GALNS gene expression profiling in Morquio A patients' fibroblasts.

TL;DR: The development of a real-time RT-PCR assay allows to absolutely quantify the GALNS mRNAs carrying mutations that lead to PTCs bearing transcripts, which escape the NMD process and are potentially suitable for the new therapeutic approach.

About: This article is published in Clinica Chimica Acta.The article was published on 2008-11-01 and is currently open access. It has received 7 citations till now. The article focuses on the topics: Stop codon.

Summary

1. Introduction

• Classical forms are characterised by a lifespan of 20–30 years, short trunk dwarfism, spondyloepiphyseal dysplasia, coxa valga, odontoid hypo- ate sulfatase; MPS IVA, mucone-6-sulfate; KS, keratan sulain reaction; RT-PCR, reverse ure termination codon; NMD, se. 9 55 570380.
• About 150 mutations have so far been identified, revealing a high degree of genetic heterogeneity that is probably responsible for the clinical variability in MPS IVA patients.
• These mutations can cause very unstable mRNA transcripts or transcripts capable of escaping the nonsense-mediated decay (NMD) pathway, a molecular mechanism that reduces the amount of transcripts carrying premature termination codons (PTCs).

2.1. Patients

• The clinical and biochemical findings of the two patients (Pt1 and Pt2) are shown in Table 1.
• Deficiency of GALNS enzyme activity was confirmed on fibroblasts by the fluorogenic method previously reported by Van Diggelen et al. [13].
• The molecular study was performed after informed consent, for genetic testing from patients' parents, was obtained.

2.2. Analysis of genomic DNA

• To identify genetic lesions in the GALNS gene, genomic DNA was isolated from peripheral blood lymphocytes and fibroblasts.
• The GALNS exons were amplified with the primers reported in Table 2. PCR products were visualized on a 2% agarose gel, excised and purified using Nucleospin Extract II extraction kit (MACHEREY-NAGEL, Duren, Germany).
• About 100 ng of purified DNA was analyzed for mutation detection by nucleotide sequencing on ABI PRISM 310 Genetic Analyzer using BigDye terminator chemicals (Applied Biosystems, Foster City, CA).

2.3. RNA isolation and retrotranscription

• Isolation of total RNA from cultured skin fibroblasts was performed with the TRIzol reagent (Life Technologies, Rockville, MD).
• RNA integrity and concentrations were both checked by 1% agarose gel and Nanodrop® ND-1000 Spectrophotometer (Nanodrop technologies, Wilmington, USA).
• RNA reverse transcription was carried out as follows: 1. 1–7 μg of total RNAs were reverse transcribed with Display THERMO-RT (Eppendorf, Hamburg, Germany) using the specific 3′ UTR primer 5′ GGAGGGTCCTGAAATCTGAGG 3′, according to the manufacturer.
• The reverse transcripts obtained from the second method were used for quantitative real-time analysis.

2.4. RT-PCR analysis

• Nucleotide numbers are derived from cDNA GALNS sequence (EMBL/Gen Bank/ DDBJ; accession number NM_000512).
• The measurement of GALNS gene mRNA was performed using a quantitative realtime RT-PCR method, based on TaqMan™ technology.
• Probe and primers were selected by the computer program “Primer Express” (Applied Biosystems, Foster City, USA).
• Plasmid vector, carrying GALNS gene transcript (pCXN-GALNS), was tenfold serially diluted from a starting quantity of 11×106 plasmid copies to 11 plasmid copies and used as standard curve.

2.8. Statistical analysis

• Statistical analysis of different real-time assay measurement was carried out using the SPSS software package (SPSS INC, Chicago, IL).
• Statistical differences between I° PCR GALNSc1F 5′ CAGCCCAGCCGGAAGGGCC.
• B. Schematic representation of the aberrant transcripts detected in MPS IVA Pt1.
• Black boxes mark the exons, white boxes indicate exonic sequence loss.
• Differences with pb0.05 were considered statistically significant.

3. Results

• The fibroblasts from patients with enzymatic diagnosis of MPS IVA disease underwent molecular characterisation (Table 1).
• The new c.385ANT leading to the premature stop codon p. K129X and the c.899−1GNC splicing mutations were identified in Pt1 and the reported c.120+1GNA mutation was identified in a homozygous state in Pt2.
• Quantitative analysis of GALNS gene mRNA was performed by absolute real-time PCR, using probe and primers encompassing exon 6–7 junction, present in all Pt1's GALNS transcripts.
• Results, reported in Fig. 2, indicated that this assay effectively distinguished 10-fold differences in concentration from about 11 to 11×106 vectors' molecules per reaction mixture.
• The authors analyzed total RNA from the fibroblasts of two MPS IVA patients and 15 normal controls.

4. Discussion

• About 150 genetic lesions have been reported in the GALNS gene of mucopolysaccharidosis IVA (MPS IVA) patients, indicating remarkable genetic heterogeneity.
• The real-time technology is now highly sensitive, accurate and simple enough to be adopted as a routine method for measuring gene levels.
• The presence in Pt1 of normal GALNS transcripts levels, identified by the real-time assay technique the authors describe, suggests that such mRNAs are not sensitive to NMD, according to what conventional RTPCR analysis has indicated.
• Such transcripts can be highly unstable and subject to NMD [12,21].
• Pt 2, who was homozygous for the c.120+1GNA mutation, had consanguineous North African parents whowere heterozygous for the mutation.

Figures

Table 1 Clinical, biochemical and molecular data of MPS IV A patients

Table 2 Primers for PCR amplification of GALNS gene

Table 4 Score calculation of canonical and cryptic splice sites by the http://www.fruitfly.org/

Table 3 Number of GALNS copies detected in MPS IVA patients and control samples

Fig. 1. A. RT-PCR analysis of MPS IVA patients. The PCR products, run on 2% agarose gel, were obtained after total RNA retrotranscription with random hexamers and two subsequent amplifications with the following primers:

Fig. 2. Real-time standard curve. Amplification plot showing the standard curve of plasmid vector pCXN-GALNS, generated by seven tenfold serial dilution from a starting quantity of 11×106 plasmid copies, and controls, Pt1 and Pt2 samples.

Frequently asked questions

Q1. What are the contributions mentioned in the paper "Galns gene expression profiling in morquio a patients' fibroblasts" ?

In this paper, the authors report characterisation of GALNS genemutations andmRNA stability verifying a genotype/phenotype correlation in two MPS IVA patients with a severe form.