scispace - formally typeset
Search or ask a question
Journal ArticleDOI

Pathology caused by persistent murine norovirus infection

TL;DR: It is confirmed that long-term persistence in WT mice is established with specific variants of MNV and that despite a subclinical presentation, active foci of acute inflammation persist within the liver.
Abstract: Subclinical infection of murine norovirus (MNV) was detected in a mixed breeding group of WT and Stat1(-/-) mice with no outward evidence of morbidity or mortality. Investigations revealed the presence of an attenuated MNV variant that did not cause cytopathic effects in RAW264.7 cells or death in Stat1(-/-) mice. Histopathological analysis of tissues from WT, heterozygous and Stat1(-/-) mice revealed a surprising spectrum of lesions. An infectious molecular clone was derived directly from faeces (MNV-O7) and the sequence analysis confirmed it was a member of norovirus genogroup V. Experimental infection with MNV-O7 induced a subclinical infection with no weight loss in Stat1(-/-) or WT mice, and recapitulated the clinical and pathological picture of the naturally infected colony. Unexpectedly, by day 54 post-infection, 50 % of Stat1(-/-) mice had cleared MNV-O7. In contrast, all WT mice remained infected persistently. Most significantly, this was associated with liver lesions in all the subclinically infected WT mice. These data confirmed that long-term persistence in WT mice is established with specific variants of MNV and that despite a subclinical presentation, active foci of acute inflammation persist within the liver. The data also showed that STAT1-dependent responses are not required to protect mice from lethal infection with all strains of MNV.

Summary (4 min read)

INTRODUCTION

  • Understanding the mechanisms of viral persistence of non-integrating RNA viruses will facilitate ultimately their control.
  • Persistence of FCV and RHDV is thought to occur by gradual mutation driven by the immune response, but recombination between strains and reinfection may also occur (Coyne et al., 2007; Forrester et al., 2008) .
  • Furthermore, although experimental infection of immunocompetent and Stat1 −/− mice was subclinical, histopathology revealed a progressive, subclinical multifocal hepatitis.
  • An infectious molecular clone was derived directly from faeces, which recapitulated this pathology.

RESULTS AND DISCUSSION

  • Natural MNV-O7 infection is subclinical in Stat1 −/− mice MNV was first described as an acute infection with mortality and morbidity apparent in Stat1 −/− mice, persistent subclinical infection in Rag −/− mice, and acute subclinical infection in WT mice (Karst et al., 2003) .
  • RAGs are the recombination activating enzymes involved in B-and T-cell receptor rearrangement, and mice without the genes for these proteins do not have an adaptive immune response.
  • To date, however, there has been no report of the consequences of subclinical and persistent MNV infection in Stat1 −/− mice.
  • Occasionally, the mesenteric lymph nodes were also enlarged, but no other gross abnormalities were detected.
  • Histopathology revealed lesions in the liver (Stat1 −/− , Fig. 1b, c ; heterozygous and WT mice, Fig. S1 , available in JGV Online), spleen, intestine and lungs (data not shown); these varied from normal to mild/moderate foci of inflammation and in 33 % of the mice multifocal to diffuse necrosis.

Direct isolation of a full-length molecular clone of MNV-O7 -a unique MNV strain

  • In order to characterize the virus without adaptation in tissue culture, an infectious fulllength molecular clone called MNV-O7mc was derived directly from faeces of a Stat1 −/− mouse.
  • This most probably reflects movement of mice between breeding and/or experimental animal facilities.
  • The majority of the differences seen were in the P domain of the capsid (aa 229-537), which is consistent with the P domain being the most variable (Thackray et al., 2007) .
  • To prove that the MNV-O7mc was infectious in vivo, three Stat1 −/− and three WT mice received 1×10 4 RNA copies of MNV-O7mc, whilst another three Stat1 −/− and three WT mice were mock inoculated.
  • This method of producing infectious virus limits the mutations that might be caused by tissue culture passage and these are known to attenuate MNV-1 in Stat1 −/− mice (Bailey et al., 2008; Wobus et al., 2004) .

Control of MNV is not dependent on STAT1 responses

  • MNV-1 was first identified because it caused mortality in Rag2 −/− Stat1 −/− mice and this was shown to be due to the lack of STAT1.
  • This confirmed that MNV-1 infection was virulent in Stat1 −/− mice.
  • It also agrees with previous reports where 129 mice infected acutely by the intracerebral, intranasal and peroral routes with MNV-1 showed no clinical signs (Karst et al., 2003) .
  • No viral RNA was detected in the faecal samples from any of the Stat1 −/− mice infected with MNV-O7, although viral RNA was isolated from the spleens and livers of ~50 % of these mice.

Gross spleen and liver pathology in MNV-O7-infected mice

  • After acute infection, splenomegaly was evident in MNV-1-infected Stat1 −/− mice, characterized by decreased coloration and an increase in length (P<0.05) compared with mock-infected and MNV-O7-infected mice (Fig. S5 ).
  • Similarly, there were no differences in size or gross pathology of the livers between mock-infected and virus-infected WT and Stat1 −/− mice (data not shown).
  • There was no significant difference in the spleen length between the other animal groups.
  • The lack of gross pathological lesions after MNV infection in immunocompetent mice is in agreement with other studies (Perdue et al., 2007) .

