scispace - formally typeset

Journal ArticleDOI

Stage of perinatal development regulates skeletal muscle mitochondrial biogenesis and myogenic regulatory factor genes with little impact of growth restriction or cross-fostering.

01 Feb 2012-Journal of Developmental Origins of Health and Disease (Cambridge University Press)-Vol. 3, Iss: 1, pp 39-51

TL;DR: It appears that reductions in adult mitochondrial biogenesis markers likely develop after weaning, as developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes, with growth restriction and cross-fostering having only subtle effects.
Abstract: Foetal growth restriction impairs skeletal muscle development and adult muscle mitochondrial biogenesis. We hypothesized that key genes involved in muscle development and mitochondrial biogenesis would be altered following uteroplacental insufficiency in rat pups, and improving postnatal nutrition by cross-fostering would ameliorate these deficits. Bilateral uterine vessel ligation (Restricted) or sham (Control) surgery was performed on day 18 of gestation. Males and females were investigated at day 20 of gestation (E20), 1 (PN1), 7 (PN7) and 35 (PN35) days postnatally. A separate cohort of Control and Restricted pups were cross-fostered onto a different Control or Restricted mother and examined at PN7. In both sexes, peroxisome proliferator-activated receptor (PPAR)-γ coactivator-1α (PGC-1α), cytochrome c oxidase subunits 3 and 4 (COX III and IV) and myogenic regulatory factor 4 expression increased from late gestation to postnatal life, whereas mitochondrial transcription factor A, myogenic differentiation 1 (MyoD), myogenin and insulin-like growth factor I (IGF-I) decreased. Foetal growth restriction increased MyoD mRNA in females at PN7, whereas in males IGF-I mRNA was higher at E20 and PN1. Cross-fostering Restricted pups onto a Control mother significantly increased COX III mRNA in males and COX IV mRNA in both sexes above controls with little effect on other genes. Developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes, with growth restriction and cross-fostering having only subtle effects. It therefore appears that reductions in adult mitochondrial biogenesis markers likely develop after weaning.
Topics: Mitochondrial biogenesis (61%), MyoD (60%), Myogenin (55%), Skeletal muscle (54%), TFAM (50%)

Content maybe subject to copyright    Report

Deakin Research Online
This is the published version:
Laker, R. C., Wadley, G. D., McConell, G. K. and Wlodek, M. E. 2012, Stage of perinatal
development regulates skeletal muscle mitochondrial biogenesis and myogenic regulatory
factor genes with little impact of growth restriction or cross-fostering, Journal of
development origins of health and disease, vol. 3, no. 1, pp. 39-51
Available from Deakin Research Online:
http://hdl.handle.net/10536/DRO/DU:30046181
Reproduced with the kind permission of the copyright owner.
Copyright : 2011, Cambridge University Press and the International Society for
Developmental Origins of Health and Disease

