PCR-RFLP analysis of fliC, fimH and 16S rRNA genes in Salmonella Typhimurium isolates of varied origin
Citations
9 citations
Cites background or methods or result from "PCR-RFLP analysis of fliC, fimH and..."
...…16S rRNA gene 572 55 Lin and Tsen 1996 16S RNARa CAC AAATCCATC TCT GGA fliCFb AAGGAATTCATCATGGCACAAG fliC 1488 55 Perera and Murray 2008; Sumithra et al. 2014fliCRb GAAGAATTCAACGCAGTAAA GAGAG fliBFc GGCAACCCGACAGTAACTGG CGATC fljB 135 47 fliBRc ATCAACGGTAACTTCATATTTG INVA-1d…...
[...]
...This is an indication that these isolates could have originated from a common ancestral strain, and similar observations have previously been reported (Jin et al. 2011; Sumithra et al. 2014)....
[...]
...In addition, flagellin gene fragments, fliC (1488 bp) and fljB (135 bp), were also amplified using standard protocols (Perera andMurray 2008; Sumithra et al. 2014....
[...]
...Considering the fact that the 16S rRNA gene segment is highly conserved in bacterial isolates, including Salmonella species, it is routinely used for sequence analysis-based identification (Sumithra et al. 2014)....
[...]
...Restriction enzymes EcoRV and HaeIII supplied by New England Biolabs, UK, were used in the analysis for RFLP (Dauga et al. 1998; Sumithra et al. 2014) according to the manufacturer’s instructions....
[...]
2 citations
Cites methods from "PCR-RFLP analysis of fliC, fimH and..."
...[45] used RFLP to analyse the typing and according to their results, PCR-RFLP was used with four endonucleases which digested 16S rRNA, fliC and fimH genes....
[...]
2 citations
Cites methods or result from "PCR-RFLP analysis of fliC, fimH and..."
...According to the results based on Matsui et al (2001) and Sumithra et al (2013) research showed that PCR-RFLP with more than one endonuclease and genes give good typeability and increase the differentiating power....
[...]
...Sumithra et al (2013) used RFLP to analysis of typing, heterogeneity, typeability and polymorphism of the 16S rRNA, fliC and fimH genes in Salmonella typhimurium isolates from different origin....
[...]
References
2,982 citations
"PCR-RFLP analysis of fliC, fimH and..." refers methods in this paper
...The numerical index of discrimination (D) of restriction enzymes which can result in discrimination among Salmonella Typhimurium isolates was calculated using Simpson’s index of diversity (Hunter and Gaston 1988)....
[...]
1,992 citations
546 citations
"PCR-RFLP analysis of fliC, fimH and..." refers methods in this paper
...Isolation of genomic DNA Genomic DNA of all isolates was isolated using the CTAB method (Wilson 1987)....
[...]
...After characterization, a glycerol stock was made of each culture which was kept at −20 °C. Isolation of genomic DNA Genomic DNA of all isolates was isolated using the CTAB method (Wilson 1987)....
[...]
377 citations
271 citations
"PCR-RFLP analysis of fliC, fimH and..." refers background in this paper
...The most common of the total of 2,668 Salmonella enterica serovars (Popoff et al. 2004) is Salmonella Typhimurium (Rahman 2002), and the number of Typhimurium infections in human and animals are dramatically increasing (Mikasova et al. 2005)....
[...]