Histopathological lesions in MNV-O7-infected mice

  • Both the MNV-O7mc and tissue culture-derived virus caused histopathological lesions in the liver (Figs 3b and 4e ) and spleen (Fig. 3d ) of Stat1 −/− mice after acute infection, whilst mock-inoculated mice showed no liver or splenic pathology (Figs 3a and 4d , liver; Fig. 3c, spleen ).
  • As in MNV-O7-infected immunocompetent and Stat1 −/− mice, acutely MNV-1-infected immunocompetent mice had mild-to-moderate reactive hyperplasia in the spleens (data not shown).
  • Histological lesions were scored in the liver (Fig. 6 ) and spleen (data not shown) at days 5 and 54 p.i.
  • Very few lesions were seen in WT mice with either virus at acute time points (Fig. 6a ).

Derivation of a full-length molecular clone from faecal RNA

  • The full-length sequence of MNV from a WT mouse (MNV-O1) was obtained using primer walking, and used to design primers at the 5′ and 3′ ends of the genome (forward primer atagtttaggactagttaatacgactcactatagtgaaatgaggatggcaacgccatcttctgcgccc; reverse primer tcgcgaactagttttttttttttttttttttttttttaaaatgcatctaaatactactaaaagaaaagcagt).
  • Using these primers, a full-length cDNA was derived directly from RNA extracted from a faecal sample obtained from an infected Stat1 −/− mouse (MNV-O7).
  • RNA was reverse transcribed using random hexamers and SuperScript III , and the PCR used the Roche Applied Science Long Ranger PCR Kit.

Sequence analysis

  • Viral nucleotide sequences obtained (GenBank accession nos. KF113527 and KF113526 for MNV-O1 and MNV-O7, respectively) and their predicted amino acid sequences were aligned using Clustal W with full-length MNV genomic or protein sequences drawn from GenBank.
  • A PhyML (Guindon et al., 2010) phylogenetic tree was constructed using SeaView software with 100 bootstrap repetitions (http://pbil.univ-lyon1.fr/software/ seaview.html; Gouy et al., 2010) .
  • The tree was then edited using FigTree software (http:// tree.bio.ed.ac.uk/software/figtree; Andrew Rambaut, Institute of Evolutionary Biology, University of Edinburgh, UK).

Reverse genetics

  • The full-length MNV-O7 cDNA clone was inserted into pT 7 3′Rz to generate pT7-MNV-O7-Rz carrying the O7 sequence under the control of a T7 RNA polymerase promoter.
  • Using site-directed mutagenesis, the SpeI restriction site sequence on the 3′ primer was altered to a NheI restriction site sequence and the plasmid used to recover infectious virus as described previously (Chaudhry et al., 2007) .

Virus culture and quantification

  • MNV-1.CW3 was kindly provided by Professor H. Virgin (Department of Pathology and Immunology, Washington State University, USA) and is not persistent in WT mice, but is pathogenic in Stat1 −/− mice (Mumphrey et al., 2007) .
  • MNV-O7 was amplified briefly by one passage on RAW264.7 cells.
  • The virus was harvested and stored as above.
  • Virus titre was determined by measuring TCID 50 in RAW264.7 cells (if the virus induced CPEs) or by qRT-PCR.
  • One-tenth of the cDNA reaction was used in the real-time PCR with Quantitect Probe PCR Master Mix using the manufacturer's suggested primer and probe concentrations, and the PCR performed in a Rotor-Gene 6000 : Taq activation (15 min, 95 °C); PCR 40 cycles: 10 s, 95 °C, 30 s, 60 °C; in triplicate.

ELISA for antibodies

  • Diagnostic MNV ELISA microtitre plates (Charles River Laboratories) were used as per the manufacturer's instructions with 50 μl serum diluted 1: 60 (derived from a test serum titration).
  • Positive and negative (CL550 and CL500, respectively; Charles River Laboratories) serum controls were used with each ELISA plate.

Animals and in vivo infections

  • A small mix-breed group of animals from the John Radcliffe Hospital, University of Oxford was shipped to Cambridge for further study.
  • From the mixed group, mice were rederived, genotyped and bred to homozygosity for the Stat1 gene deletion.
  • For experimental infections, mice were used at 8-12 weeks of age and were negative for anti-MNV antibody by ELISA.
  • Faecal samples were collected from individual mice.

Gross pathology

  • The following tissues were examined for gross lesions: intestine, mesenteric lymph node, spleen, liver and lung.
  • The liver, spleen and lung were measured by ruler and digital images taken.

Histopathology

  • Small pieces of the small intestine (duodenum, jejunum and ileum), caecum, colon, mesenteric lymph node, spleen, liver and lung were placed in 10 % buffered formal saline and embedded in paraffin.
  • Haematoxylin and eosin-stained 3 μm thick sections were viewed with a Carl Zeiss AxioVision microscope, the images captured using an AxioCam camera and processed using the AxioVision digital image processing software and/or the sections captured with a digital slide scanner Hamamatsu NanoZoomer 2.0 RS and the images viewed with NDP.view2.
  • The tissues were graded for the degree of inflammation, fibrosis and necrosis using a modification of published grading systems (Hübscher, 1998; Theise, 2007; Wirtz et al., 2007) (Table S1 , 10 fields per section were scored).
  • Histopathological grading of liver pathology from MNV-infected mice.
  • Individual mouse scores and group medians are shown.