Journal of Developmental Origins of Health and Disease (2012), 3(1), 39–51.
& Cambridge University Press and the International Society for Developmental Origins of Health and Disease 2011
doi:10.1017/S204017441100064X
ORIGINAL ARTICLE
Stage of perinatal development regulates skeletal
muscle mitochondrial biogenesis and myogenic
regulatory factor genes with little impact of growth
restriction or cross-fostering
R. C. Laker
1
, G. D. Wadley
1,2
, G. K. McConell
1,3
and M. E. Wlodek
1
*
1
Department of Physiology, The University of Melbourne, Parkville, Victoria, Australia
2
Centre for Physical Activity and Nutrition Research, School of Exercise and Nutrition Sciences, Deakin University, Burwood,
Victoria, Australia
3
Institute of Sport, Exercise and Active Living and the School of Biomedical and Health Sciences, Victoria University, Victoria, Australia
Foetal growth restriction impairs skeletal muscle development and adult muscle mitochondrial biogenesis. We hypothesized that key genes
involved in muscle development and mitochondrial biogenesis would be altered following uteroplacental insufficiency in rat pups, and
improving postnatal nutrition by cross-fostering would ameliorate these deficits. Bilateral uterine vessel ligation (Restricted) or sham (Control)
surgery was performed on day 18 of gestation. Males and females were investigated at day 20 of gestation (E20), 1 (PN1), 7 (PN7) and 35
(PN35) days postnatally. A separate cohort of Control and Restricted pups were cross-fostered onto a different Control or Restricted mother and
examined at PN7. In both sexes, peroxisome proliferator-activated receptor (PPAR)-g coactivator-1a (PGC-1a), cytochrome c oxidase
subunits 3 and 4 (COX III and IV) and myogenic regulatory factor 4 expression increased from late gestation to postnatal life, whereas
mitochondrial transcription factor A, myogenic differentiation 1 (MyoD), myogenin and insulin-like growth factor I (IGF-I) decreased. Foetal
growth restriction increased MyoD mRNA in females at PN7, whereas in males IGF-I mRNA was higher at E20 and PN1. Cross-fostering
Restricted pups onto a Control mother significantly increased COX III mRNA in males and COX IV mRNA in both sexes above controls with
little effect on other genes. Developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes,
with growth restriction and cross-fostering having only subtle effects. It therefore appears that reductions in adult mitochondrial biogenesis
markers likely develop after weaning.
Received 20 March 2011; Revised 25 August 2011; Accepted 30 September 2011; First published online 10 November 2011
Key words: gene expression, growth, growth restriction, skeletal muscle
Introduction
Being born small for gestational age significantly increases the
risk of developing insulin resistance and type 2 diabetes later in
life.
1–4
Skeletal muscle insulin resistance has been associated with
impaired skeletal muscle mitochondrial biogenesis (synthesis of
new mitochondria) and metabolism.
5–7
Mitochondria are the
primary controllers of cellular energy metabolism and impair-
ments in skeletal muscle mitochondrial content and function
havebeenshowninadultratsbornsmall.
8,9
Our laboratory has
shown that foetal growth restriction reduces gene and protein
markers of skeletal muscle mitochondrial biogenesis [e.g. per-
oxisome proliferator-activ ated receptor (PPAR)-g coactivator-1a
(PGC-1a), mitochondrial transcription factor A (Tfam), cyto-
chrome c oxidase subunits 3 and 4 (COX III and IV)] in
6-month-old adult rats, with males more affected than females.
8
This potential impairment in skeletal muscle metabolism may
provide an important mechanistic link to skeletal muscle insul in
resistance
5–7
associated with being born small.
The developmental time course for the reduction in mar-
kers of skeletal muscle mitochondrial biogenesis following
uteroplacental insufficiency is unclear. One study reported
that the master regulator of mitochondrial biogenesis, PGC-
1a, mRNA was downregulated in the slow twitch soleus
muscle but upregulated in the fast twitch extensor digitorum
longus muscle of small birth weight offspring at 21 days of
age, with males more affected than females.
10
It is important
to consider that the control group used in these studies had
their litter size reduced at birth,
10,11
previously shown to alter
postnatal growth and impair skeletal muscle markers of
mitochondrial biogenesis at 6 months of age
8
and therefore
impacts on the interpretation of these findings. Conse-
quently, the impact of foetal growth restriction on markers of
skeletal muscle mitochon drial biogenesis and the develop-
mental time course in early life remains unclear.
Low birth weight in humans has also been associated with
reduced muscle mass and strength that persists from child-
hood
12–15
through to adult life.
16–18
Evidence suggests that
*Author for correspondence: Prof M. E. Wlodek, Department of
Physiology, The University of Melbourne, Parkville, Victoria 3010, Australia.
(Email m.wlodek@unimelb.edu.au)

