scispace - formally typeset

Journal ArticleDOI

Morphological, ecological and molecular characterization of Pyropia vietnamensis (Bangiales, Rhodophyta) from the Konkan region, India

26 Aug 2015-Phytotaxa (Magnolia Press)-Vol. 224, Iss: 1, pp 45-58

TL;DR: The molecular analysis utilizing cox 1 gene sequences clearly revealed the close relation of Indian and Brazilian specimens with only 0-1 bp intraspecific variation.
Abstract: Pyropia vietnamensis is one of the most luxuriously growing seaweed in Konkan coast, India. In the present study we attempted to explore the morphology, ecology and molecular characteristics exhibited by P. vietnamensis and its taxonomic implications. We described the effects of ecological parameters on the variability of morphological characters. The water motion was found to be one of the most important ecological parameter that governs the plant morphology. The plant was found to grow on entire intertidal region and this may be one of the possible reasons for high morphological variation among the taxa in this region. The molecular analysis utilizing cox 1 gene sequences clearly revealed the close relation of Indian and Brazilian specimens with only 0-1 bp intraspecific variation. The present study provides a beginning to a clearly required detailed study of the morphology, ecology and genetic diversity showed by Pyropia species from Indian waters.

Content maybe subject to copyright    Report

Phyiotaxa 0 0 0 (0 ): 0 0 0- 0 0 0 ISSN 1179-315 5 (printedition)
w w w .m a p re s s.c o in /p h y to ta x a / A F tlc l 0 PHYTOTAXA
C o pyi iglU O 2 0 15 M a g n o lia Press
htlp://dx.doi.org/10.11646/phytotaxa.00.0.0
ISSN 1179-3163 (online edition)
M orphological, ecological and molecular characterization oiP yrop ia vietnamensis
(Bangiales, Rhodophyta) from the Konkan region, India
MO NIC A G. KAVALE'*, M U D ASSAR ANISO DD IN K A ZI', NIV ED SREEN ADH AN & VEERENDRA V.
SIN G H'
' Department o f Botany, I. C. S. College, Khed, Ratnagiri. M aharashtra. 415 709, India
^ICAR-Mumbai Research Centre o f Central Marine Fisheries Research Institute, Mumbai 400061, India
Corresponding author: * monicakavale(^^gjinail. com
Abstract
Pyropia vietnamensis is one of the most luxuriously growing seaweed in Konkan coast, India. In the present study we at
tempted to explore the morphology, ecology and molecular characteristics exhibited by P. vietnamensis and its taxonomic
implications. We described the effects o f ecological parameters on the variability o f morphological characters. The water
motion was found to be one o f the most important ecological parameter that governs the plant morphology. The plant was
found to grow on entire intertidal region and this may be one o f the possible reasons for high morphological variation among
the taxa in this region. The molecular analysis utilizing cox I gene sequences clearly revealed the close relation o f Indian and
Brazilian specimens with only O-I bp intraspecific variation. The present study provides a beginning to a clearly required
detailed study o f the morphology, ecology and genetic diversity showed by Pyropia species from Indian waters.
Key w ords: Pyropia, morphological plasticity, morphometries, c oxi, phylogenetic analysis, taxonomy
Introduction
The m arine m acroalga P yropia vietnamensis (Tak. Tanaka & RH. Ho) J.E. Sutherland & M onotilla was first described
from the upper littoral zone o f Vung-Tau (Cap. St. Jacqus), Vietnam by Tanaka & Ho (1962). The taxon was distinguished
from its closest relative P yropia denticulate Levring based on its difference in frond size and the division formula o f
spermatia. P. vietnam ensis is one o f the most important and abundantly growing seaw eed in India (Sahoo etal. 2001).
Its occurrence was first rep orted by Sreeram ulu (1952) as Porphyra naiadam from Waltair, Visakhapatnam,
India during the sum m er season (February to June) and later on same specimen was identified as P. vietnam ensis by
Umam ahesw ara Rao & Sreeram ulu (1963). P. vietnam ensis w as also reported from Dona Paula, Goa (Dhargalkar el
at. 1981) and Colaba Coast, M aharashtra (Deodhar 1985) in m onsoon season during the m onths o f June to September.
Both Dona P aula and Colaba C oast falls within the K onkan region situated along the W est co ast o f India.
Konkan is a northern part o f the western coastal plain o f India, situated between the Western Ghats and the
Arabian Sea. It is a narrow strip o f about 50 km width th at stretches from 15®37 to 20®20 latitude and 70®07’ to
74®13’ longitude. The K onkan coast is characterized by num erous backwaters, lagoons and rocky cliffs. However,
from the above reports it is clear that very few attem pts have been m ade to explore the diversity o f P. vietnamensis
from this region. It w as surprising to note that, the w o rld s highly important and com m ercialized algal genus remained
underutilized by phycologist, despite its abundance on the Konkan coast.
We realized the possible reasons for such apparent apathy during the collection o f Pyropia. It is amply clear from
our survey th at the occurrence o f the alga was visible during monsoon season (June-Septem ber). D uring this period,
the coast experienced very heavy rain, coupled w ith strong and huge waves hitting the coast. Consequently, the fishing
activities in this region also cease. These prevailing odd environm ental conditions might have been deterrent for
phycologists to plan and execute collections o f Pyropia during the m onsoon period.
Recently, biodiversity assessm ent study o f econom ically im portant seaweeds was undertaken by authors along
the west coast o f India. We observed tw o different species o f Pyropia z\ong the K onkan region. A mong these two
species, one w as identified as P. acanthophora, a new report from the Indian region and subsequently reported as a
A c c ep te d by R a fa el R io sm en a-R o dr igitez : 2 Aug. 201 5: p u blis he d: x x xxx. 2 015 1