Did you find this useful? Give us your feedback

Content maybe subject to copyright    Report

Pathology caused by persistent murine norovirus infection
Amita Shortland
1
, James Chettle
1
, Joy Archer
1
, Kathryn Wood
2
, Dalan Bailey
3
, Ian
Goodfellow
4
, Barbara A. Blacklaws
1
, and Jonathan L. Heeney
1
1
Department of Veterinary Medicine, University of Cambridge, Madingley Road, Cambridge CB3
OES, UK
2
Nuffield Department of Surgical Sciences, University of Oxford, Level 6, John Radcliffe Hospital,
Headington, Oxford OX3 9DU, UK
3
Institute of Biomedical Research, University of Birmingham, Birmingham B15 2TT, UK
4
Division of Virology, Department of Pathology, University of Cambridge, Addenbrooke’s Hospital
Level 5, Hills Road, Cambridge CB2 2QQ, UK
Abstract
Subclinical infection of murine norovirus (MNV) was detected in a mixed breeding group of WT
and Stat1
−/−
mice with no outward evidence of morbidity or mortality. Investigations revealed the
presence of an attenuated MNV variant that did not cause cytopathic effects in RAW264.7 cells or
death in Stat1
−/−
mice. Histopathological analysis of tissues from WT, heterozygous and Stat1
−/−
mice revealed a surprising spectrum of lesions. An infectious molecular clone was derived directly
from faeces (MNV-O7) and the sequence analysis confirmed it was a member of norovirus
genogroup V. Experimental infection with MNV-O7 induced a subclinical infection with no
weight loss in Stat1
−/−
or WT mice, and recapitulated the clinical and pathological picture of the
naturally infected colony. Unexpectedly, by day 54 post-infection, 50 % of Stat1
−/−
mice had
cleared MNV-O7. In contrast, all WT mice remained infected persistently. Most significantly, this
was associated with liver lesions in all the subclinically infected WT mice. These data confirmed
that long-term persistence in WT mice is established with specific variants of MNV and that
despite a subclinical presentation, active foci of acute inflammation persist within the liver. The
data also showed that STAT1-dependent responses are not required to protect mice from lethal
infection with all strains of MNV.
INTRODUCTION
Understanding the mechanisms of viral persistence of non-integrating RNA viruses will
facilitate ultimately their control. Persistence of members of the family Caliciviridae has
© 2014 The Authors. Published by Society for General Microbiology.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/
licenses/by/3.0/)
Correspondence: Barbara A. Blacklaws, bab2@cam.ac.uk.
The GenBank/EMBL/DDBJ accession numbers for the genomic sequences of MNV-O1 and MNV-O7 are KF113527 and KF113526,
respectively.
One supplementary table and eight supplementary figures are available with the online version of this paper.
Europe PMC Funders Group
Author Manuscript
J Gen Virol. Author manuscript; available in PMC 2015 January 29.
Published in final edited form as:
J Gen Virol. 2014 February ; 95(0 2): 413–422. doi:10.1099/vir.0.059188-0.
Europe PMC Funders Author Manuscripts Europe PMC Funders Author Manuscripts

been reported after infection with feline calicivirus (FCV), rabbit haemorrhagic disease virus
(RHDV), and human and murine norovirus (HuNoV and MNV) (Capizzi et al., 2011; Coyne
et al., 2006; Forrester et al., 2003; Hsu et al., 2006; Siebenga et al., 2008; Thackray et al.,
2007). Studies on HuNoV persistence have focused on mechanisms of viral evolution,
antigenic variation and receptor switching to allow persistence in the population, but if and
how ‘within-host’ persistence occurs is not understood clearly. Persistence of FCV and
RHDV is thought to occur by gradual mutation driven by the immune response, but
recombination between strains and reinfection may also occur (Coyne et al., 2007; Forrester
et al., 2008).
MNV has been reported to persist in both immunocompromised and immunocompetent
mice, and persistent infection can occur in immunocompetent hosts despite robust
seroconversion (Hsu et al., 2006; Karst et al., 2003; Thackray et al., 2007). Acute and
persistent strains of MNV belong to the same genogroup (V), and serogroup and systemic
infection occurs with both types, with spread to the spleen, liver and lungs as well as other
organs (Hsu et al., 2006; Thackray et al., 2007). A role for antibodies and T-cells in the
clearance of acute MNV from tissues and the intestine has been demonstrated (Chachu et
al., 2008a
, b), but persistent MNV strains are less well characterized, and there are few
comparisons between acute and persistent strains (Kahan et al., 2011; Nice et al., 2013).
How persistent norovirus infection is maintained is unclear. Changes in surface antigens
may enable evolving viral progeny to evade the immune system, facilitating their persistence
in the host. This has been shown for FCV and MNV during chronic infection where
mutations occur in areas predicted to be important for immune recognition (Arias et al.,
2012; Johnson, 1992; Radford et al., 1998). Impairment of immune cell function may be
another way in which virus can persist. MNV replicates in macrophages and dendritic cells
and, like many viruses that infect antigen-presenting cells, may also impair the activation of
T-cells (
Tomov et al., 2013) and B-cells (Oldstone, 2006; Wobus et al., 2004). Studies with
two persistent strains of MNV have implicated colonic tropism in persistent infection of
immunocompetent mice; however, the immunopathological consequences of infection by
these viruses have not been established (Arias et al., 2012; Nice et al., 2013).
Here, we report on the identification and characterization of a variant of MNV (MNV-O7)
derived from a small group of mixed breeding animals consisting of Stat1
−/−
and WT mice
that had no clinical abnormalities or increased mortality. Surprisingly, all animals in this
group were infected subclinically. Virus growth was noncytopathic in vitro. Furthermore,
although experimental infection of immunocompetent and Stat1
−/−
mice was subclinical,
histopathology revealed a progressive, subclinical multifocal hepatitis. An infectious
molecular clone was derived directly from faeces, which recapitulated this pathology.
Interestingly, infection of immunocompetent mice showed that all animals had long-term
persistence of MNV-O7, whilst resolution and clearance occurred in 50 % of Stat1
−/−
mice.
Here, we report on the characterization of a non-pathogenic MNV strain in Stat1 knockout
mice with direct derivation of an infectious molecular clone from faeces.
Shortland et al.
Page 2
J Gen Virol. Author manuscript; available in PMC 2015 January 29.
Europe PMC Funders Author Manuscripts Europe PMC Funders Author Manuscripts