the struct ural and functional development of muscles and
muscle fibres is altered in babies born small
18–23
and this is
likely to play an important role in the programming of adult
disease. Animal studies show that foetal undernutrition is asso-
ciated with reduced postnatal muscle weight and myofibre
density,
20,21,24
along with impaired morphological and con-
tractile characteristics
22,23
that may persist into adulthood.
25
In
the rat, skeletal muscle develops during mid-to-late gestation and
continues to grow some months postnatally.
26–28
During gesta-
tion, skeletal muscle development coincides with the expres sion
of myogenic regulatory factors (MRFs), which are temporally
expressed throughout perinatal development and control an array
of regulatory and structural genes.
29–32
Myogenic differentiation
1 (MyoD), myogenin and MRF4 are involved in skeletal muscle
proliferation and differentiation with expression detected from
mid-to-late gestation.
27,33–35
In the r at, myogenesis continues for
up to 2 weeks postnatally after which skeletal muscle hyper-
trophy persists. Insulin-like growth factor I (IGF-I) plays a well-
defined role in skeletal muscle hypertrophy,
36–38
but evidence
also implicates IGF-I in skeletal muscle proliferation and dif-
ferentiation.
39
Owing to the temporal pattern of MRF expres-
sion, the timing of an insult may be an important determinant of
the muscle’s phenotypic profile. An insult, during gestation or
after birth, may alter the expression of these myogenic regulatory
andgrowthfactorsandmayimpactonlaterskeletalmusclemass
and function.
Our laboratory has shown that uteroplacental insufficiency
in pregnant rats not only impairs the growth of the foetus but
also impairs maternal mammary development resulting in
poor lactation,
40
further compromising the growth of the
offspring after birth.
41
In low birth weight humans, improved
growth between birth and 2 y ears has been shown to reduce the
risk of developing adult metabolic disease.
4,42–44
Indeed, Siebel
et al. have shown that improved postnatal nutrition by cross-
fostering growth-restricted pups onto a control mother with
normal lactation, improved early postnatal growth and amelio-
rated the impaired glucose tolerance
45
and pancreatic b-cell
mass
46
observed at 6 months of age. Furthermore, at 7 days of
age, restricted pups fostered onto a control mother showed
upregulation of key pancreatic genes important for b-cell growth
and maintenance.
46
These results highlight the potential for early
life interventions that may lessen the adverse consequences of
being born small.
Therefore, Study 1 determined the impact of uteroplacenta l
insufficiency on gene expression of skeletal muscle markers of
mitochondrial biogenesis and myogenic regulatory and growth
factors in late gestation and during postnatal life. Study 2
determined whether improved lactation after birth by cross-
fostering could ameliorate any adverse consequences of uter-
oplacental insufficiency on skeletal muscle gene expression in
early life. Finally, due to multiple and significant gender differ-
ences in metabolic disease outcomes in response to impaired
foetal growth reported previously by ourselves
8,45
and others,
47–49
we determined the impact of uteroplacental insufficiency and
cross-fostering in males and females separately. On the basis of
our and others findings in adulthood, we hypothesized that key
genes involved in skeletal muscle development and mitochondrial
biogenesis would be altered following intrauterine growth
restriction in rats, with different developmental profiles between
males and females.
Methods
Animals
All procedures were approved by The University of Melbourne
Animal Experimentation Sub-Committee. In both studies,
Wistar Kyoto rats (aged 11 weeks) were obtained from the
Australian Resource Centre (Murdoch, WA, Australia) and
house with a 12-h light dark cycle with access to water and
normal chow ad libitum. On day 18 of gestation (term 22 days),
pregnant rats were anesthetized by intraperitoneal injection
of ketamine (225 mg/kg) and Ilium Xylazil-20 (30 mg/kg).
Bilateral uterine vessel ligation of both the artery and vein
supplying each uterine horn was performed to induce late
gestation uteroplacental insuf ficiency (Restricted) or sham
surgery was performed to generate the Control group.
50,51
Study 1: developmental timeline study
At day 20 of gestation (E20), mothers that underwent either
bilateral uterine vessel ligation or sham surgery were anes-
thetized by intraperitoneal injection of ketamine (225 mg/kg)
and Ilium Xylazil-20 (30 mg/kg) and the uterus exposed. In
Restricted litters at E20, the ligation integrity was confirmed.
Foetuses at E20 or pups at postnatal day 1 (PN1) and 7 (PN7)
were weighed, killed by decapitation and hindlimb skeletal
muscle rapidly excised, pooled within litters and separated by sex
(n 5 8–10 litters/group). Skeletal muscle was not weighed at
ages E20, PN1 or PN7 due to potential inaccuracies in dissec-
tion of the muscle in the small animals. Because of the increased
body mass at postnatal day 35 (PN35) individual male and
female offspring were anesthetized by intraperitoneal injection of
ketamine (225 mg/kg) and Ilium Xylazil-20 (30 mg/kg) and the
gastrocnemius muscle rapidly excised and weighed (n 5 8–10
offspring/group). The gastrocnemius muscle was examined at
PN35 as it is the largest muscle of the lower hindlimb and is also
a mixed fibre muscle making it an appropriate hindlimb muscle
for comparing to mixed hindlimb muscle collected at earlier
ages. All samples collected were immediately frozen in liquid
nitrogenandstoredat2808C.
Study 2: cross-fostering study
In a separate cohort of offspring exposed to uteroplacental
insufficiency or sham surgery, Restricted or Control pups were
cross-fostered 1 day after birth onto either a mother who had
undergone bilateral uterine vessel ligation or a sham-operated
Control mother to yield four treatment groups. Control pups
fostered onto a Control mother (Cont-on-Cont ), Control pups
40 R. C. Laker et al.

