Mechanisms of gene silencing by double-stranded RNA
TL;DR: A key step in known silencing pathways is the processing of dsRNAs into short RNA duplexes of characteristic size and structure, which guide RNA silencing by specific and distinct mechanisms.
Abstract: Double-stranded RNA (dsRNA) is an important regulator of gene expression in many eukaryotes. It triggers different types of gene silencing that are collectively referred to as RNA silencing or RNA interference. A key step in known silencing pathways is the processing of dsRNAs into short RNA duplexes of characteristic size and structure. These short dsRNAs guide RNA silencing by specific and distinct mechanisms. Many components of the RNA silencing machinery still need to be identified and characterized, but a more complete understanding of the process is imminent.
Citations
More filters
TL;DR: The type II prokaryotic CRISPR (clustered regularly interspaced short palindromic repeats)/Cas adaptive immune system has been shown to facilitate RNA-guided site-specific DNA cleavage as discussed by the authors.
Abstract: Functional elucidation of causal genetic variants and elements requires precise genome editing technologies. The type II prokaryotic CRISPR (clustered regularly interspaced short palindromic repeats)/Cas adaptive immune system has been shown to facilitate RNA-guided site-specific DNA cleavage. We engineered two different type II CRISPR/Cas systems and demonstrate that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells. Cas9 can also be converted into a nicking enzyme to facilitate homology-directed repair with minimal mutagenic activity. Lastly, multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology.
12,265 citations
01 Feb 2013
TL;DR: Two different type II CRISPR/Cas systems are engineered and it is demonstrated that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology.
Abstract: Genome Editing Clustered regularly interspaced short palindromic repeats (CRISPR) function as part of an adaptive immune system in a range of prokaryotes: Invading phage and plasmid DNA is targeted for cleavage by complementary CRISPR RNAs (crRNAs) bound to a CRISPR-associated endonuclease (see the Perspective by van der Oost). Cong et al. (p. 819, published online 3 January) and Mali et al. (p. 823, published online 3 January) adapted this defense system to function as a genome editing tool in eukaryotic cells. A bacterial genome defense system is adapted to function as a genome-editing tool in mammalian cells. [Also see Perspective by van der Oost] Functional elucidation of causal genetic variants and elements requires precise genome editing technologies. The type II prokaryotic CRISPR (clustered regularly interspaced short palindromic repeats)/Cas adaptive immune system has been shown to facilitate RNA-guided site-specific DNA cleavage. We engineered two different type II CRISPR/Cas systems and demonstrate that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells. Cas9 can also be converted into a nicking enzyme to facilitate homology-directed repair with minimal mutagenic activity. Lastly, multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology.
10,746 citations
Cites background from "Mechanisms of gene silencing by dou..."
...> U6-St_tracrRNA(7-97) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAA TTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATA ATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTA ACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTTACTT AAATCTTGCAGAAGCTACAAAGATAAGGCTTCATGCCGAAATCAACACCCTGTCATTTTATGGC AGGGTGTTTTCGTTATTTAA...
[...]
TL;DR: This work has revealed unexpected diversity in their biogenesis pathways and the regulatory mechanisms that they access, which has direct implications for fundamental biology as well as disease etiology and treatment.
4,490 citations
Cites background from "Mechanisms of gene silencing by dou..."
...In humans, four of the eight proteins are from the Ago clade and associate with both siRNAs and miRNAs (Meister and Tuschl, 2004; Tomari and Zamore, 2005), but little difference has been reported thus far in the populations of small RNAs that they bind, so the degree of functional specialization in…...
[...]
...These dsRNAs are processed by Dicer into the siRNAs that direct silencing (Meister and Tuschl, 2004; Tomari and Zamore, 2005). siRNAs were originally observed during transgene- and virus-induced silencing in plants (Mello and Conte, 2004), consistent with a natural role in genome defense (Figure 2)....
[...]
...Single-stranded forms of both miRNAs and siRNAs were found to associate with effector assemblies (Meister and Tuschl, 2004) known as RNA-induced silencing complexes (RISCs) (Hammond et al., 2000)....
[...]
...…RNase III enzymes had long been characterized as dsRNA-specific nucleases, enzymes with RNase III domains were promptly recognized as primary candidates in the search for miRNA/ siRNA biogenesis factors, and confirmation of this role came quickly (Meister and Tuschl, 2004; Tomari and Zamore, 2005)....
[...]
...N IH -PA Author M anuscript N IH -PA Author M anuscript N IH -PA Author M anuscript them from their precursors, and Ago proteins to support their silencing effector functions (Meister and Tuschl, 2004; Tomari and Zamore, 2005) (Figure 1A)....
[...]
TL;DR: In this article, tracrRNA, a trans-encoded small RNA with 24-nucleotide complementarity to the repeat regions of crRNA precursor transcripts, is shown to direct the maturation of crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein.
Abstract: CRISPR/Cas systems constitute a widespread class of immunity systems that protect bacteria and archaea against phages and plasmids, and commonly use repeat/spacer-derived short crRNAs to silence foreign nucleic acids in a sequence-specific manner. Although the maturation of crRNAs represents a key event in CRISPR activation, the responsible endoribonucleases (CasE, Cas6, Csy4) are missing in many CRISPR/Cas subtypes. Here, differential RNA sequencing of the human pathogen Streptococcus pyogenes uncovered tracrRNA, a trans-encoded small RNA with 24-nucleotide complementarity to the repeat regions of crRNA precursor transcripts. We show that tracrRNA directs the maturation of crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein; all these components are essential to protect S. pyogenes against prophage-derived DNA. Our study reveals a novel pathway of small guide RNA maturation and the first example of a host factor (RNase III) required for bacterial RNA-mediated immunity against invaders.