RESULTS AND DISCUSSION
Natural MNV-O7 infection is subclinical in Stat1
−/−
mice
MNV was first described as an acute infection with mortality and morbidity apparent in
Stat1
−/−
mice, persistent subclinical infection in Rag
−/−
mice, and acute subclinical infection
in WT mice (Karst et al., 2003). STAT1 (signal transducer and activator of transcription-1)
is a central molecule in signalling from all IFN receptors and as such is key in inducing the
innate immune response antiviral pathways. RAGs are the recombination activating
enzymes involved in B- and T-cell receptor rearrangement, and mice without the genes for
these proteins do not have an adaptive immune response. It was therefore proposed by Karst
et al. (2003) that the IFN pathway is important in controlling the level of MNV infection,
but that adaptive immune responses are important in clearing the virus. MNV has also been
reported as causing a persistent infection in immunocompetent mice (Godinez et al., 2009;
Hsu et al., 2006, 2007; Karst et al., 2003; Manuel et al., 2008; Thackray et al., 2007). To
date, however, there has been no report of the consequences of subclinical and persistent
MNV infection in Stat1
−/−
mice.
A mixed colony of Stat1
−/−
mice with WT and heterozygous mice was found to be
seropositive for MNV by diagnostic ELISA. However, all mice were healthy and the high
morbidity or mortality seen previously in Stat1
−/−
mice (Karst et al., 2003; Wobus et al.,
2004) was not evident. The genotype of the mice was confirmed using two different sets of
published primers (Agrawal et al., 2007; Mohan et al., 2000) (data not shown). Surprisingly,
at necropsy all the Stat1
−/−
, 63 % of the heterozygous and none of the WT mice had
splenomegaly. In addition, Stat1
−/−
mice had multifocal, round slightly raised pale foci
throughout the liver parenchyma (data not shown). Occasionally, the mesenteric lymph
nodes were also enlarged, but no other gross abnormalities were detected.
Histopathology revealed lesions in the liver (Stat1
−/−
, Fig. 1b, c; heterozygous and WT
mice, Fig. S1, available in JGV Online), spleen, intestine and lungs (data not shown); these
varied from normal to mild/moderate foci of inflammation and in 33 % of the mice
multifocal to diffuse necrosis. A vasculitis (Fig. S1a) with occasional mild inflammatory
foci occurred in the liver parenchyma of 15 % of the WT and 56 % of the heterozygous mice
(data not shown), whilst the livers of 22 % of the heterozygous and 83 % of the Stat1
−/−
mice showed more severe multifocal to diffuse areas of inflammation often accompanied by
necrosis and fibrosis (Figs 1c and S1b). Lesions were present in the spleens, and varied from
red pulp hyperplasia and activation of the white pulp in both WT and heterozygous mice (20
and 38 %, respectively) to multifocal inflammation and necrosis in 50 % of the heterozygous
and all of the Stat1
−/−
mice (data not shown). In the lungs, 73 % of the Stat1
−/−
mice had
evidence of pneumonia with focal to multifocal perivascular inflammatory cell infiltrates
(Fig. 1d).
In WT mice naturally infected with this strain of MNV (referred to as MNV-O7),
enlargement of Peyer’s patches with increased germinal centres was observed. In Stat1
−/−
mice, mesenteric lymph nodes were enlarged with expanded, hyperplastic germinal centres
(data not shown).
Shortland et al.
Page 3
J Gen Virol. Author manuscript; available in PMC 2015 January 29.
Europe PMC Funders Author Manuscripts Europe PMC Funders Author Manuscripts

