sulfate sulfatase (GALNS). Patients show a broad spectrum of phenotypes ranging from classical severe type to mild forms. Classical forms are characterized by severe bone dysplasia and usually normal intelligence. So far, more than 170 unique mutations have been identified in the GALNS gene of MPS IVA patients. We report on a Morquio A patient with a classical phenotype who was found to be homozygous for a missense mutation (c.236 G>A; p.Cys79Tyr) in the GALNS gene. This alteration affects the highly conserved p.Cys79 that is transformed into formylglycine, the catalytic residue of the active site. The mutation was present in the proband's mother, but not in the father, whose paternity was confirmed by microsatellite analysis. In order to test the hypothesis of maternal uniparental disomy (UPD), we investigated the segregation of sixteen microsatellite markers from chromosome 16. The results showed a condition of maternal UPD due to an error in meiosis I. Maternal isodisomy of the 16q24 region led to homozygosity for the GALNS mutant allele, causing the patient's disease. These findings allow to add for the first time the LSD Morquio A syndrome to the list of conditions that can be caused by UPD. The possibility of UPD is relevant when giving genetic counseling to couples since the recurrent risk in future pregnancies is dramatically reduced.

15 citations


Cites methods from "GALNS gene expression profiling in ..."

  • ...The entire GALNS coding region and exon/intron boundaries were amplified and directly sequenced using previously described primers and conditions [26]....

    [...]


Journal ArticleDOI
TL;DR: GALNS variants located within deep intronic regions that have the potential to impact splicing machinery are identified and incorporated into the diagnostic flow procedure for the molecular analysis of Morquio A disease.
Abstract: Mucopolysaccharidosis-IVA (Morquio A disease) is a lysosomal disorder in which the abnormal accumulation of keratan sulfate and chondroitin-6-sulfate is consequent to mutations in the galactosamine-6-sulfatase (GALNS) gene. Since standard DNA sequencing analysis fails to detect about 16% of GALNS mutant alleles, gross DNA rearrangement screening and uniparental disomy evaluation are required to complete the molecular diagnosis. Despite this, the second pathogenic GALNS allele generally remains unidentified in ~ 5% of Morquio-A disease patients. In an attempt to bridge the residual gap between clinical and molecular diagnosis, we performed an mRNA-based evaluation of three Morquio-A disease patients in whom the second mutant GALNS allele had not been identified. We also performed sequence analysis of the entire GALNS gene in two patients. Different aberrant GALNS mRNA transcripts were characterized in each patient. Analysis of these transcripts then allowed the identification, in one patient, of a disease-causing deep intronic GALNS mutation. The aberrant mRNA products identified in the other two individuals resulted in partial exon loss. Despite sequencing the entire GALNS gene region in these patients, the identity of a single underlying pathological lesion could not be unequivocally determined. We postulate that a combination of multiple variants, acting in cis, may synergise in terms of their impact on the splicing machinery. We have identified GALNS variants located within deep intronic regions that have the potential to impact splicing. These findings have prompted us to incorporate mRNA analysis into our diagnostic flow procedure for the molecular analysis of Morquio A disease.

10 citations


Journal Article
TL;DR: The combination of corrective therapy (CT) with paliative therapy (PT) is the most promising strategy to solve most of the multisystem manifestations of LSD.
Abstract: Lysosomal storage diseases (LSD) are caused by monogenic mutations in genes coding for multiple aberrant proteins involved in the catabolism of complex lipids, glycosaminoglycans, oligosaccharides, or nucleic acids. The pathophysiology of the LSD is due to abnormal accumulation of non-hydrolyzed substrate in the lysosomes, affecting the architecture and function of cells, tissues and organs. Due to their genic and allelic heterogeneity the LSD present a wide clinical spectrum in severity of symptoms, evolution and age of onset. The therapeutic strategy has two goals: 1) Palliative management of symptoms (splenectomy, surgery to improve or restore joints or bones, drugs for CNS symptoms, etc.), and 2) The correction of activity of the mutant protein, the former has two approaches: A) Replacing deficient protein (bone marrow transplantation, hematopoietic stem cells or umbilical cord blood cells; replacement with recombinant enzyme and gene therapy) and B) Activate or enhanced the functionality of the mutant enzyme with therapeutic small molecules. Neither of the known treatments is able to address all aspects of these multisystemic disorders, nor cure the patients. Currently, the combination of corrective therapy (CT) with paliative therapy (PT) is the most promising strategy to solve most of the multisystem manifestations. The multidisciplinary medical care is fundamental for diagnosis, treatment and control of disease. Nanotechnology opens a promising new era in the treatment of LSD. Finally, the LSD that has CT must be included in newborn screening programs in order to implement timely treatment and prevent irreversible damage.

2 citations


References
More filters

Journal ArticleDOI
TL;DR: Suggestions are presented for reporting complex mutations in a unified manner for efficient and accurate reporting, testing, and curation of the growing number of disease mutations and useful polymorphisms being discovered in the human genome.
Abstract: Consistent gene mutation nomenclature is essential for efficient and accurate reporting, testing, and curation of the growing number of disease mutations and useful polymorphisms being discovered in the human genome. While a codified mutation nomenclature system for simple DNA lesions has now been adopted broadly by the medical genetics community, it is inherently difficult to represent complex mutations in a unified manner. In this article, suggestions are presented for reporting just such complex mutations.

