Showing papers on "Dengue virus published in 1989"

An enzyme-linked immunosorbent assay to characterize dengue infections where dengue and Japanese encephalitis co-circulate.

Abstract: The diagnostic sensitivity and specificity of detection of anti-dengue IgM by antibody capture enzyme-linked immunosorbent assay (ELISA) was investigated in dengue infections in a variety of clinical settings. Sera from uninfected controls were uniformly negative. Serial specimens from experimental and natural infections showed that viremia and fever terminated as anti-dengue IgM became detectable. Anti-dengue IgM appeared in most cases by the 3rd afebrile day of illness and declined to undetectable levels after 30-60 days. Assay sensitivity was 78% in admission sera (924/1,183; 95% CI = 75-81%) and 97% in paired sera (1,030/1,062; 95% CI = 96-98%) thus exceeding or matching the performance of the hemagglutination-inhibition assay. Measurement of the anti-dengue IgM to anti-Japanese encephalitis IgM ratio correctly identified all sera from 112 patients with strictly defined Japanese encephalitis and 98% (307/312; 95% CI = 96-99%) of sera from patients whose dengue infections were confirmed by virus isolation. Dengue infections could be classified as primary or secondary by determining the ratio of units of dengue IgM to IgG antibody. We propose that measurement of dengue and Japanese encephalitis IgM and IgG antibodies upon admission and discharge from hospital care should replace the hemagglutination inhibition assay as the standard dengue serologic technique in regions where these 2 viruses co-circulate.

Antibody-dependent enhancement of dengue virus growth in human monocytes as a risk factor for dengue hemorrhagic fever.

Abstract: Serum specimens collected during a prospective study of dengue infections among schoolchildren in Bangkok were tested for their ability to enhance dengue 2 (DEN-2) virus growth in human monocytes in vitro. Two groups of dengue-immune sera were compared: 32 dengue antibody positive serum specimens from children who subsequently developed asymptomatic secondary dengue infections; and 9 dengue antibody positive serum specimens from children who subsequently developed severe symptomatic secondary dengue infections, 8 of which were clinically diagnosed as dengue hemorrhagic fever. Antibody-dependent enhancement of virus growth was quantitated by measurement of virus yields in supernatant fluids of normal human monocyte cultures that were infected with DEN-2 virus in the presence of undiluted test serum. Only 4 of 32 (12%) preinfection sera from asymptomatic children, but 6 of 9 (67%) preinfection sera from symptomatic children, had significant enhancing activity (P < 0.001). High serum DEN-2 antibody dependent enhancing activity is a significant (relative risk = 6.2) risk factor for severe illness among children in a dengue hemorrhagic fever endemic region. Dengue antibodies can be neutralizing and therefore protective, or they can be enhancing and increase the risk of dengue hemorrhagic fever.

Antibody, Macrophages, Dengue Virus Infection, Shock, and Hemorrhage: A Pathogenetic Cascade

Abstract: Dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS) in children is reliably associated with the presence of dengue antibody--actively or passively acquired--before the onset of illness. Limited observations by electron microscopy and fluorescent antibody testing and the recovery of virus from tissues obtained at autopsy show that dengue viruses are consistently associated with cells of mononuclear phagocyte lineage. In particular, virus is associated with Kupffer cells, pulmonary macrophages, and mononuclear cells in skin and blood. Endothelial cells fail to demonstrate necrosis or inflammatory changes. Since acute vascular permeability, shock, and hemorrhage occur late in illness, a plausible hypothesis is that phlogistic factors, resulting from interactions with elements of the immune response, are released from virus-infected mononuclear phagocytes. Such phenomena as generalized depression of mitotic activity of bone marrow cells, destruction of mature polymorphonuclear leukocytes, complement activation, and abnormal hemostasis may serve as markers of these phlogistic factors. It will be of interest to establish whether other viral hemorrhagic fevers involve the same target cells as in DHF/DSS and are mediated by similar effector mechanisms.