Direct isolation of a full-length molecular clone of MNV-O7 - a unique MNV strain
In order to characterize the virus without adaptation in tissue culture, an infectious full-
length molecular clone called MNV-O7mc was derived directly from faeces of a Stat1
−/−
mouse. Western blotting of the supernatant of molecular clone-transfected cells revealed
expression of MNV-O7mc RNA polymerase (Fig. S2). Reverse transcriptase (RT)-PCR
using RNA extracted from RAW264.7 cells infected with supernatant from the transfection
produced a strong band at 186 bp as expected for MNV-1 and MNV-O7 (data not shown).
This confirmed in vitro that the reverse genetics system had produced infectious virus.
MNV-O7mc was sequenced. A phylogenetic tree of the predicted amino acid sequences of
VP1 showed that MNV-O7 clustered with other MNV strains in genogroup V separate from
norovirus genogroups I, II, III and IV (data not shown), in agreement with previous reports
(Thackray et al., 2007). The predicted VP1 amino acid sequence of MNV-O7 was <11 %
divergent compared with other MNV strains, which supported the classification of MNV-O7
within genogroup V. Phylogenetic analysis of MNV genomic nucleotide sequences showed
MNV-O7 to cluster with MNV-O1 (isolated from a WT mouse in the same colony), on a
branch separate from other MNV strains, but closely related to two German isolates (GV/
CR18/2005/DEU and Berlin/05/O6/DE) and a South Korean isolate (MNV3/K4/2009/
Korea) (Fig. 1a). This most probably reflects movement of mice between breeding and/or
experimental animal facilities. MNV-O7 was identified as a unique strain as it diverged by
>3 % from all other MNV strains (Thackray et al., 2007).
MNV-O7 had four ORFs characteristic of MNV (Thackray et al., 2007). Compared to
MNV-1, MNV-O7 ORF2 had 178 nt differences (Fig. S3) corresponding to 17 aa
differences, including a codon (CAA) deleted at nt 6676 as has been observed for CR18
(Thackray et al., 2007). Phylogenetic analysis also showed CR18 to be related closely to
MNV-O7 (Fig. 1a). The majority of the differences seen were in the P domain of the capsid
(aa 229–537), which is consistent with the P domain being the most variable (Thackray et
al., 2007). However, the differences were spread across the P region and not restricted to the
P2 domain (aa 278–415) of the capsid. MNV-O7 had a glutamic acid at aa 296 in the P2
region of VP1, which is known to be associated with avirulence in Stat1
−/−
mice (Bailey et
al., 2008). The majority of MNV strains also have a predicted glutamic acid in this region of
VP1, with only MNV-1 and its derivatives containing lysine at this position. The epitope for
the neutralizing mAb A6.2 is also conserved in MNV-O7 (leucine at residue 386) (Katpally
et al., 2008; Lochridge & Hardy, 2007; Taube et al., 2010).
Comparison of ORF1 between MNV-O7 and MNV-1 revealed 80 aa differences (Fig. S3).
These included a glutamic acid at position 94 of NS1/2 that is associated with growth in the
proximal intestine in the persistent strain CR6 (Nice et al., 2013). ORF3 had 21 and ORF4
24 aa differences between MNV-O7 and MNV-1 (Fig. S3).
To prove that the MNV-O7mc was infectious in vivo, three Stat1
−/−
and three WT mice
received 1×10
4
RNA copies of MNV-O7mc, whilst another three Stat1
−/−
and three WT
mice were mock inoculated. The mice were observed daily (for 7 days) and clinical signs
were absent. A diagnostic RT-PCR for MNV carried out on faecal RNA collected pre-
infection and at day 7 post-infection (p.i.) showed no product in the control animals before
Shortland et al.
Page 4
J Gen Virol. Author manuscript; available in PMC 2015 January 29.
Europe PMC Funders Author Manuscripts Europe PMC Funders Author Manuscripts

and after inoculation, and no product in the challenged mice before infection with MNV-
O7mc (data not shown). Importantly, the faeces were virus-positive at day 7 p.i. for almost
all animals inoculated with MNV-O7mc (three of three WT and two of three Stat1
−/−
mice,
data not shown). A MNV RT-quantitative (q)PCR assay on the samples showed that all of
the challenged mice were infected, with viral titres in faeces ranging from 4×10
4
to 4×10
5
copies ml
−1
. The single Stat1
−/−
mouse that was negative by diagnostic RT-PCR had a low
viral copy number.
A separate group of WT mice was also infected with MNV-O7mc and the virus caused
persistent infection (three of three mice shedding virus in faeces at day 30 p.i.).
The filtered supernatant of faecal homogenate from the original MNV-O7-positive Stat1
−/−
mouse was incubated with RAW264.7 cells for 4 days, yet no cytopathic effects (CPEs)
were visible (Fig. S4b), despite an increase in viral RNA measured by RT-qPCR. MNV-1
did cause CPEs (Fig. S4c). At day 4 p.i., viral RNA levels with MNV-O7 as detected by RT-
qPCR were similar to MNV-1 levels. The MNV-O7mc stock grown in RAW264.7 cells was
also noncytopathic (data not shown).
Our data illustrate that full-length amplification of infectious MNV without growth in cell
culture is possible and can provide a method of characterizing non-cytopathic viruses. This
method of producing infectious virus limits the mutations that might be caused by tissue
culture passage and these are known to attenuate MNV-1 in Stat1
−/−
mice (Bailey et al.,
2008
; Wobus et al., 2004). There has also been concern expressed that experimental
infections showing persistence of MNV have only been carried out with virus grown in
tissue culture that may select for this trait (Hsu et al., 2007). These concerns have been
addressed here to show that a directly isolated virus was attenuated in Stat1-knockout mice
and caused persistent infections in immunocompetent mice. Production of a fulllength clone
by RT-PCR may also induce RT- and PCR polymerase-related mutations; however, these
can be minimized by the use of a proofreading PCR enzyme, as was used here.
Control of MNV is not dependent on STAT1 responses
MNV-1 was first identified because it caused mortality in Rag2
−/−
Stat1
−/−
mice and this was
shown to be due to the lack of STAT1. This finding implied an important role for STAT1-
mediated immune responses in the control of MNV infection in mice (
Karst et al., 2003).
Here, Stat1
−/−
and WT mice were infected with 10
8
RNA copies of MNV-1 and MNV-O7.
All virus-infected animals were positive for MNV RNA in the faeces at day 5 p.i. (Table 1).
The animals were observed daily for any clinical signs. There was a decrease in body weight
in Stat1
−/−
mice infected with MNV-1 compared with mock-infected Stat1
−/−
mice at days 6
and 7 p.i. (P<0.01, Fig. 2). This confirmed that MNV-1 infection was virulent in Stat1
−/−
mice. There was no difference in the weight gain between MNV-O7-infected Stat1
−/−
mice,
MNV-O7- and MNV-1-infected WT mice, and mock-inoculated mice on the same genetic
background. At day 5 p.i., Stat1
−/−
mice infected with MNV-1 showed a hunched posture,
piloerection, subdued behaviour, distended abdomens and reduced faecal output, and by day
7 p.i. these mice had been euthanized due to the clinical signs, as expected (Karst et al.,
2003
). In contrast, no clinical signs were observed in mock- or MNV-O7-infected Stat1
−/−
mice, nor in mock- or virus-infected WT mice. This supports the hypothesis that MNV
Shortland et al.
Page 5
J Gen Virol. Author manuscript; available in PMC 2015 January 29.
Europe PMC Funders Author Manuscripts Europe PMC Funders Author Manuscripts