on Restricted mother (Cont-on-Rest), Restricted pups on Control
mother (Rest-on-Cont)andRestricted pups on Restricted mother
(Rest -on-Res t).
46
To determine the early effects of foetal growth
restriction and cross-fostering before the majority of proliferation
and differentiation was complete, hindlimb skeletal muscle was
collected at PN7 as described above (n 5 7–10 litters/group).
Analysis for studies 1 and 2: real-time poly merase
chain reaction (PCR) analysis
For the Developmental Timeline Study, total RNA was extracted
from skeletal muscle using the Tri-Reagent (Ambion Inc.,
Austin,TX,USA)methodduetothesmallamountsofpooled
tissue obtained from pups at E20 and PN1. RNA was extracted
from skeletal muscle of the Cross-foster Study using the Invitro-
gen micro–to-midi RNA extraction kits (Invitrogen, Carlsbad,
CA, USA). RNA yield was measured using the NanoDrop
TM
1000 Spectrophotometer (NanoDrop Technologies, Wilming-
ton, DE, USA) at 260 nm absorbance. Integrity was confirmed
from the 260/280 nm ratio and random samples were also
selected for gel electrophoresis with high levels of 18S and 28S
detected.
First-strand cDNA was synthesized from 1 mg of RNA
using superscript III first-strand system (Invitrogen). Primer
and Taqman
R
probe sequences for PGC-1a, Tfam, COX
III, COX IV, myogenin, MyoD, MRF4, IGF-I, b-actin and
18S are presented in Table 1. Depending on probe availability,
real-time PCR using either SYBR green
8
or TaqMan
R
52
chemistry was performed, as described previously, using the
sequence detector software (Rotor-gene v6, Corbett Research,
Sydney, NSW, Australia). Samples from each age within an
experimental group were amplified on the same run to eliminate
inter-assay variability, whereas a positive control sample was used
as a reference to make inter-assay comparisons within an age
group. In cases when SYBR green chemistry (Tfam, COX III
and COX IV) was utilized, samples were subjected to a heat
dissociation protocol following the final amplification cycle to
ensure that only a single product was detected. Relative gene
expression was quantified using the comparative C
t
(DDC
t
)
method.
8,46
18S was used as the endogenous control for the
Developmental Timeline Study (Study 1) as it was stably
expressed across age groups, whereas b-actin was used for the
Cross-foster Study (Study 2) due to stable expression between
treatment groups at that age.
Studies 1 and 2: statistical analysis
At each age, body weight and dimensions were analysed by a
two-way ANOVA for sex and treatment. For the Develop-
mental Timeline Study, gene expression data were analysed
separately for sex using a two-way ANOVA for age and
treatment. If a statistically significant interaction was
observed, data were then split and analysed by one-way
ANOVA with Du ncan’s post hoc test where appropriate. For
the Cross-foster Study, gene expression data were analysed
Table 1. Primer and probe sequences used for genes quantified using real-time PCR relative to 18S or b-actin and GenBank accession numbers
Gene Forward 5
0
–3
0
Reverse 5
0
–3
0
Probe 5
0
–3
0
GenBank accession
PGC-1a CGTAGGCCCAGGTATGACA GCGGTATTCGTCCCTCTTCA ATGAAGCCAATGAGCACGAAAGGC NM_031347
Tfam AGCCATGTGGAGGGAGCTT TTGTACACCTTCCACTCAGCTTTAA N/A NM_031326
COX III GACGGAATTTACGGCTCAACAT AATTAGGAAAGTTGAGCCAATAATTACG N/A AF504920
COX IV GTGCTGATCTGGGAGAAGAGCTA GGTTGACCTTCATGTCCAGCAT N/A NM_017202
Myogenin GAAGCGCAGGCTCAAGAAAG GCGCAGGATCTCCACCTTAG TGAATGAGGCCTTCGAGGCTCTG NM_017115
MyoD CAGCGGCTACCCAAGGTG AGAGCCTGCAGACCTTCAATGTAG AGATCCTGCGCAACGCCATCCG NM_176079
MRF4 TGAGGGTGCGGATTTCCT GCTTGCTCCTCCTTCCTTAGC CAGCCCGCAGTGGCCAAGTG M27151
IGF-I CCAGCGCCACACTGACATG GGGAGGCTCCTCCTACATTC CCCAAGACTCAGAAGGAAGTACACTTGA X_06043
b-Actin ACCCAGATCATGTTTGAGACCTTCA AGAGGCATACAGGGACAACACA CCCAGCCATGTACGTAGCCATCC NM_031144
18S GCATGGCCGTTCTTAGTTGG TGCCAGAGTCTCGTTCGTTA TGGAGCGATTTGTCTGGTTAATTCCGA V01270.1
PGC-1a, peroxisome proliferator-activated receptor (PPAR)-g coactivator-1a; Tfam, mitochondrial transcription factor A; COX III and IV, cytochrome c oxidase subunits 3 and 4;
MyoD, myogenic differentiation 1; MRF4, myogenic regulatory factor 4; IGF-1, insulin-like growth factor 1.
Growth restriction and muscle development 41