Proper processing of dengue virus nonstructural glycoprotein NS1 requires the N-terminal hydrophobic signal sequence and the downstream nonstructural protein NS2a.

Abstract: Expression of dengue virus gene products involves specific proteolytic cleavages of a precursor polyprotein. To study the flanking sequences required for expression of the dengue virus nonstructural glycoprotein NS1, we constructed a series of recombinant vaccinia viruses that contain the coding sequence for NS1 in combination with various lengths of upstream and downstream sequences. The NS1 products expressed by these viruses in infected CV-1 cells were immune precipitated and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The data show that the 24-residue hydrophobic sequence preceding NS1 was necessary and sufficient for the production of glycosylated NS1 and that this sequence was cleaved from NS1 in the absence of most dengue virus proteins. This finding is consistent with previous proposals that this hydrophobic sequence serves as an N-terminal signal sequence that is cleaved by signal peptidase. The cleavage between the C terminus of NS1 and the downstream protein NS2a occurred when the complete NS2a was present. Recombinant viruses containing NS1 plus 15 or 49% of NS2a produced proteins larger than authentic NS1, indicating that the cleavage between NS1 and NS2a had not occurred. Failure of cleavage was not corrected by coinfection with a recombinant virus capable of cleavage. These results suggest that NS2a may be a cis-acting protease that cleaves itself from NS1, or NS2a may provide sequences for recognition by a specific cellular protease that cleaves at the NS1-NS2a junction.

Dengue virus-specific human T cell clones. Serotype crossreactive proliferation, interferon gamma production, and cytotoxic activity.

Abstract: The severe complications of dengue virus infections, hemorrhagic manifestation and shock, are much more commonly observed during secondary infections caused by a different serotype of dengue virus than that which caused the primary infections. It has been speculated, therefore, that dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are caused by serotype crossreactive immunopathological mechanisms. We analyzed clones of dengue serotype crossreactive T lymphocytes derived from the PBMC of a donor who had been infected with dengue 3 virus. These PBMC responded best to dengue 3 antigen, but also responded to dengue 1, 2, and 4 antigens, in bulk culture proliferation assays. 12 dengue antigen-specific clones were established using a limiting dilution technique. All of the clones had CD3+ CD4+ CD8 phenotypes. Eight clones responded to dengue 1, 2, 3, and 4 antigens and are crossreactive, while four other clones responded predominantly to dengue 3 antigen. These results indicate that the serotype crossreactive dengue-specific T lymphocyte proliferation observed in bulk cultures reflects the crossreactive responses detected at the clonal level. Serotype crossreactive clones produced high titers of IFN-gamma after stimulation with dengue 3 antigens, and also produced IFN-gamma to lower levels after stimulation with dengue 1, 2, and 4 antigens. The crossreactive clones lysed autologous lymphoblastoid cell line (LCL) pulsed with dengue antigens, and the crossreactivity of CTL lysis by T cell clones was consistent with the crossreactivity observed in proliferation assays. Epidemiological studies have shown that secondary infections with dengue 2 virus cause DHF/DSS at a higher rate than the other serotypes. We hypothesized that the lysis of dengue virus-infected cells by CTL may lead to DHF/DSS; therefore, the clones were examined for cytotoxic activity against dengue 2 virus-infected LCL. All but one of the serotype crossreactive clones lysed dengue 2 virus-infected autologous LCL, and they did not lyse uninfected autologous LCL. The lysis of dengue antigen-pulsed or virus-infected LCL by the crossreactive CTL clones that we have examined is restricted by HLA DP or DQ antigens. These results indicate that primary dengue virus infections induce predominantly crossreactive memory CD4+ T lymphocytes. These crossreactive T lymphocytes proliferate and produce IFN-gamma after stimulation with a virus strain of another serotype, and demonstrate crossreactive cyotoxic activity against autologous cells infected with heterologous dengue viruses.(ABSTRACT TRUNCATED AT 400 WORDS)

Monoclonal antibodies for dengue virus prM glycoprotein protect mice against lethal dengue infection