Citations
More filters
Journal ArticleDOI
TL;DR: Although oral immunoglobulins and nitazoxanide have been used to treat noroviral infections associated with immunosuppression, ribavirin is the only agent to date that has been linked to viral clearance in the Noroviral enteropathy associated with CVID.
Abstract: Summary Chronic infection with norovirus is emerging as a significant risk for patients with immunodeficiency – either primary or secondary to therapeutic immunosuppression. Patients with primary immunodeficiency present a range of pathological responses to norovirus infection. Asymptomatic infections occur and differentiating viral carriage or prolonged viral shedding after self-limiting infection from infection causing protracted diarrhoea can be challenging, due to relatively mild pathological changes that may mimic other causes of diarrhoea in such patients (for instance pathogenic bacteria or parasites or graft-versus-host disease). However, a subset of patients with common variable immunodeficiency (CVID) experience a severe norovirus-associated enteropathy leading to intestinal villous atrophy and malabsorption. Symptomatic infection of up to 8 years has been demonstrated with clinical and histological recovery on viral clearance. Although oral immunoglobulins and nitazoxanide have been used to treat noroviral infections associated with immunosuppression, ribavirin is the only agent to date that has been linked to viral clearance in the Noroviral enteropathy associated with CVID.

62 citations


Cites background from "Pathology caused by persistent muri..."

  • ...organs such as spleen and liver may occur, possibly as a result of viraemia or via dendritic cells [23-25]....

    [...]

Journal ArticleDOI
TL;DR: It is shown that one of the most conspicuous impacts of activated IEL on IEC is the functional upregulation of antiviral interferon (IFN)-responsive genes, mediated by the collective actions of IFNs with other cytokines.
Abstract: Unrelenting environmental challenges to the gut epithelium place particular demands on the local immune system. In this context, intestinal intraepithelial lymphocytes (IEL) compose a large, highly conserved T cell compartment, hypothesized to provide a first line of defence via cytolysis of dysregulated intestinal epithelial cells (IEC) and cytokine-mediated re-growth of healthy IEC. Here we show that one of the most conspicuous impacts of activated IEL on IEC is the functional upregulation of antiviral interferon (IFN)-responsive genes, mediated by the collective actions of IFNs with other cytokines. Indeed, IEL activation in vivo rapidly provoked type I/III IFN receptor-dependent upregulation of IFN-responsive genes in the villus epithelium. Consistent with this, activated IEL mediators protected cells against virus infection in vitro, and pre-activation of IEL in vivo profoundly limited norovirus infection. Hence, intraepithelial T cell activation offers an overt means to promote the innate antiviral potential of the intestinal epithelium.

61 citations

Journal ArticleDOI
TL;DR: In the future, structure-based drug design and rational optimization of known nucleoside and non-nucleoside inhibitors of norovirus RdRp may pave the way towards the next generation of direct-acting antivirals.

46 citations


Cites background from "Pathology caused by persistent muri..."

  • ...Other strains of norovirus such as MNV-3, MNV R6, and MNV O7 have been shown to cause a persistent yet asympomatic infection in immunocompetent mice (Arias et al., 2012; su et al., 2006; Kahan et al., 2011; Shortland et al., 2014)....

    [...]

Journal ArticleDOI
TL;DR: The results indicate that caution is warranted in the interpretation of zebrafish behaviour, particularly since in most cases infection status is unknown, and highlights the importance of comprehensive monitoring procedures to detect sub-clinical infections in laboratory animals.
Abstract: Research conducted on model organisms may be biased due to undetected pathogen infections. Recently, screening studies discovered high prevalence of the microsporidium Pseudoloma neurophilia in zebrafish (Danio rerio) facilities. This spore-forming unicellular parasite aggregates in brain regions associated with motor function and anxiety, and despite its high occurrence little is known about how sub-clinical infection affects behaviour. Here, we assessed how P. neurophilia infection alters the zebrafish´s response to four commonly used neurobehavioral tests, namely: mirror biting, open field, light/dark preference and social preference, used to quantify aggression, exploration, anxiety, and sociability. Although sociability and aggression remained unaltered, infected hosts exhibited reduced activity, elevated rates of freezing behaviour, and sex-specific effects on exploration. These results indicate that caution is warranted in the interpretation of zebrafish behaviour, particularly since in most cases infection status is unknown. This highlights the importance of comprehensive monitoring procedures to detect sub-clinical infections in laboratory animals.