2,336 citations
TL;DR: Clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner.
Abstract: Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci take up genetic material from invasive elements and build up inheritable DNA-encoded immunity over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable genetic elements, and enhancing viral resistance in domesticated microbes.
2,193 citations
References
More filters
TL;DR: Although they escaped notice until relatively recently, miRNAs comprise one of the more abundant classes of gene regulatory molecules in multicellular organisms and likely influence the output of many protein-coding genes.
32,946 citations
TL;DR: To their surprise, it was found that double-stranded RNA was substantially more effective at producing interference than was either strand individually, arguing against stochiometric interference with endogenous mRNA and suggesting that there could be a catalytic or amplification component in the interference process.
Abstract: Experimental introduction of RNA into cells can be used in certain biological systems to interfere with the function of an endogenous gene Such effects have been proposed to result from a simple antisense mechanism that depends on hybridization between the injected RNA and endogenous messenger RNA transcripts RNA interference has been used in the nematode Caenorhabditis elegans to manipulate gene expression Here we investigate the requirements for structure and delivery of the interfering RNA To our surprise, we found that double-stranded RNA was substantially more effective at producing interference than was either strand individually After injection into adult animals, purified single strands had at most a modest effect, whereas double-stranded mixtures caused potent and specific interference The effects of this interference were evident in both the injected animals and their progeny Only a few molecules of injected double-stranded RNA were required per affected cell, arguing against stochiometric interference with endogenous mRNA and suggesting that there could be a catalytic or amplification component in the interference process
15,374 citations
"Mechanisms of gene silencing by dou..." refers background in this paper
...gif" NDATA ITEM> ]> First discovered in plants, where it was known as post-transcriptional gene silencing, RNA silencing or RNA interference (RNAi...
[...]
TL;DR: Dicer is a member of the RNase III family of nucleases that specifically cleave double-stranded RNAs, and is evolutionarily conserved in worms, flies, plants, fungi and mammals, and has a distinctive structure, which includes a helicase domain and dualRNase III motifs.
Abstract: RNA interference (RNAi) is the mechanism through which double-stranded RNAs silence cognate genes. In plants, this can occur at both the transcriptional and the post-transcriptional levels; however, in animals, only post-transcriptional RNAi has been reported to date. In both plants and animals, RNAi is characterized by the presence of RNAs of about 22 nucleotides in length that are homologous to the gene that is being suppressed. These 22-nucleotide sequences serve as guide sequences that instruct a multicomponent nuclease, RISC, to destroy specific messenger RNAs. Here we identify an enzyme, Dicer, which can produce putative guide RNAs. Dicer is a member of the RNase III family of nucleases that specifically cleave double-stranded RNAs, and is evolutionarily conserved in worms, flies, plants, fungi and mammals. The enzyme has a distinctive structure, which includes a helicase domain and dual RNase III motifs. Dicer also contains a region of homology to the RDE1/QDE2/ARGONAUTE family that has been genetically linked to RNAi.
5,229 citations
TL;DR: The two RNase III proteins, Drosha and Dicer, may collaborate in the stepwise processing of miRNAs, and have key roles in miRNA-mediated gene regulation in processes such as development and differentiation.
Abstract: Hundreds of small RNAs of approximately 22 nucleotides, collectively named microRNAs (miRNAs), have been discovered recently in animals and plants. Although their functions are being unravelled, their mechanism of biogenesis remains poorly understood. miRNAs are transcribed as long primary transcripts (pri-miRNAs) whose maturation occurs through sequential processing events: the nuclear processing of the pri-miRNAs into stem-loop precursors of approximately 70 nucleotides (pre-miRNAs), and the cytoplasmic processing of pre-miRNAs into mature miRNAs. Dicer, a member of the RNase III superfamily of bidentate nucleases, mediates the latter step, whereas the processing enzyme for the former step is unknown. Here we identify another RNase III, human Drosha, as the core nuclease that executes the initiation step of miRNA processing in the nucleus. Immunopurified Drosha cleaved pri-miRNA to release pre-miRNA in vitro. Furthermore, RNA interference of Drosha resulted in the strong accumulation of pri-miRNA and the reduction of pre-miRNA and mature miRNA in vivo. Thus, the two RNase III proteins, Drosha and Dicer, may collaborate in the stepwise processing of miRNAs, and have key roles in miRNA-mediated gene regulation in processes such as development and differentiation.
5,191 citations
"Mechanisms of gene silencing by dou..." refers background in this paper
...miRNAs are transcribed as long primary transcripts, which are first processed by Drosha in the nucleu...
[...]
TL;DR: Detailed deletion and expression analysis shows that miR15 and miR16 are located within a 30-kb region of loss in CLL, and that both genes are deleted or down-regulated in the majority (≈68%) of CLL cases.
Abstract: Micro-RNAs (miR genes) are a large family of highly conserved noncoding genes thought to be involved in temporal and tissue-specific gene regulation MiRs are transcribed as short hairpin precursors (≈70 nt) and are processed into active 21- to 22-nt RNAs by Dicer, a ribonuclease that recognizes target mRNAs via base-pairing interactions Here we show that miR15 and miR16 are located at chromosome 13q14, a region deleted in more than half of B cell chronic lymphocytic leukemias (B-CLL) Detailed deletion and expression analysis shows that miR15 and miR16 are located within a 30-kb region of loss in CLL, and that both genes are deleted or down-regulated in the majority (≈68%) of CLL cases
5,113 citations