Abstract: Five murine monoclonal antibodies (Mabs) reactive against the prM glycoproteins of DEN-3 and -4 were used to passively protect mice in vivo against lethal challenge with homologous and heterologous dengue virus serotypes. Four of the 5 prM-reactive monoclonals cross-protected mice against heterologous challenge, whereas 1 protected against challenge with only the homologous serotype. Although in vitro binding to virions was readily demonstrated, only 2 of the prM Mabs had detectable neutralizing activity. The neutralizing activity could not be enhanced by anti-mouse immunoglobulin or complement. However, 4 of the 5 prM Mabs fixed complement. This is the first report of prM-specific Mabs that are protective in mice.

Human T cell responses to dengue virus antigens. Proliferative responses and interferon gamma production.

Abstract: The severe complications of dengue virus infections, hemorrhagic manifestations and shock, are more commonly observed during secondary dengue virus infections than during primary infections. It has been speculated that these complications are mediated by cross-reactive host-immune responses. We have begun to analyze human T cell responses to dengue antigens in vitro to explain the possible role of T lymphocytes in the pathogenesis of these complications. Dengue antigens induce proliferative responses of PBMC from dengue antibody-positive donors, but do not induce specific proliferative responses of PBMC from dengue antibody-negative donors. IFN gamma is detected in the culture fluids of dengue-immune PBMC stimulated with dengue antigens. The cells that proliferate in the dengue antigen-stimulated bulk cultures have CD3+, CD4+, CD8-, CD16-, and CD20- phenotypes. Dengue-specific T cell lines were established using limiting dilution techniques. They have CD3+, CD4+, and CD8- phenotypes, and produce IFN gamma in response to dengue antigens. Culture fluids from dengue-immune PBMC stimulated with dengue antigens, which contain IFN gamma, augment dengue virus infection of human monocytes by dengue virus-antibody complexes. These results indicate that PBMC from dengue-immune donors contain CD4+ T cells that proliferate and produce IFN gamma after stimulation with dengue antigens, and suggest that the IFN gamma that is produced by these stimulated dengue-specific T cells may contribute to the pathogenesis of dengue hemorrhagic fever and dengue shock syndrome by increasing the number of dengue virus-infected monocytes in the presence of cross-reactive anti-dengue antibodies.

Mice immunized with recombinant vaccinia virus expressing dengue 4 virus structural proteins with or without nonstructural protein NS1 are protected against fatal dengue virus encephalitis.

Abstract: We have constructed vaccinia virus recombinants expressing dengue virus proteins from cloned DNA for use in experimental immunoprophylaxis. A recombinant virus containing a 4.0-kilobase DNA sequence that codes for three structural proteins, capsid (C), premembrane (pre-M), and envelope (E), and for nonstructural proteins NS1 and NS2a produced authentic pre-M, E, and NS1 in infected CV-1 cells. Mice immunized with this recombinant were protected against an intracerebral injection of 100 50% lethal doses of dengue 4 virus. A recombinant containing only genes C, pre-M, and E also induced solid resistance to challenge. Deletion of the putative C-terminal hydrophobic anchor of the E glycoprotein did not result in secretion of E from recombinant-virus-infected cells. Recombinants expressing only the E protein preceded by its own predicted N-terminal hydrophobic signal or by the signal of influenza A virus hemagglutinin or by the N-terminal 71 amino acids of the G glycoprotein of respiratory syncytial virus produced glycosylated E protein products of expected molecular sizes. These vaccinia virus recombinants also protected mice.

Dengue virus-specific cross-reactive CD8+ human cytotoxic T lymphocytes.

Abstract: Stimulation with live dengue virus of peripheral blood mononuclear cells from a dengue virus type 4-immune donor generated virus-specific, serotype-cross-reactive, CD8+, class I-restricted cytotoxic T lymphocytes (CTL) capable of lysing dengue virus-infected cells and cells pulsed with dengue virus antigens of all four serotypes. These CTL lysed autologous fibroblasts infected with vaccinia virus-dengue virus recombinant viruses containing the E gene or several nonstructural dengue virus type 4 genes. These results demonstrate that both dengue virus structural and nonstructural proteins are targets for the cytotoxic T-cell-mediated immune response to dengue virus and suggest that serotype-cross-reactive CD8+ CTL may be important mediators of viral clearance and of virus-induced immunopathology during secondary dengue virus infections.