44 citations

Journal ArticleDOI
04 Aug 2021-Viruses
TL;DR: In this article, the authors provide an overview of notable advances in norovirus research and provide a short recap of the novel model systems to which much of the recent progress is owed.
Abstract: Human noroviruses are recognised as the major global cause of viral gastroenteritis. Here, we provide an overview of notable advances in norovirus research and provide a short recap of the novel model systems to which much of the recent progress is owed. Significant advances include an updated classification system, the description of alternative virus-like protein morphologies and capsid dynamics, and the further elucidation of the functions and roles of various viral proteins. Important milestones include new insights into cell tropism, host and microbial attachment factors and receptors, interactions with the cellular translational apparatus, and viral egress from cells. Noroviruses have been detected in previously unrecognised hosts and detection itself is facilitated by improved analytical techniques. New potential transmission routes and/or viral reservoirs have been proposed. Recent in vivo and in vitro findings have added to the understanding of host immunity in response to norovirus infection, and vaccine development has progressed to preclinical and even clinical trial testing. Ongoing development of therapeutics includes promising direct-acting small molecules and host-factor drugs.

25 citations

References
More filters
Journal ArticleDOI
TL;DR: A new algorithm to search the tree space with user-defined intensity using subtree pruning and regrafting topological moves and a new test to assess the support of the data for internal branches of a phylogeny are introduced.
Abstract: PhyML is a phylogeny software based on the maximum-likelihood principle. Early PhyML versions used a fast algorithm performing nearest neighbor interchanges to improve a reasonable starting tree topology. Since the original publication (Guindon S., Gascuel O. 2003. A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696-704), PhyML has been widely used (>2500 citations in ISI Web of Science) because of its simplicity and a fair compromise between accuracy and speed. In the meantime, research around PhyML has continued, and this article describes the new algorithms and methods implemented in the program. First, we introduce a new algorithm to search the tree space with user-defined intensity using subtree pruning and regrafting topological moves. The parsimony criterion is used here to filter out the least promising topology modifications with respect to the likelihood function. The analysis of a large collection of real nucleotide and amino acid data sets of various sizes demonstrates the good performance of this method. Second, we describe a new test to assess the support of the data for internal branches of a phylogeny. This approach extends the recently proposed approximate likelihood-ratio test and relies on a nonparametric, Shimodaira-Hasegawa-like procedure. A detailed analysis of real alignments sheds light on the links between this new approach and the more classical nonparametric bootstrap method. Overall, our tests show that the last version (3.0) of PhyML is fast, accurate, stable, and ready to use. A Web server and binary files are available from http://www.atgc-montpellier.fr/phyml/.

14,385 citations


"Pathology caused by persistent muri..." refers methods in this paper

  • ...New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0....

    [...]

  • ...A PhyML (Guindon et al., 2010) phylogenetic tree was constructed using SeaView software with 100 bootstrap repetitions (http://pbil....

    [...]

  • ...(a) Full-length genomic MNV nucleotide sequences were used to construct a maximumlikelihood phylogenetic tree with PhyML and 100 bootstrap interactions....

    [...]

  • ...A PhyML (Guindon et al., 2010) phylogenetic tree was constructed using SeaView software with 100 bootstrap repetitions (http://pbil.univ-lyon1.fr/software/ seaview.html; Gouy et al., 2010)....

    [...]

Journal ArticleDOI
TL;DR: SeaView version 4 combines all the functions of the widely used programs SeaView and Phylo_win, and expands them by adding network access to sequence databases, alignment with arbitrary algorithm, maximum-likelihood tree building with PhyML, and display, printing, and copy-to-clipboard of rooted or unrooted, binary or multifurcating phylogenetic trees.
Abstract: We present SeaView version 4, a multiplatform program designed to facilitate multiple alignment and phylogenetic tree building from molecular sequence data through the use of a graphical user interface. SeaView version 4 combines all the functions of the widely used programs SeaView (in its previous versions) and Phylo_win, and expands them by adding network access to sequence databases, alignment with arbitrary algorithm, maximum-likelihood tree building with PhyML, and display, printing, and copy-to-clipboard of rooted or unrooted, binary or multifurcating phylogenetic trees. In relation to the wide present offer of tools and algorithms for phylogenetic analyses, SeaView is especially useful for teaching and for occasional users of such software. SeaView is freely available at http://pbil.univ-lyon1.fr/software/seaview.

5,074 citations


"Pathology caused by persistent muri..." refers methods in this paper

  • ..., 2010) phylogenetic tree was constructed using SeaView software with 100 bootstrap repetitions (http://pbil.univ-lyon1.fr/software/seaview.html; Gouy et al., 2010)....

    [...]

  • ...A PhyML (Guindon et al., 2010) phylogenetic tree was constructed using SeaView software with 100 bootstrap repetitions (http://pbil.univ-lyon1.fr/software/ seaview.html; Gouy et al., 2010)....

    [...]

