Identification of novel NAD(P)H dehydrogenase [quinone] 1 antagonist using computational approaches.
01 Feb 2020-Journal of Biomolecular Structure & Dynamics (Taylor & Francis)-Vol. 38, Iss: 3, pp 682-696
TL;DR: The results of induced fit docking and prime/MM-GBSA suggest that leads AN-153/J117103 and AT-138/KB09997 binding with the catalytic site suggests potential of this compound to treat cancer.
Abstract: NAD(P)H: quinone oxidoreductase 1 (NQO1) inhibitors are proved as promising therapeutic agents against cancer. This study is to determine potent NAD(P)H-dependent NQO1 inhibitors with new scaffold. Pharmacophore-based three-dimensional (3D) QSAR model has been built based on 45 NQO1 inhibitors reported in the literature. The structure-function correlation coefficient graph represents the relationship between phase activity and phase predicted activity for training and test sets. A QSAR model statistics shows the excellent correlation of the generated model. Pharmacophore hypothesis (AARR) yielded a statistically significant 3D QSASR model with a correlation coefficient of r2 = 0.99 as well as an excellent predictive power. From the analysis of pharmacophore-based virtual screening using by SPEC database, 4093 hits were obtained and were further filtered using virtual screening filters (HTVS, SP, XP) through structure based molecular docking. Based on glide energy and docking score, seven lead compounds show better binding affinity compared to the co-crystal inhibitor. The results of induced fit docking and prime/MM-GBSA suggest that leads AN-153/J117103 and AT-138/KB09997 binding with the catalytic site. Further, to understanding the stability of identified lead compounds MD simulations were done. The lead AN-153/J117103 showed the strong binding stable of the protein-ligand complex. Also the computed drug likeness reveals potential of this compound to treat cancer. AbbreviationsNQO1NAD(P)H-quinine oxidoreductase 1CPHcommon pharmacophore hypothesisPLSpartial least squireHBDhydrogen bond donorSDstandard deviationXPextra precisionIFDinduced fit dockingMM-GBSAmolecular mechanics generalized born surface areaMDSmolecular dynamics simulationRMSDroot mean square deviationRMSFroot mean square fluctuationRMSEroot mean square errorADMEabsorption distribution metabolism excretionsCommunicated by Ramaswamy H. Sarma.
Citations
More filters
TL;DR: NQO1 emerges as a good model to investigate loss of function mechanisms in genetic diseases as well as to improve strategies to discriminate between neutral and pathogenic variants in genome-wide sequencing studies.
60 citations
Journal Article•
TL;DR: Comparisons between pancreatic adenocarcinoma, pancreatic cancer cell lines, normal pancreas, and chronic pancreatitis have identified genes that are selectively expressed in the neoplastic epithelium of pancreatic adsorption.
Abstract: The molecular basis of pancreatic cancer is not understood. Previous attempts to determine the specific genes expressed in pancreatic cancer have been hampered by similarities between adenocarcinoma and chronic pancreatitis. In the current study, microarrays (Affymetrix) were used to profile gene expression in pancreatic adenocarcinoma (10), pancreatic cancer cell lines (7), chronic pancreatitis (5), and normal pancreas (5). Molecular profiling indicated a large number of genes differentially expressed between pancreatic cancer and normal pancreas but many fewer differences between pancreatic cancer and chronic pancreatitis, likely because of the shared stromal influences in the two diseases. To specifically identify genes expressed in neoplastic epithelium, we selected genes more highly expressed (>2-fold, p < 0.01) in adenocarcinoma compared with both normal pancreas and chronic pancreatitis and which were also highly expressed in pancreatic cancer cell lines. This strategy yielded 158 genes, of which 124 were not previously associated with pancreatic cancer. Quantitative-reverse transcription-PCR for two molecules, S100P and 14-3-3sigma, validated the microarray data. Support for the success of the neoplastic cell gene expression identification strategy was obtained by immunocytochemical localization of four representative genes, 14-3-3sigma, S100P, S100A6, and beta4 integrin, to neoplastic cells in pancreatic tumors. Thus, comparisons between pancreatic adenocarcinoma, pancreatic cancer cell lines, normal pancreas, and chronic pancreatitis have identified genes that are selectively expressed in the neoplastic epithelium of pancreatic adenocarcinoma. These data provide new insights into the molecular pathology of pancreatic cancer that may be useful for detection, diagnosis, and treatment.
40 citations
References
More filters
TL;DR: These findings provide the first evidence for in vivo degradation of p53 and p73 by the 20S proteasomes and its regulation by NQO1 and NADH level and show that this pathway plays a role in p53 accumulation in response to ionizing radiation.
Abstract: Protein degradation is an essential and highly regulated process. The proteasomal degradation of the tumor suppressors p53 and p73 is regulated by both polyubiquitination and by an ubiquitin-independent process. Here, we show that this ubiquitin-independent process is mediated by the 20S proteasomes and is regulated by NQO1. NQO1 physically interacts with p53 and p73 in an NADH-dependent manner and protects them from 20S proteasomal degradation. Remarkably, the vast majority of NQO1 in cells is found in physical association with the 20S proteasomes, suggesting that NQO1 functions as a gatekeeper of the 20S proteasomes. We further show that this pathway plays a role in p53 accumulation in response to ionizing radiation. Our findings provide the first evidence for in vivo degradation of p53 and p73 by the 20S proteasomes and its regulation by NQO1 and NADH level.
346 citations
Additional excerpts
...(Asher, 2005; Moscovitz et al., 2012; Oh et al., 2016)....
[...]