Surveillance for dengue and dengue hemorrhagic fever.

Abstract: Dengue and dengue hemorrhagic fever are emerging as major public health problems in most tropical countries. Effective prevention and control programs will depend on improved surveillance designed to provide early warning of dengue epidemics. This article outlines a reasonable approach to dengue surveillance of this kind. Virologic surveillance should be considered the most important element in any such early warning system. Dengue virus transmission should be monitored to determine which serotypes are present, their distribution, and the type of illnesses associated with each. Other key components of an active surveillance system should include monitoring of fever activity and clinical surveillance for cases of severe and fatal disease associated with viral syndromes. Collectively, these three surveillance components can provide an early warning capability permitting emergency mosquito control measures to be implemented and major epidemics to be averted.

In vitro processing of dengue virus structural proteins: cleavage of the pre-membrane protein.

Abstract: Processing of dengue virus structural proteins was assessed in vitro. RNA transcripts for cell-free translation were prepared from cloned DNA (dengue virus type 4, strain 814669 genome) encoding capsid, pre-membrane (prM), and the first 23 amino acids of envelope (E). Processing of a 33-kilodalton precursor polypeptide encoded by wild-type RNA transcripts occurred only in the presence of added microsomal membranes. Under these conditions, cleavage at the capsid-prM and prM-E sites and glycosylation of prM occurred in association with translocation. Amino acid sequence analysis confirmed that translation initiated at the predicted N terminus of the capsid and that capsid-prM cleavage occurred at the predicted site for the action of signal peptidase following a candidate signal sequence (hydrophobic residues 100 to 113) in the dengue virus precursor. Mutations were introduced into the dengue virus DNA template by site-directed mutagenesis, altering nucleotide sequences encoding the capsid and the candidate signal for prM. The phenotypes of the mutants were deduced by analysis of the products of cell-free translation of the respective RNA transcripts. The resulting observations confirmed that cleavage at the capsid-prM and prM-E sites is effected entirely by signal peptidase and that the candidate signal is required for translocation.

Arbovirus infections and viral haemorrhagic fevers in Uganda: a serological survey in Karamoja district, 1984

Abstract: Sera collected in May 1984 from 132 adult residents of Karamoja district, Uganda, were examined by haemagglutination inhibition tests for antibodies against selected arboviruses, namely Chikungunya and Semliki Forest alphaviruses (Togaviridae); dengue type 2, Wesselsbron, West Nile, yellow fever and Zika flaviviruses (Flaviviridae); Bunyamwera, Ilesha and Tahyna bunyaviruses (Bunyaviridae); and Sicilian sandfly fever phlebovirus (Bunyaviridae); and by immunofluorescence tests against certain haemorrhagic fever viruses, Lassa fever arenavirus (Arenaviridae), Ebola-Sudan, Ebola-Zaire and Marburg filoviruses (Filoviridae), Crimean-Congo haemorrhagic fever nairovirus and Rift Valley fever phlebovirus (Bunyaviridae). Antibodies against Chikungunya virus were the most prevalent (47%), followed by flavivirus antibodies (16%), which were probably due mainly to West Nile virus. No evidence of yellow fever or dengue virus circulation was observed. A few individuals had antibodies against Crimean-Congo haemorrhagic fever, Lassa, Ebola and Marburg viruses, suggesting that these viruses all circulate in the area.

Epidemiology and control of dengue virus infections in Thai villages in 1987.

