Identification of a GTP-bound Rho specific scFv molecular sensor by phage display selection
TL;DR: The success of C1-N1N2 in discriminating activated Rho in immunofluorescence studies implies that this new tool, in collaboration with currently used RhoA and B antibodies, has the potential to analyze Rho activation in cell function and tumor development.
Abstract: The Rho GTPases A, B and C proteins, members of the Rho family whose activity is regulated by GDP/GTP cycling, function in many cellular pathways controlling proliferation and have recently been implicated in tumorigenesis. Although overexpression of Rho GTPases has been correlated with tumorigenesis, only their GTP-bound forms are able to activate the signalling pathways implicated in tumorigenesis. Thus, the focus of much recent research has been to identify biological tools capable of quantifying the level of cellular GTP-bound Rho, or determining the subcellular location of activation. However useful, these tools used to study the mechanism of Rho activation still have limitations. The aim of the present work was to employ phage display to identify a conformationally-specific single chain fragment variable (scFv) that recognizes the active, GTP-bound, form of Rho GTPases and is able to discriminate it from the inactive, GDP-bound, Rho in endogenous settings. After five rounds of phage selection using a constitutively activated mutant of RhoB (RhoBQ63L), three scFvs (A8, C1 and D11) were selected for subsequent analysis. Further biochemical characterization was pursued for the single clone, C1, exhibiting an scFv structure. C1 was selective for the GTP-bound form of RhoA, RhoB, as well as RhoC, and failed to recognize GTP-loaded Rac1 or Cdc42, two other members of the Rho family. To enhance its production, soluble C1 was expressed in fusion with the N-terminal domain of phage protein pIII (scFv C1-N1N2), it appeared specifically associated with GTP-loaded recombinant RhoA and RhoB via immunoprecipitation, and endogenous activated Rho in HeLa cells as determined by immunofluorescence. We identified an antibody, C1-N1N2, specific for the GTP-bound form of RhoB from a phage library, and confirmed its specificity towards GTP-bound RhoA and RhoC, as well as RhoB. The success of C1-N1N2 in discriminating activated Rho in immunofluorescence studies implies that this new tool, in collaboration with currently used RhoA and B antibodies, has the potential to analyze Rho activation in cell function and tumor development.
Citations
More filters
TL;DR: This work describes the first fully synthetic phage display library of humanized llama single domain antibody (NaLi-H1: Nanobody Library Humanized 1), based on a humanized synthetic singledomain antibody (hs2dAb) scaffold optimized for intracellular stability, which provides high affinity binders without animal immunization.
Abstract: Antibodies are proteins that form part of an animal’s immune system and can identify and help eradicate infections. These proteins are also needed at many stages in biological research and represent one of the most promising tools in medical applications, from diagnostics to treatments. Traditionally, antibodies have been collected from animals that had been previously injected with a target molecule that the antibodies must recognize. An alternative strategy that uses bacteria and bacteria-infecting viruses instead of animals was developed several decades ago and allows researchers to obtain antibodies more quickly. However, the majority of the scientific community view these “in vitro selected antibodies” as inferior to those produced via the more traditional approach. Moutel, Bery et al. set out to challenge this widespread opinion, using a smaller kind of antibody known as nanobodies. The proteins were originally found in animals like llamas and camels and are now widely used in biological research. One particularly stable nanobody was chosen to form the backbone of the in vitro antibodies, and the DNA that encodes this nanobody was altered to make the protein more similar to human antibodies. Moutel, Bery et al. then changed the DNA sequence further to make billions of different versions of the nanobody, each one slightly different from the next in the region that binds to the target molecules. Transferring this DNA into bacteria resulted in a library (called the NaLi-H1 library) of bacterial clones that produce the nanobodies displayed at the surface of bacteria-infecting viruses. Moutel, Bery et al. then screened this library against various target molecules, including some from tumor cells, and showed that the fully in vitro selected antibodies worked just as well as natural antibodies in a number of assays. The in vitro antibodies could even be used to track, or inactivate, proteins within living cells. The NaLi-H1 library will help other researchers obtain new antibodies that bind strongly to their targets. The approaches developed to create the library could also see more people decide to create their own synthetic libraries, which would accelerate the identification of new antibodies in a way that is cheaper and requires fewer experiments to be done using animals. These in vitro selected antibodies could help to advance both fundamental and medical research.
219 citations
Cites methods from "Identification of a GTP-bound Rho s..."