new variety P. acanthophora var. robusla (K avale el al. 2014). T he second species w as P. vietnamensis. We found
notable m orphological variations in P. vietnamensis. Although, several publications have appeared with respect to its
developm ental, chem ical and ecological studies(A nilkumar et al. 2005, Sahoo et al. 2006, Subbarao et al. 2007, B hatia
et al. 2010 , Kavale et al. 2013, Kumari et al. 2013); least attention was paid tow ards its system atics from the Konkan
coast. T hu s, the present study mainly focuses on morphological, ecological and m olecular characterization and their
taxonom ical im plication to understand the variation patterns in P. vietnamensis.
M ateria] & M ethods
C ollection
The specim ens analysed were collected from several locations along the coastal plain o f the Konkan region. The
sites selected for collection are shown in Supplementary File, Fig. S I. Collection was made during the monsoon
season (July-Septem ber). P rinciple o f random sampling was followed during the collections. The plants were found
grow ing on rocks in the supralittoral and eulittoral zones. The specim en was handpicked. The colour o f the alga and
the extent o f their growth w ere recorded in th e field itself G eom orphology and ordinates o f collection sites are given
in Supplem entary File, Table S I. Specim ens were washed two to three tim es with sea w ater to rem ove adhering
m aterials such as sand particles, other debris as well as epiphytes. A solution o f 4% formalin in seawater w as used
as preservative. T he collected material was preserved for further processing and characterization. Herbarium s o f the
specim ens were m ade and subm itted to the repository o f C entral National Herbarium, Botanical Survey o f India,
K olkata, India. Fresh specim ens were stored at -20°C for the isolation o f genomic DNA.
M orph ological characterization
Initially specim ens w ere assorted based on their shape and texture. M inim um 30 thalli o f each specim en type were
used for observations. Length and width of th e thalli w ere measured using thread and scale. Free hand sections were
taken for characterization. The features selected for the morphological characterization were shape, size, texture
and colou r o f the plant, base o f the blade, nature of margins, thickness o f the thallus, thickness o f the mucilage,
diam eter o f m onospores, diam eter o f vegetative and reproductive cells, distribution, division formula and num ber
o f fertile cells etc. 1% aqueous Toludine Blue and 1% aqueous saffranine were used for staining and w as m ounted
in a medium containing 50% glycerin. M icrom eter and ocular scales were used to determine the dim ensions o f the
material. M orphological observations were cairied out on com pound and phase contrast m icroscope (Motic, Hong
Kong). T he characteristics o f specim ens were compared with previously published reports for identification (Tanaka
& Ho 1962, K rishnam urthy & Balusw am i 1984).
M orphomefric analysis
The m orphological characters representing shape and size o f the plant, habitat, nature o f margin, color o f the plant,
occurrence o f spines, thickness o f m ucilage and thickness o f the thallus in reproductive and vegetative part were scored
for the m orphom etric studies. Minimum 30 observations were taken for each character. The cluster analysis was
perform ed by UPG M A (unweighted pair group method with arithm etic mean algorithm ) in Multi-Variate Statistical
Package (M V SP) program (Everitt, 1980).
M olecular characterization
Total D N A w as extracted w ith the G ene Elute Plant G enomic DNA miniprep kit (Sigm a Aldrich, St. Louis, USA)
follow ing the m anu facturers protocol. Amplification by PCR was performed in a master mix o f volume 25 |.il containing
200 fiM o f each dNTP, 5 pmol o f each primer, IX assay buffer, and 1.25 units o f Taq DNA polymerase. The co x\
(cytochrom e c oxidase subunit 1) gene w as am plified using prim ers G az Fl: 5- TCAACAAATCATAAAGATATTGG
- 3 and G azR l; 5’- ACTTC TGGATGTCCAA AA AA YCA - 3 (Saunders 2005). The am plification profile for coxl
follow ed Saunders (2005). The PCR products w ere purified with a G ene Elute Gel Extraction K it (Sigm a Aldrich,
St. Louis, USA) and sent for com mercial sequencing (X celris Labs Ltd., India). The sequences were deposited in
G enBank under the accession numbers shown in Supplem entary File, Table S 1.
T he phylogenetic analysis o f coxl gene data was carried out in MEGA version 6 (Tamura et al. 2013), The maximum
likelihood (ML) tree w as constructed using G eneral Time Reversible (G TR )(T avare 1986) nucleotide substitution
model w ith discrete G am m a distribution (+G) and invariant sites (+1). Best suited evolutionary model was estim ated in
2 000 (0) © 2015 Magnolia Press KAVALE