separately for sex using a one-way ANOVA for treatment.
All data are presented as the mean 6
S.E.M. The level of
significance was set at P , 0.05.
Results
Study 1: developmental timeline study
Body weight, dimensions and litter size
Litter size was reduced by uteroplacental insufficiency during
gestation at E20 (8.1 6 0.7 v. 10.5 6 0.9; P 5 0.05) and after
birth at PN1 (5.2 6 0.6 v. 8.2 6 0.5; P , 0.05). Restricted
offspring were lighter (P , 0.05) with shorter crown-rump
length (P , 0.05) than Control at all ages in males and at E20,
PN1andPN7infemales(Table2).Hindlimblengthwas
shorter in Restricted malesatE20andinbothsexesatPN7
(Table2).HeadlengthwasshorterinRestricted at PN1 and
head width was shorted in Restricted at PN7 compared with
Controls in both sexes (Table 2). Foetal growth restriction
reduced PN35 absolute gastrocnemius weight in males
(0.26 6 0.01 g v. 0.20 6 0.01 g; P , 0.05), but not in females
(0.20 6 0.02 g v. 0.21 6 0.02 g). Relative (to body weight)
gastrocnemius weight was unaffected by foetal growth restric-
tion in both males (0.34 6 0.02 g v. 0.32 6 0.01 g) and females
(0.31 6 0.02 g v. 0.32 6 0.03 g).
Skeletal muscle gene expression
Skeletal muscle mitochondrial biogenesis markers
Uteroplacental insufficiency had no impact on skeletal muscle
gene expression of mitochondrial biogenesis markers regard-
less of sex (Fig. 1). In both males and females, PGC-1a
mRNA was lowest at E20 (P , 0.05) and showed increasing
(P , 0.05) expression such that by PN35 was more than
four-fold higher (P , 0.05) than E20 (Fig. 1a and 1e). In
females, Tfam mRNA was similar between E20 and PN1 and
peaked (P ,
0.05) at PN7 (Fig. 1f). In males, Tfam mRNA
was similar at E20, PN1 and PN7 and decreased (P , 0.05)
only at PN35 (Fig. 1b). COX III mRNA levels were similar at
E20, PN1 and PN7 and increased (P , 0.05) substantially by
PN35 in both males and females (Fig. 1c and 1g). Finally,
COX IV mRNA in males and females was similar at E20 and
PN1 and progressively increased such that it was highest
(P , 0.05) at PN35 (Fig. 1d and 1h).
Myogenic regulatory and growth factors
In both males and females, MyoD and myogenin mRNA pro-
gressively decreased such that it was highest at E20 (P , 0.05)
and lowest (P , 0.05) at PN35 (Fig. 2a, 2b, 2e and 2f, respec-
tively). Uteroplacental insufficiency had no impact on MyoD
and myogenin mRNA in either sex (Fig. 2a, 2e, 2b and 2f,
respectively) except in females at PN7, MyoD mRNA was
, 40% higher (Fig. 2e; P , 0.05). MRF4 mRNA was lowest
(P, 0.05) at E20 and progressively increased (P , 0.05) to
Table 2. Effect of uteroplacental insufficiency on body weight and dimensions in males and females at E20, PN1, PN7 and PN35
E20 PN1 PN7 PN35
Cont Rest Cont Rest Cont Rest Cont Rest
Males
Body weight (g) 1.82 6 0.06 1.53 6 0.15* 4.28 6 0.09 3.44 6 0.14* 10.33 6 0.27 6.95 6 0.50* 76.05 6 3.04 62.72 6 3.66*
Crown rump (mm) 27.13 6 0.43 25.11 6 2.22* 35.29 6 0.41 32.51 6 0.54* 48.92 6 0.77 42.41 6 0.68* 103.78 6 1.66 95.03 6 1.98*
Hindlimb length (mm) 6.40 6 0.11 5.96 6 0.54* 9.45 6 0.08 9.37 6 0.25 14.66 6 0.28 12.54 6 0.46* 34.44 6 0.71 32.52 6 0.46
Head length (mm) 9.78 6 0.11 10.79 6 1.67 12.99 6 0.25 11.78 6 0.35* 17.61 6 0.36 16.95 6 0.51 32.99 6 0.40 31.81 6 0.50
Head width (mm) 6.54 6 0.08 6.55 6 0.68 8.89 6 0.13 8.59 6 0.14 12.28 6 0.09 11.11 6 0.29* 19.58 6 0.19 18.53 6 0.46
Females
Body weight (g) 1.71 6 0.03 1.48 6 0.05* 4.04 6 0.06 3.53 6 0.16* 9.41 6 0.22 6.84 6
0.40* 65.91 6 2.73 64.06 6 3.42
Crown rump (mm) 26.40 6 0.34 25.13 6 0.58 34.84 6 0.21 31.97 6 0.62* 47.55 6 0.79 41.73 6 1.01* 97.89 6 2.19 98.62 6 3.0
Hind limb length (mm) 6.38 6 0.07 6.02 6 0.15 9.50 6 0.11 9.40 6 0.13 14.23 6 0.22 12.78 6 0.29* 32.99 6 0.51 32.60 6 1.07
Head length (mm) 9.60 6 0.09 10.72 6 1.35 13.13 6 0.17 11.98 6 0.28* 17.57 6 0.37 17.02 6 0.33 32.19 6 0.48 31.75 6 0.33
Head width (mm) 6.49 6 0.12 6.48 6 0.33 9.00 6 0.14 8.74 6 0.21 12.03 6 0.11 11.11 6 0.17* 18.89 6 0.24 19.52 6 0.27
E20, day 20 of gestation; PN1, postnatal day 1; PN7; postnatal day 7; PN35, postnatal day 35; Cont, Control; Rest, Restricted.
*Denotes significantly (P , 0.05) different from Cont within that age.
Body weight, crown-rump length, hindlimb length, head length and head width measured for male and female offspring. Data are expressed as mean 6
S.E.M.(n 5 8–10/group).
42 R. C. Laker et al.