...…libraries, immune or naı̈ve llama VHH libraries (Monegal et al., 2012; Olichon and Surrey, 2007) or from scFv libraries (Dimitrov et al., 2008; Goffinet et al., 2008; Nizak et al., 2003a) we then rationally designed CDR diversity with fixed CDR1 and CDR2 size and four CDR3 sizes (9, 12, 15…...
[...]
TL;DR: This work grades every paper published in 2008 on a scale from A to F and outlines what features make a biosensor article fabulous, middling or abysmal and focuses on a few experimental, analysis and presentation mistakes that are alarmingly common.
Abstract: Optical biosensor technology continues to be the method of choice for label-free, real-time interaction analysis. But when it comes to improving the quality of the biosensor literature, education should be fundamental. Of the 1413 articles published in 2008, less than 30% would pass the requirements for high-school chemistry. To teach by example, we spotlight 10 papers that illustrate how to implement the technology properly. Then we grade every paper published in 2008 on a scale from A to F and outline what features make a biosensor article fabulous, middling or abysmal. To help improve the quality of published data, we focus on a few experimental, analysis and presentation mistakes that are alarmingly common. With the literature as a guide, we want to ensure that no user is left behind.
192 citations
TL;DR: The approaches used for antibody purification are critically examined with the aim of providing the reader with the principles and practical insights required to understand the intricacies of the procedures.
161 citations
TL;DR: It is shown that changing the tag order to Myc/His improved the production of soluble antibodies, but did not affect antibody phage display, and the highly diverse universal antibody gene libraries HAL9/10 were constructed using an optimized scFv phagemid vector design.
Abstract: Antibody phage display is a proven key technology that allows the generation of human antibodies for diagnostics and therapy. From naive antibody gene libraries - in theory - antibodies against any target can be selected. Here we describe the design, construction and characterization of an optimized antibody phage display library. The naive antibody gene libraries HAL9 and HAL10, with a combined theoretical diversity of 1.5×1010 independent clones, were constructed from 98 healthy donors using improved phage display vectors. In detail, most common phagemids employed for antibody phage display are using a combined His/Myc tag for detection and purification. We show that changing the tag order to Myc/His improved the production of soluble antibodies, but did not affect antibody phage display. For several published antibody libraries, the selected number of kappa scFvs were lower compared to lambda scFvs, probably due to a lower kappa scFv or Fab expression rate. Deletion of a phenylalanine at the end of the CL linker sequence in our new phagemid design increased scFv production rate and frequency of selected kappa antibodies significantly. The HAL libraries and 834 antibodies selected against 121 targets were analyzed regarding the used germline V-genes, used V-gene combinations and CDR-H3/-L3 length and composition. The amino acid diversity and distribution in the CDR-H3 of the initial library was retrieved in the CDR-H3 of selected antibodies showing that all CDR-H3 amino acids occurring in the human antibody repertoire can be functionally used and is not biased by E. coli expression or phage selection. Further, the data underline the importance of CDR length variations. The highly diverse universal antibody gene libraries HAL9/10 were constructed using an optimized scFv phagemid vector design. Analysis of selected antibodies revealed that the complete amino acid diversity in the CDR-H3 was also found in selected scFvs showing the functionality of the naive CDR-H3 diversity.
105 citations
Additional excerpts
...pCANTAB3his [50], pCES [51], pHEN2 [52], pHAL14 [31], pIT2 [53],...
[...]
TL;DR: Therapeutic approaches targeting Rho GTPase signaling may provide a novel alternative for anti-HCC therapy.
97 citations
References
More filters
TL;DR: The crystal structure of a Q63L-RhoA bound to the GTP-analog 5'-guanylylimidodiphosphate (GMPPNP) was determined and supported the notion that differences observed between the mutants in vivo are likely to arise from altered affinities for RhoGDI and not from direct structural differences.
Abstract: Mutants of the small G protein RhoA that are deficient in GTPase activity and thereby exhibit constitutive molecular signaling activity are commonly used to discover its cellular functions. In particular, two such mutants, Gly14→Val (G14V) and Gln63→Leu (Q63L), are often used interchangeably for such studies. However, while their in vitro rates of GTP hydrolysis are very similar, differences are observed in their other functional properties. The structure of G14V-RhoA is known; in order to assess whether structural variations are responsible for functional differences, the crystal structure of a Q63L-RhoA bound to the GTP-analog 5′-guanylylimidodiphosphate (GMPPNP) was determined at 1.5 A resolution. Overall, the structure is very similar to that of G14V-RhoA, but the significantly higher resolution data permit an improved basis for structural analysis and comparison. The data support the notion that differences observed between the mutants in vivo are likely to arise from altered affinities for RhoGDI and not from direct structural differences.