TL;DR: The elevated activity of QAO in some tumors and the apparent depressant effect of smoking could influence the response of these tumors to quinone drugs or toxic agents that are metabolized by QAAO.
Abstract: NAD(P)H:(quinone-acceptor)oxidoreductase (QAO), previously known as DT-diaphorase, catalyzes the reduction of quinones to hydroquinones. Enhanced activity of the enzyme has been suggested to protect cells against the cellular toxicity and carcinogenicity of quinones, but may activate some cytotoxic anti-tumor quinones. Cytosolic levels of QAO, carbonyl reductase (CR) and total quinone reductase activity have been measured in normal and tumorous human tissues. QAO was the major component of the total cytosolic quinone reductase activity in all the tissues investigated. CR represented 10 to 28% of the total cytosolic quinone reductase activity in normal tissue. Normal tissue QAO was high in the stomach and kidney, and lower in the lung, liver, colon and breast. Primary tumor from lung, liver, colon and breast had elevated levels of QAO compared to normal tissue, while tumor from kidney and stomach had lower levels. CR was not significantly altered in tumor tissue, except in the case of lung and colon tumor which showed an increase compared to normal tissue. A major determinant of the variability of human lung tumor QAO was the cigarette-smoking history of the donor. Non-smokers and past smokers had high levels of tumor QAO compared to normal tissue. Smokers had levels of tumor QAO that were not significantly different from those of normal tissue QAO. Smokers had a small increase in normal lung QAO compared to non-smokers. Alcohol use was associated with an increase in lung tumor QAO but had no effect on QAO in normal lung. The function of QAO in tumors is not known but the elevated activity of QAO in some tumors and the apparent depressant effect of smoking could influence the response of these tumors to quinone drugs or toxic agents that are metabolized by QAO.
261 citations
"Identification of novel NAD(P)H deh..." refers background in this paper
...Recent studies have revealed the role of NQO1 activity in lung cancer (Chen, Lum, Seifried, Wilkens, & Le Marchand, 1999; Lin, Wang, & Lee, 1999; Peng et al., 2014; Schlager & Powis, 1990) or cancer in other organs (Lewis, Cherry, Niven, Barber, & Povey, 2001; Song et al., 2010)....
[...]
TL;DR: Nuclear run-on experiments performed using nuclei isolated from 2,3,7,8-tetrachlorodibenzo-p-dioxin treated and untreated human hepatoblastoma (Hep-G2) cells demonstrated that TCDD treatment increases the rate of transcription of endogenous NQO1 gene by 3-fold.
Abstract: The human NAD(P):quinone oxidoreductase (NQO{sub 1}) gene, 1850 base pairs (bp) of the 5{prime} flanking region, and 67 bp of the 3{prime} flanking region have been sequenced. The human NQO{sub 1} gene is approximately 20 kb in length and has six exons interrupted by five introns. The start site of transcription was determined by primer extension analysis. Nuclear run-on experiments performed using nuclei isolated from 2,3,7,8-tetrachlorodibenzo-p-doxin (TCDD) treated and untreated human hepatoblastoma (Hep-G2) cells demonstrated that TCDD treatment increases the rate of transcription of endogenous NQO{sub 1} gene by 3-fold. The sequence analysis of the 5{prime} flanking region of the NQO{sub 1} gene showed the presence of a TATA box in the {minus}37 to {minus}32 bp region, one CCAAT box at nucleotide {minus}649, an AP1 binding site at position {minus}462, an AP2 site at nucleotide position {minus}156, and one copy of the nucleotide sequence GCGTC. It is noteworthy that XRE in human NQO{sub 1} gene is located 5{prime} to the ARE compared to its 3{prime} location in the rat quinone reductase gene. Interestingly, the consensus sequence for binding to AP1 protein (TGACTCA) is contained within the ARE sequence (TCACAGTGACTCAGCAGAATC) of human NQO{sub 1} gene. By deletion mutagenesis and transfection studies,more » the author has identified a segment of DNA in the upstream region of the human NQO{sub 1} gene required for a high level of expression in hepatoma cells and its induction by TCDD.« less
216 citations
"Identification of novel NAD(P)H deh..." refers background in this paper
...NQO1 gene consists of five introns and six exons with an approximate length of 20Kb (Jaiswal, 1991)....
[...]
TL;DR: Results from a 1.2 micros explicit solvent MD simulation of the protein ubiquitin are compared with previously determined backbone order parameters derived from NMR relaxation experiments, revealing fluctuations in three loop regions that occur on time scales comparable to or longer than that of the overall rotational diffusion of ubiquitIn.
Abstract: A molecular-level understanding of the function of a protein requires knowledge of both its structural and dynamic properties. NMR spectroscopy allows the measurement of generalized order parameters that provide an atomistic description of picosecond and nanosecond fluctuations in protein structure. Molecular dynamics (MD) simulation provides a complementary approach to the study of protein dynamics on similar time scales. Comparisons between NMR spectroscopy and MD simulations can be used to interpret experimental results and to improve the quality of simulation-related force fields and integration methods. However, apparent systematic discrepancies between order parameters extracted from simulations and experiments are common, particularly for elements of noncanonical secondary structure. In this paper, results from a 1.2 μs explicit solvent MD simulation of the protein ubiquitin are compared with previously determined backbone order parameters derived from NMR relaxation experiments [Tjandra, N.; Felle...
204 citations
"Identification of novel NAD(P)H deh..." refers background in this paper
...Simulation trajectory was found to be stable and hence it confirms the appropriate docking of ligand and protein (Maragakis et al., 2008)....
[...]
133 citations