Figures (5)
Citations
More filters

Journal ArticleDOI
Arin K. Oestreich1, Kelle H. Moley1Institutions (1)
TL;DR: In this review, several studies are highlighted that have revealed the role of epigenetics in multigenerational transmission of developmentally programmed obesity and associated cardiometabolic disease.
Abstract: The current global obesity pandemic is clearly linked to both the increasing prevalence of, and preference for, foods high in calories, specifically fat and sucrose, and declining levels of daily physical activity. A less commonly discussed possible explanation is that risk of obesity begins in utero as a result of developmental plasticity during early life. This idea fits into the broader Developmental Origins of Health and Diseases (DOHAD) hypothesis, which holds that stressful in utero exposure manifests as disease in adulthood. In this review, we highlight several studies that have revealed the role of epigenetics in multigenerational transmission of developmentally programmed obesity and associated cardiometabolic disease.

31 citations


Journal ArticleDOI
TL;DR: It is demonstrated that mitochondrial biogenesis was impaired in limb-girdle muscular dystrophy (LGMD) 2D patients and mice and was associated with impaired OxPhos capacity and could be recovered by TSA changing chromatin conformation, or it could be overcome by NO activating a mitochondrial salvage pathway.
Abstract: Mitochondrial dysfunction occurs in many muscle degenerative disorders. Here, we demonstrate that mitochondrial biogenesis was impaired in limb-girdle muscular dystrophy (LGMD) 2D patients and mice and was associated with impaired OxPhos capacity. Two distinct approaches that modulated histones or peroxisome proliferator-activated receptor-gamma coactivator 1 α (PGC-1α) acetylation exerted equivalent functional effects by targeting different mitochondrial pathways (mitochondrial biogenesis or fatty acid oxidation[FAO]). The histone deacetylase inhibitor Trichostatin A (TSA) changed chromatin assembly at the PGC-1α promoter, restored mitochondrial biogenesis, and enhanced muscle oxidative capacity. Conversely, nitric oxide (NO) triggered post translation modifications of PGC-1α and induced FAO, recovering the bioenergetics impairment of muscles but shunting the defective mitochondrial biogenesis. In conclusion, a transcriptional blockade of mitochondrial biogenesis occurred in LGMD-2D and could be recovered by TSA changing chromatin conformation, or it could be overcome by NO activating a mitochondrial salvage pathway.

25 citations


Cites background from "Stage of perinatal development regu..."

  • ...Mitochondrial biogenesiswas not inducedby classical physiological stimuli including development and cold (Hock and Kralli, 2009; Laker et al., 2012), indicating a persistent and severe defect....

    [...]

  • ...Mitochondrial Biogenesis Is Impaired in Muscle of a-SG Null Mice The number of mitochondria is known to increase during muscle growth (Laker et al., 2012)....

    [...]


Journal ArticleDOI
TL;DR: It seems that a certain plasticity of muscle fiber type still remains in this developmental stage of the pig, as shown by the rapid and considerable changes in expression of MHC 2b mRNA.
Abstract: The purpose of this study is to elucidate developmental changes in muscle fiber type in the pig during pre- and postnatal development. For this purpose, we performed a histochemical analysis for myosin adenosine triphosphatase activity to assess muscle fiber type and determined abundances of messenger RNA (mRNA) of myosin heavy chain (MHC) isoforms. Samples of Longissimus dorsi (LD) muscle were taken from fetuses on day 90 of the fetal stage. Further, samples of LD, Rhomboideus and Biceps femoris (B. femoris) muscles were taken from pigs when they were 1, 12, 26, 45 or 75 days old. Expression of MHC 2b mRNA in the LD and the B. femoris muscles rapidly and considerably increased from the late fetal stage to the early postnatal stage and this increase was associated with the development of type 2b fibers at least in the LD muscle. As shown by the rapid and considerable changes in expression of MHC 2b mRNA, it seems that a certain plasticity of muscle fiber type still remains in this developmental stage.

9 citations


Cites background from "Stage of perinatal development regu..."

  • ...Indeed, abundances of PGC-1α mRNA in muscle of rats were higher in the postnatal period as compared with the final stage of the gestation period (Laker et al. 2012)....

    [...]