MEG A version 6 u nder the Bayesian Information Criterion (BIC) (Schwarz 1978). Support for branches was estimated
by 1000 bootstrap replicates (Felsenstein 1985). The pairw ise distances between sequences w ere calculated using the
Kimura tw o param eter (K 2P) distance model (Kimura 1980) in MEGA version 6.
Results
The data presented in this study is the outcome o f th e algal collection m ade from A ugust 2012 to Septem ber 2013
from various locations along the Konkan coast. O f the 22 sites visited, P. vietm m en sis was found growing only at 12
locations as listed in Table S I. A total o f 15 specimens w ere studied for their ecological, m orphological and molecular
characteristics.
Ecological characterization
It w as observed th at th e growth o f P. vietnam ensis starts in the m onth o f June. By the first h alf o f August a fully grown
thalli was observed I. e. the vegetative thalli appeared during the month o f July and developed to its reproductive stage
by first w eek o f A ugust. The growth o f alga started declining with the end o f m onsoon and vanished by th e end o f
September. T h e plants were found to be grow ing on different kinds o f rocky substrate (Supplem entary File, T able SI).
It grows in patches tow ards the low water m ark and then gradually spreads and covers the entire rock surface up to
high tide w ater m ark . The other species like Uha^ C eram ium, Chaetoniorpha, Spongom orpha and Sphacelaria w ere
also observed as associates of P. vietnamensis. How ever, at the end o f monsoon season other species like Ulva and
Grateloupia started encroaching over P. vietnamensis.
M orphological characterization
M orphological characters o f P. vietnam ensis specim ens are enlisted in Supplem entary F ile, Table S2. The plants are
4 -3 0 cm in height and 1.5-15 cm in width (Figs. 1-15). At younger stage plants look greenish brown and at m aturity
it turns brownish red. The plants turned purple brow n, purple pink and brown after drying. The plants vary in shapes
as linear, orbicular, lanceolate, orbilanceolate, ovate pyramidal and irregular (Figs. 1-15). Blades were sessile with
cordate base and delicate in texture. Several blades arise from a discoid holdfast, Margin o f the blades w ere plain to
undulate with ruffled surface and w ith numerous spines (Figs. 1-15, Figs. 16-30). The spines were 1-2 celled and
up to 9.9 )jm in h eight (Figs. 16-30). The plants in eulittoral zone show ed higher num ber o f spines as com pared to
supralittoral zon es. Generally the spines were observed in the lower to m iddle region o f the blade. The thalli were
m onostrom atic, 23 .1-49.5 nm thick in vegetative part (Figs. 3 1-45) and 29.7-52.8 ^m in reproductive part (Figs. 4 6 -
75). The v egetative cells were found to be polygonal with blunt corners and ranged from 13.2-23.1 nm in its greatest
dimensions. In cross section vegetative cells w ere one to Uvo lim es higher than broader and ranged from 16.5-26.4
)im in height and 6.6-16.5 jim In width. The shap e o f the vegetative cells in the cross section was rectangular with
rounded corners. The surface mucilage was 6.6 -1 3 .2 jam thick on the either side o f the section. Each vegetative cell
consisted o f a stellate chloroplast with a central pyrenoid. The m onosporangia w ere produced on the m arginal region.
The m onospores were round with diam eter up to 23.1|im . The plants w ere m onoecious. M ostly sperm atangia and
zygotosporangia w ere observed in mixed fonn and occasionally as irregular patches or in strip? (Figs. 76-7 8). The
sperm atangia and zygotosporangia w ere easily differentiated by their color. The sperm atangia w ere colorless to pale
yellow while zygotosporangia appeared reddish brown in colour. There w ere 64 sperm atia in each sperm atangium
with division form ula as a/4, b/4, c/4 and m easured upto 3.3 ftm in diameter. Each zygotosporangium consisted o f 8
zygotospores ranging from 6.6-13.2 tim In d iam eter and their division fom iula as a/2, b/2, c/2.
M orphom etric analysis
The phenogram (Fig. 79) show ed tw o m ain clusters. Cluster I and C luster II. C luster I included specimens D ona Paula,
Redi, Palshet, H edavi I, Harihareshwar, Malvan I and Shekhadi. Cluster II included specim ens A njuna, Vagathor,
Purnagad I, Velaneshwar, Hedavi II, M alvan II, Purnagad II and K olthare. These tw o clusters were mainly separated
based on their size and shape o f the plant; w ave exposed and wave sheltered habitat. Cluster I included specimen
which grow s on wave shelter area while Cluster 2 comprised o f specim ens that grow s on w ave exposed area except
Purnagad I and Kolthare. The plants which w ere directly exposed to waves show ed characteristically narrow width
and longer length. The shape o f these plants varied between linear to lanceolate and margin was plain with ruffled
surface. On the other hand the specim ens w hich w ere grow ing in sem i-sheltered region showed variation in shapes
PYROPIA V I E T N A M E N S I S 000 (0) © 2015 Magnolia Press 3