1,714 citations


Journal ArticleDOI
01 Jun 2003-Leukemia
TL;DR: The interpretation of RQ-PCR MRD data needs standardized criteria and reporting of MRDData needs international uniformity, and several European networks have now been established and common guidelines for data analysis and for reporting ofMRD data are being developed.
Abstract: Detection of minimal residual disease (MRD) has prognostic value in many hematologic malignancies, including acute lymphoblastic leukemia, acute myeloid leukemia, chronic myeloid leukemia, non-Hodgkin's lymphoma, and multiple myeloma. Quantitative MRD data can be obtained with real-time quantitative PCR (RQ-PCR) analysis of immunoglobulin and T-cell receptor gene rearrangements, breakpoint fusion regions of chromosome aberrations, fusion-gene transcripts, aberrant genes, or aberrantly expressed genes, their application being dependent on the type of disease. RQ-PCR analysis can be performed with SYBR Green I, hydrolysis (TaqMan) probes, or hybridization (LightCycler) probes, as detection system in several RQ-PCR instruments. Dependent on the type of MRD-PCR target, different types of oligonucleotides can be used for specific detection, such as an allele-specific oligonucleotide (ASO) probe, an ASO forward primer, an ASO reverse primer, or germline probe and primers. To assess the quantity and quality of the RNA/DNA, one or more control genes must be included. Finally, the interpretation of RQ-PCR MRD data needs standardized criteria and reporting of MRD data needs international uniformity. Several European networks have now been established and common guidelines for data analysis and for reporting of MRD data are being developed. These networks also include standardization of technology as well as regular quality control rounds, both being essential for the introduction of RQ-PCR-based MRD detection in multicenter clinical treatment protocols.

548 citations


Journal ArticleDOI
TL;DR: Nonsense-mediated mRNA decay in mammalian cells generally degrades mRNAs that terminate translation more than 50-55 nucleotides upstream of a splicing-generated exon-exon junction.
Abstract: Nonsense-mediated mRNA decay (NMD) in mammalian cells generally degrades mRNAs that terminate translation more than 50-55 nucleotides upstream of a splicing-generated exon-exon junction (reviewed in [Maquat, 2004a][1]; [Nagy and Maquat, 1998][2]). Notably, dependence on exon-exon junctions

275 citations


Journal ArticleDOI
TL;DR: This study conducted a study in which MPS IVA patients were asked to fill out a questionnaire with inquiries regarding family history, diagnosis, signs and symptoms, height, weight, surgical history, physical activity, and general complaints to provide a reference for assessment of efficacy for studies of novel therapies.
Abstract: Mucopolysaccharidosis IVA (MPS IVA; Morquio A disease) is a lysosomal storage disorder caused by deficiency of N-acetylgalactosamine-6-sulfate sulfatase. The natural history of this disease is incompletely understood. To study which variables influence the clinical outcome, we conducted a study in which MPS IVA patients were asked to fill out a questionnaire with inquiries regarding family history, diagnosis, signs and symptoms, height, weight, surgical history, physical activity, and general complaints. A total of 326 patients (172 male, 154 female) from 42 countries enrolled in the Morquio A Registry programme. The mean age of patients enrolled was 14.9 years for males and 19.1 years for females, with a wide range of 1–73 years. Sixty-four per cent of the patients were under 18 years. Initial symptoms were recognized between 1 and 3 years of age (mean age 2.1 years) and mean age at diagnosis for the patients was 4.7 years. A progressive skeletal dysplasia was commonly observed among the MPS IVA patients. Fifty per cent of patients underwent surgical operations to improve their quality of life. The most frequent surgical sites include neck (51%), ear (33%), leg (26%) and hip (25%). The birth length for affected males and females was 52.2 ± 4.7 cm and 52.2 ± 4.5 cm, respectively. The final adult height for affected males and females was 122.5 ± 22.5 cm and 116.5 ± 20.5 cm, respectively. The results of this study provide a reference for assessment of efficacy for studies of novel therapies.

262 citations


Journal ArticleDOI
TL;DR: How to determine which PTCs elicit NMD is reviewed, what is currently known about the mechanism of NMD, and additional information that is pertinent to establishing therapies for PTC-associated diseases are reviewed.
Abstract: Premature termination codons (PTCs) are equivalent to nonsense sequences. They encode no amino acid, and their presence precludes the synthesis of full-length proteins. Furthermore, the resulting truncated proteins, if synthesized and stable, are likely to be non-functional or might even be deleterious to cellular metabolism. Approximately one third of genetic and acquired diseases are due to PTCs. In fact, PTCs are apt to cause at least some cases of all diseases that involve protein insufficiency. Cells have evolved a way to eliminate mRNAs that contain PTCs using a mechanism called nonsense-mediated mRNA decay (NMD). Here, we will review how to determine which PTCs elicit NMD, what is currently known about the mechanism of NMD, and additional information that is pertinent to establishing therapies for PTC-associated diseases.

233 citations


Related Papers (5)
Frequently Asked Questions (1)
Q1. What are the contributions mentioned in the paper "Galns gene expression profiling in morquio a patients' fibroblasts" ?

In this paper, the authors report characterisation of GALNS genemutations andmRNA stability verifying a genotype/phenotype correlation in two MPS IVA patients with a severe form.