Journal ArticleDOI
Abstract: Duchenne Muscular Dystrophy (DMD) is a rare disorder characterized by progressive muscle wasting, weakness, and premature death. Remarkable progress has been made in genetic approaches, restoring dystrophin, or its function. However, the targeting of secondary pathological mechanisms, such as increasing muscle blood flow or stopping fibrosis, remains important to improve the therapeutic benefits, that depend on tackling both the genetic disease and the downstream consequences. Mitochondrial dysfunctions are one of the earliest deficits in DMD, arise from multiple cellular stressors and result in less than 50% of ATP content in dystrophic muscles. Here we establish that there are two temporally distinct phases of mitochondrial damage with depletion of mitochondrial mass at early stages and an accumulation of dysfunctional mitochondria at later stages, leading to a different oxidative fibers pattern, in young and adult mdx mice. We also observe a progressive mitochondrial biogenesis impairment associated with increased deacetylation of peroxisome proliferator-activated receptor-gamma coactivator 1 α (PGC-1α) promoter. Such histone deacetylation is inhibited by givinostat that positively modifies the epigenetic profile of PGC-1α promoter, sustaining mitochondrial biogenesis and oxidative fiber type switch. We, therefore, demonstrate that givinostat exerts relevant effects at mitochondrial level, acting as a metabolic remodeling agent capable of efficiently promoting mitochondrial biogenesis in dystrophic muscle.

2 citations


Journal ArticleDOI
TL;DR: Exposure to DEX during late gestation causes behavioral changes that compromise the maternal emotional state, disrupting the expression of MC, and data indicate that an adequate MC improves pup's survival in this model.
Abstract: Administration of dexamethasone (DEX) during late gestation is a model to study growth restriction in rodents, but the pup's mortality index can be high, depending on DEX dosage, and little is known about the effects of DEX on maternal care (MC). Considering that an inadequate MC can also contribute to pup's mortality in this model, we evaluated the effects of DEX on dams' behavior and its consequences on offspring survival. We also investigated whether the cross-fostering of pups from dams treated or not with DEX could improve pup's survival. Wistar rats were treated with DEX (14th to 19th day of gestation −0.2 mg/kg, B.W, in the drinking water). Nest building, MC and responses in the elevated plus-maze, forced swimming and object recognition tests were evaluated. DEX reduced gestational weight gain and impaired neonatal development, reducing pup's survival to 0% by the 3rd postnatal day. DEX-treated dams reduced the expression of typical MC and increased anxiety-like behaviors. After cross-fostering, DEX-treated mothers behaved similarly to controls, indicating that a healthy offspring is crucial to induce adequate MC. Cross-fostering increased the survival index from zero to 25% in the DEX offspring. Postnatal development of the DEX offspring was comparable to controls after cross-fostering. We concluded that exposure to DEX during late gestation causes behavioral changes that compromise the maternal emotional state, disrupting the expression of MC. Although it does not seem to be the main cause of pup's mortality, our data indicate that an adequate MC improves pup's survival in this model.

References
More filters

Journal ArticleDOI
David J.P. Barker1, Clive Osmond1, P D Winter1, Barrie Margetts1  +1 moreInstitutions (1)
TL;DR: Measurements that promote prenatal and postnatal growth may reduce deaths from ischaemic heart disease and may be especially important in boys who weigh below 7.5 pounds (3.4 kg) at birth.
Abstract: Environmental influences that impair growth and development in early life may be risk factors for ischaemic heart disease. To test this hypothesis, 5654 men born during 1911-30 were traced. They were born in six districts of Hertfordshire, England, and their weights in infancy were recorded. 92.4% were breast fed. Men with the lowest weights at birth and at one year had the highest death rates from ischaemic heart disease. The standardised mortality ratios fell from 111 in men who weighed 18 pounds (8.2 kg) or less at one year to 42 in those who weighed 27 pounds (12.3 kg) or more. Measures that promote prenatal and postnatal growth may reduce deaths from ischaemic heart disease. Promotion of postnatal growth may be especially important in boys who weigh below 7.5 pounds (3.4 kg) at birth.

3,023 citations


Journal ArticleDOI
08 Oct 1993-Cell
TL;DR: In addition to generalized organ hypoplasia in Igf1r(-/-) embryos, including the muscles, and developmental delays in ossification, deviations from normalcy were observed in the central nervous system and epidermis.
Abstract: Newborn mice homozygous for a targeted disruption of insulin-like growth factor gene (Igf-1) exhibit a growth deficiency similar in severity to that previously observed in viable Igf-2 null mutants (60% of normal birthweight). Depending on genetic background, some of the Igf-1(-/-) dwarfs die shortly after birth, while others survive and reach adulthood. In contrast, null mutants for the Igf1r gene die invariably at birth of respiratory failure and exhibit a more severe growth deficiency (45% normal size). In addition to generalized organ hypoplasia in Igf1r(-/-) embryos, including the muscles, and developmental delays in ossification, deviations from normalcy were observed in the central nervous system and epidermis. Igf-1(-/-)/Igf1r(-/-) double mutants did not differ in phenotype from Igf1r(-/-) single mutants, while in Igf-2(-)/Igf1r(-/-) and Igf-1(-/-)/Igf-2(-) double mutants, which are phenotypically identical, the dwarfism was further exacerbated (30% normal size). The roles of the IGFs in mouse embryonic development, as revealed from the phenotypic differences between these mutants, are discussed.