I 2
FIG U R E S 1-15. Habit o f Pyropia vietm m ensis. 1. Harihareshwar (ARC- P- 31). 2. Shekhadi (ARC* P- 80). 3. Kollhare (ARC* P- 23).
4. Palshet (ARC- P- 3). 5. Malvan (ARC- P- 48). 6. Malvan (ARC- P- 69). 7. Pumagad (ARC- P- 21), 8. Pum agad (ARC- P-22). 9.
Velaneshwar (ARC- P- 8). 10. Anjuna (ARC- P - 192). II . Hedavi (ARC- P - 12). 12. Vagathor (ARC- P - 196). 13. Hedavi (ARC- P- 20).
14. Dona Paula (ARC* P - 183). 15. Rcdi (ARC- P- 73).
Phytotaxa 000 (0) © 2015 Magnolia Press KAVALE E T A L

s
t ^ ' ^ 5 ; ® '"
25 r
27
FIG U R E S 16-27. Spinulose margin o f thallus. Scale bar=* lOpm. 16. Anjuna. 17. Vagathor. 18. Malvan II. 29. Velaneshwar. 20. Hedavi
II. 21. Pum agad I. 22. Redi. 23. Hedavi I. 24. Malvan 1. 25. Dona Paula. 26. Palshet 27. Pumagad II
PYROPIA VlE TN AM E NSlS{^h^G {K LE%)
000 (0) © 2015 Magnolia Press 5

Citations
More filters

Journal ArticleDOI
Yang Li'en1, Wei Zhou, Hu Chuanming, Deng Yinyin  +6 moreInstitutions (2)
TL;DR: A transoceanic and antitropical pattern of distribution was found forPyropia at both the subgeneric and species level, indicating that the Northwest Pacific might act as a centre of origin for modern distribution of Pyropia since the early Cenozoic.
Abstract: A molecular taxonomic study was undertaken for the first time of the bladed Bangiales of the mainland coast of China (Northwest Pacific) based on sequence data of 201 plastid rbcL and 148 nuclear 18S sequences of historical and contemporary specimens. The results revealed that only one genus of bladed Bangiales, Pyropia, was present along Chinese coast. Species delimitation was determined using two empirical methods: the Automatic Barcode Gap Discovery (ABGD) and General Mixed Yule Coalescence (GMYC) coupled with detection of monophyly in tree reconstruction. At least fourteen species of Pyropia were recovered. Six species were confirmed that had been recorded previously based on morphology (Py. suborbiculata, Py. yezoensis, Py. haitanensis, Py. katadae, Py. tenera and Py. acanthophora), three species were recorded from China for the first time (Py. kinositae, Py. pseudolinearis and Py. tanegashimensis), and five cryptic species that did not match any molecular sequences were also discovered. The phylogeny of the concatenated rbcL and 18S dataset resolved three singletons and four clades. Each clades has a strong trend towards occupying a biogeographic region, but they are not confined to them. A transoceanic and antitropical pattern of distribution was found for Pyropia at both the subgeneric and species level. This together with high biodiversity (ca. 30% of all known Pyropia species) indicates that the Northwest Pacific might act as a centre of origin for modern distribution of Pyropia since the early Cenozoic.