Journal ArticleDOI
TL;DR: In this paper, the authors provide protocols for establishing murine 2,4,6-trinitro benzene sulfonic acid (TNBS)-, oxazolone- and both acute and chronic dextran sodium sulfate (DSS) colitis, the most widely used chemically induced models of intestinal inflammation.
Abstract: Animal models of intestinal inflammation are indispensable for our understanding of the pathogenesis of Crohn disease and ulcerative colitis, the two major forms of inflammatory bowel disease in humans. Here, we provide protocols for establishing murine 2,4,6-trinitro benzene sulfonic acid (TNBS)-, oxazolone- and both acute and chronic dextran sodium sulfate (DSS) colitis, the most widely used chemically induced models of intestinal inflammation. In the former two models, colitis is induced by intrarectal administration of the covalently reactive reagents TNBS/oxazolone, which are believed to induce a T-cell-mediated response against hapten-modified autologous proteins/luminal antigens. In the DSS model, mice are subjected several days to drinking water supplemented with DSS, which seems to be directly toxic to colonic epithelial cells of the basal crypts. The procedures for the hapten models of colitis and acute DSS colitis can be accomplished in about 2 weeks but the protocol for chronic DSS colitis takes about 2 months.

1,386 citations


"Pathology caused by persistent muri..." refers methods in this paper

  • ...The tissues were graded for the degree of inflammation, fibrosis and necrosis using a modification of published grading systems (Hübscher, 1998; Theise, 2007; Wirtz et al., 2007) (Table S1, 10 fields per section were scored)....

    [...]

Journal ArticleDOI
TL;DR: The capacity of MNV-1 to replicate in a STAT-1-regulated fashion and the unexpected tropism of a norovirus for cells of the hematopoietic lineage provide important insights into Norovirus biology.
Abstract: Noroviruses are understudied because these important enteric pathogens have not been cultured to date. We found that the norovirus murine norovirus 1 (MNV-1) infects macrophage-like cells in vivo and replicates in cultured primary dendritic cells and macrophages. MNV-1 growth was inhibited by the interferon-alphabeta receptor and STAT-1, and was associated with extensive rearrangements of intracellular membranes. An amino acid substitution in the capsid protein of serially passaged MNV-1 was associated with virulence attenuation in vivo. This is the first report of replication of a norovirus in cell culture. The capacity of MNV-1 to replicate in a STAT-1-regulated fashion and the unexpected tropism of a norovirus for cells of the hematopoietic lineage provide important insights into norovirus biology.

809 citations


"Pathology caused by persistent muri..." refers background or methods in this paper

  • ...MNV replicates in macrophages and dendritic cells and, like many viruses that infect antigen-presenting cells, may also impair the activation of T-cells (Tomov et al., 2013) and B-cells (Oldstone, 2006; Wobus et al., 2004)....

    [...]

  • ...This method of producing infectious virus limits the mutations that might be caused by tissue culture passage and these are known to attenuate MNV-1 in Stat1−/− mice (Bailey et al., 2008; Wobus et al., 2004)....

    [...]

  • ...However, all mice were healthy and the high morbidity or mortality seen previously in Stat1−/− mice (Karst et al., 2003; Wobus et al., 2004) was not evident....

    [...]

  • ...This method of producing infectious virus limits the mutations that might be caused by tissue culture passage and these are known to attenuate MNV-1 in Stat1 mice (Bailey et al., 2008; Wobus et al., 2004)....

    [...]

  • ...However, all mice were healthy and the high morbidity or mortality seen previously in Stat1 mice (Karst et al., 2003; Wobus et al., 2004) was not evident....

    [...]

Journal ArticleDOI
07 Mar 2003-Science
TL;DR: Analysis of Murine Norovirus 1 infection revealed that signal transducer and activator of transcription 1–dependent innate immunity, but not T and B cell–dependent adaptive immunity, is essential for norovirus resistance.
Abstract: Norwalk-like caliciviruses (Noroviruses) cause over 90% of nonbacterial epidemic gastroenteritis worldwide, but the pathogenesis of norovirus infection is poorly understood because these viruses do not grow in cultured cells and there is no small animal model. Here, we report a previously unknown murine norovirus. Analysis of Murine Norovirus 1 infection revealed that signal transducer and activator of transcription 1-dependent innate immunity, but not T and B cell-dependent adaptive immunity, is essential for norovirus resistance. The identification of host molecules essential for murine norovirus resistance may provide targets for prevention or control of an important human disease.

762 citations


"Pathology caused by persistent muri..." refers background or result in this paper

  • ...…AND DISCUSSION Natural MNV-O7 infection is subclinical in Stat1−/− mice MNV was first described as an acute infection with mortality and morbidity apparent in Stat1−/− mice, persistent subclinical infection in Rag−/− mice, and acute subclinical infection in WT mice (Karst et al., 2003)....

    [...]

  • ...these mice had been euthanized due to the clinical signs, as expected (Karst et al., 2003)....

    [...]

  • ...This finding implied an important role for STAT1-mediated immune responses in the control of MNV infection in mice (Karst et al., 2003)....

    [...]

  • ...All the WT mice infected with MNV-1 had cleared virus from faeces and tissues by day 54 p.i. (Table 1), which is in agreement with previous studies (Hsu et al., 2006; Karst et al., 2003)....

    [...]

  • ...This finding implied an important role for STAT1mediated immune responses in the control of MNV infection in mice (Karst et al., 2003)....

    [...]

Frequently Asked Questions (1)
Q1. What are the contributions mentioned in the paper "Pathology caused by persistent murine norovirus infection" ?

In this paper, a subclinical infection of murine norovirus ( MNV ) was detected in a mixed breeding group of WT and Stat1−/− mice with no outward evidence of morbidity or mortality.