2,846 citations


Journal ArticleDOI
26 Oct 1991-BMJ
TL;DR: Reduced growth in early life is strongly linked with impaired glucose tolerance and non-insulin dependent diabetes and reduced early growth is also related to a raised plasma concentration of 32-33 split proinsulin, which is interpreted as a sign of beta cell dysfunction.
Abstract: OBJECTIVE--To discover whether reduced fetal and infant growth is associated with non-insulin dependent diabetes and impaired glucose tolerance in adult life. DESIGN--Follow up study of men born during 1920-30 whose birth weights and weights at 1 year were known. SETTING--Hertfordshire, England. SUBJECTS--468 men born in east Hertfordshire and still living there. MAIN OUTCOME MEASURES--Fasting plasma glucose, insulin, proinsulin, and 32-33 split pro-insulin concentrations and plasma glucose and insulin concentrations 30 and 120 minutes after a 75 g glucose drink. RESULTS--93 men had impaired glucose tolerance or hitherto undiagnosed diabetes. They had had a lower mean birth weight and a lower weight at 1 year. The proportion of men with impaired glucose tolerance fell progressively from 26% (6/23) among those who had weighted 18 lb (8.16 kg) or less at 1 year to 13% (3/24) among those who had weighed 27 lb (12.25 kg) or more. Corresponding figures for diabetes were 17% (4/23) and nil (0/24). Plasma glucose concentrations at 30 and 120 minutes fell with increasing birth weight and weight at 1 year. Plasma 32-33 split proinsulin concentration fell with increasing weight at 1 year. All these trends were significant and independent of current body mass. Blood pressure was inversely related to birth weight and strongly related to plasma glucose and 32-33 split proinsulin concentrations. CONCLUSIONS--Reduced growth in early life is strongly linked with impaired glucose tolerance and non-insulin dependent diabetes. Reduced early growth is also related to a raised plasma concentration of 32-33 split proinsulin, which is interpreted as a sign of beta cell dysfunction. Reduced intrauterine growth is linked with high blood pressure, which may explain the association between hypertension and impaired glucose tolerance.

2,603 citations


Journal ArticleDOI
David J.P. Barker1, C. N. Hales2, Caroline H.D. Fall1, Clive Osmond1  +2 moreInstitutions (2)
TL;DR: It is concluded that Type 2 diabetes and hypertension have a common origin in sub-optimal development in utero, and that syndrome X should perhaps be re-named “the small-baby syndrome”.
Abstract: Two follow-up studies were carried out to determine whether lower birthweight is related to the occurrence of syndrome X-Type 2 (non-insulin-dependent) diabetes mellitus, hypertension and hyperlipidaemia. The first study included 407 men born in Hertfordshire, England between 1920 and 1930 whose weights at birth and at 1 year of age had been recorded by health visitors. The second study included 266 men and women born in Preston, UK, between 1935 and 1943 whose size at birth had been measured in detail. The prevalence of syndrome X fell progressively in both men and women, from those who had the lowest to those who had the highest birthweights. Of 64-year-old men whose birthweights were 2.95 kg (6.5 pounds) or less, 22% had syndrome X. Their risk of developing syndrome X was more than 10 times greater than that of men whose birthweights were more than 4.31 kg (9.5 pounds). The association between syndrome X and low birthweight was independent of duration of gestation and of possible confounding variables including cigarette smoking, alcohol consumption and social class currently or at birth. In addition to low birthweight, subjects with syndrome X had small head circumference and low ponderal index at birth, and low weight and below-average dental eruption at 1 year of age. It is concluded that Type 2 diabetes and hypertension have a common origin in sub-optimal development in utero, and that syndrome X should perhaps be re-named "the small-baby syndrome".

2,339 citations


Journal ArticleDOI
08 Oct 1993-Cell
TL;DR: Postnatal growth curves indicated that surviving Igf-1(-/-) mutants, which are infertile and exhibit delayed bone development, continue to grow with a retarded rate after birth in comparison with wild-type littermates and become 30% of normal weight as adults.
Abstract: A developmental analysis of growth kinetics in mouse embryos carrying null mutations of the genes encoding insulin-like growth factor I (IGF-I), IGF-II, and the type 1 IGF receptor (IGF1R), alone or in combination, defined the onset of mutational effects leading to growth deficiency and indicated that between embryonic days 110 and 125, IGF1R serves only the in vivo mitogenic signaling of IGF-II From E135 onward, IGF1R interacts with both IGF-I and IGF-II, while IGF-II recognizes an additional unknown receptor (XR) In contrast with the embryo proper, placental growth is served exclusively by an IGF-II-XR interaction Additional genetic data suggested that the type 2IGF/mannose 6-phosphate receptor is an unlikely candidate for XR Postnatal growth curves indicated that surviving Igf-1(-/-) mutants, which are infertile and exhibit delayed bone development, continue to grow with a retarded rate after birth in comparison with wild-type littermates and become 30% of normal weight as adults

2,329 citations