16 citations


Journal ArticleDOI
TL;DR: An examination of molecular differentiation and distribution was undertaken using the mitochondrial COI-5P and plastid rbcL gene sequences, showing evidence that the Philippine populations of Py.
Abstract: Pyropia acanthophora is a foliose Bangiales with widely known endemic populations in Indo-Pacific region. This alga has expanded its range recently as a consequence of introduction. In an attempt t...

15 citations


Journal ArticleDOI
25 Dec 2019-Diversity
Abstract: Seaweeds are a renewable marine resources and have not yet received considerable attention in the field of taxonomy in India as compared to their terrestrial counterparts, essentially due to the lack of awareness of their economic potential. Although the recent inventory from the Indian region documented the presence of approximately 865 seaweed taxa, of which only a few are taxonomically well characterized, more precise information still awaits with respect to microscopic and molecular examinations of many. Thus far, in terms of spatial extent, probably only a few of the total hospitable seaweed habitats have been explored, and large portions, including island territories and subtidal waters, remain virtually untouched. Surveying those may lead to the reporting of several taxa new to science. Furthermore, more focused efforts are required to understand the endemic and endangered taxa which have high conservation implications. Considering the unprecedented pressures seaweeds are facing, including coastal pollution and human-induced global warming, it is critical to reinforce our knowledge of seaweed biodiversity. In the present communication, we intended to address the status of seaweed biodiversity in India along with the gaps, challenges, and opportunities.

14 citations


Journal ArticleDOI
TL;DR: The nutritional analysis of P. acanthophora var.
Abstract: Genus Pyropia is one of the nutritionally rich marine algae. Among Indian Pyropia species, Pyropia acanthophora has been documented as a new addition with its new variety robusta. Biodiversity assessment revealed that P. acanthophora var. robusta reported only on the central west coast of India during monsoon (June to September). The nutritional composition of the collected samples was evaluated for proximate analysis along with vitamin C, dietary fiber, pigments, minerals, and fatty acid composition. The protein content was in the range of 14.11 ± 0.62 to 18.36 ± 0.90 g (100 g)−1 dry wt. Lipid content ranged from 1.65 ± 0.25 to 2.56 ± 0.40 g (100 g)−1 dry wt., and the concentrations of PUFA among these lipids were found in considerable quantity. Dietary fiber was also obtained in high concentration and ranged from 45.13 ± 1.30 to 63.0 ± 4.40 g (100 g)−1 dry wt. In this study, the level of K, Na, Mg, Fe, I, and P were appreciably high. Thus, the nutritional analysis of P. acanthophora var. robusta confirmed that it has potential to be used as an ingredient for nutritional supplements.

8 citations


Cites background or methods from "Morphological, ecological and molec..."

  • ...…Khed, Maharashtra 415 709, India 2 Present address: CSIR-CSMCRI, Marine Algal Research Station, Mandapam, Tamilnadu 623519, India M.A. Kazi &N. Sreenadhan, a new report with its new variety in India (Kavale et al. 2015a) which had limited occurrence, particularly at Central West cost of India....

    [...]

  • ...In India, the generic name Porphyra was used up to 2011, but, after the generic revision of Bangiales by Sutherland et al. (2011), all the Porphyra species were transferred to Pyropia (Kavale et al. 2015a, 2015b)....

    [...]



References
More filters

Journal ArticleDOI
Joseph Felsenstein1Institutions (1)
01 Jul 1985-Evolution
TL;DR: The recently‐developed statistical method known as the “bootstrap” can be used to place confidence intervals on phylogenies and shows significant evidence for a group if it is defined by three or more characters.
Abstract: The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.

37,948 citations


"Morphological, ecological and molec..." refers methods in this paper

  • ...Support for branches was estimated by 1000 bootstrap replicates (Felsenstein 1985)....

    [...]