35 citations
TL;DR: A general method is described here which enables expressions of functional antibody fragments when fused to the amino-terminal domain(s) of the filamentous phage coat protein III.
34 citations
"Identification of a GTP-bound Rho s..." refers background in this paper
...reported that an inactive antibody fragment can be functionally rescued by fusion to the N-terminal domain of the original phage display fusion partner, filamentous phage protein III [26]....
[...]
...A: Schematic representation of the pHEN2 phagemid vector (Griffin 1. library). pelB leader: signal peptide sequence of bacterial pectate lyase that mediates secretion into the periplasmic space; VH : variable fragment of the heavy chain; VL: light chain; 6xHis: 6 histidine-tag; myc: myc-tag; amber: amber stop codon; N1, N2, Cterm: portions of the N- and C-term of phage capside protein pIII; LMB3 and pHENSeq: primers used for sequencing the VH and VL domain....
[...]
...The amber stop codon between the scFv and gene III in pHEN 2 was removed by mutagenesis (middle construct)....
[...]
...The C-terminal portion of pIII was removed in the final pHEN C1-N1N2 vector (bottom construct), first by PCR amplification of pHEN C1-pIII, introducing an EcoRI site after N2, and subsequently by cloning the NcoI and EcoRI digested PCR product into the linearized pHEN C1-pIII plasmid at the NotI and EcoRI sites....
[...]
...A new EcoRI site was introduced downstream of the pIII N2 region by PCR amplification of this modified plasmid (pHEN C1-pIII) using primers LMB3, 5'-CAGGAAACAGCTATGAC-3', and N2 (EcoR1), 5'CCGGA ATTCGCCGCCGCCAGCATTGAC 3'....
[...]
30 citations
"Identification of a GTP-bound Rho s..." refers background in this paper
...They function in cell cycle regulation by the modulation of cyclin D1 [10] and by their involvement in endocytic traffic [11,12], such as in regulation of epidermal growth factor receptor [13]....
[...]
TL;DR: By selection on the active conformation of Ras, a Fab antibody was identified that exclusively binds to active Ras, and not to inactive Ras, which may well be more selective than previously used anti‐Ras antibodies, and thus could be used for gene therapy of cancer with intracellular antibodies.
22 citations
"Identification of a GTP-bound Rho s..." refers methods in this paper
...Using the previously described methodology by Horn et al, we bound GST-RhoA loaded with GDP on one flowcell (FC1), and GST-RhoA loaded with GTPγS on a second flowcell (FC2) [28]....
[...]
...Using the previously described methodology by Horn et al, we bound GST-RhoA loaded with GDP on one flowcell (FC1), and GST-RhoA loaded with GTPγS on a second flowcell (FC2) [28]....
[...]
...In order to test the specificity of scFv C1-N1N2 for the GTP-bound form of RhoA, differential responses (FC2-FC1) were recorded and analyzed using the Biaevaluation 4.0 software (Biacore AB)....
[...]
...Same results were found with GST-Cdc 42 and GST-Rac 1 loaded with GTPγS are coated on FC1 in front of GSTRhoA loaded with GTPγS on FC2....
[...]
TL;DR: It is shown that conformation-specific recombinant antibodies specific to the GTP-bound conformation of Rab6 proteins can be expressed in living cells to follow endogenous Rab6 in its activated conformation in vivo and could be used to study other conformation switching mechanisms.
Abstract: The existence of a conformational switch of Rabs and other small GTPases involved in intracellular transport regulation has been known for many years. This switch is superimposed on the membrane association/dissociation cycle for most of these GTPases. While these processes are key features of the dynamics of intracellular transport events, surprisingly very few previous studies have focused on the dynamics of the GDP/GTP cycle of Rab proteins in time and space. The main reason for this is the lack of tools available to dynamically probe for Rab GTPases conformation switches and membrane association/dissociation, in particular in vivo . We recently reported the in vitro selection of conformation‐specific recombinant antibodies specific to the GTP‐bound conformation of Rab6 proteins. These antibodies were obtained in vitro by phage display, a rather simple, rapid, and cheap technique. We additionally showed that these conformation‐specific antibodies can be expressed in living cells to follow endogenous Rab6 in its activated conformation in vivo . The same strategy could be used to study other conformation switching mechanisms and, in general, to study the switching between states that antibodies can distinguish (e.g., phosphorylation, ubiquitination).
18 citations
Additional excerpts
...1 library [34], as previously described [35]...
[...]