Abstract: A severe epidemic of dengue hemorrhagic fever (DHF) in Nakhon Ratchasima, Thailand in August of 1987 prompted a field investigation. DHF rates of 0.4–6.5 cases per 1,000 residents in subdistricts and 2–15 cases per 1,000 residents in 10 villages investigated were reported. Epidemics peaked in neighboring villages at different times; in June and July, and in August before the rainy season began late in the month. In 4 primary schools representing 6 villages, sera from groups of randomly selected children were tested for dengue IgM with the antibody capture ELISA test. Rates of recent dengue infection were 10–65% in the schools and correlated closely with reported rates of DHF. In an effort to control vectors, malathion fog and temephos (1% abate sand granules) were applied. Villagers were educated in prevention and were urged to cover water receptacles. The percentage of houses with larvae dropped from 67 to 20, the percentage of containers with larvae decreased from 30 to 5, and the number of containers with larvae per 100 households decreased from 221 to 33. This was a serious epidemic in which conventional control measures were only moderately effective.

Serologically defined linear epitopes in the envelope protein of dengue 2 (Jamaica strain 1409).

Abstract: Antisera from dengue patients and dengue virus infected rabbits recognized octapeptides corresponding to linear amino acid sequences in the envelope protein of dengue 2 (Jamaica 1409). Although no peptide was recognized by sera from all dengue infected hosts, two peptides (216LPLPWLPG223 and448FSGVSWTM455) were recognized by sera from all dengue 2 infected rabbits. One of these448FSGVSWTM455 was also recognized by sera from both the dengue 2 patients tested. No peptides were identified which reacted exclusively with all dengue 2 infected animals. Use of a mouse monoclonal antibody (1B7) enabled identification of two regions (50AKQPATLR57 and127GKVVLPEN134) and possibly a third (349GRLITVNP356) in the envelope protein of dengue 2 likely to be involved in haemagglutination inhibition and virus neutralization in vitro.

The Reemergence of Dengue in China

Abstract: In 1978, dengue was reported in China for the first time in 32 years. Since then, epidemics involving hundreds of thousands of people have occurred in Guangdong and Guangxi provinces and on Hainan Island. These epidemics were caused by all four types of dengue virus. Aedes aegypti was the vector in coastal areas, while Aedes albopictus was the vector in inland regions. During these epidemics, case rates were very high (greater than 50%) in some areas. Case-fatality rates were generally less than 0.1% except during the 1986 outbreak on Hainan Island, when the rate was 0.25%. Hemorrhagic disease occurred in both children and adults. On Hainan Island, hemorrhagic disease was more than three times as common in the 1986 outbreak as in the 1980 outbreak; the 1980 outbreak was caused by dengue virus type 3 and the 1986 outbreak by dengue virus type 2. The weight of the evidence suggests that the reemergence of dengue in China resulted from the introduction of the infection by travelers and refugees from areas of Asia where dengue is endemic.

Dengue virus-specific murine T-lymphocyte proliferation: serotype specificity and response to recombinant viral proteins.

Abstract: Definition of the T-lymphocyte responses to dengue viruses should aid in the development of safe and effective vaccines and help to explain the pathophysiology of dengue hemorrhagic fever and dengue shock syndrome. In this study, we demonstrated that dengue virus-specific T lymphocytes were detected in spleen cells from dengue virus-immune mice using an in vitro proliferation assay. Following immunization with a single dose of infectious dengue virus, murine lymphocytes showed increased proliferation when incubated in the presence of viral antigens of the same serotype but not in the presence of control antigens. Depletion experiments with antibody and complement showed that the population of responding cells expressed the Thy1+ L3T4+ Lyt2- phenotype. This indicates that the predominant proliferating cells are T lymphocytes of the helper-inducer phenotype. Dengue virus-specific memory lymphocyte responses were detectable for at least 22 weeks after immunization. The response to primary infection was primarily serotype specific, with some serotype cross-reactivity present at a low level. We demonstrated that lymphocytes from mice immunized with dengue 4 virus proliferate in response to a combination of dengue 4 virus C, pre-M, E, NS1, and NS2a proteins expressed in Sf9 cells with a recombinant baculovirus, and, to a lesser extent, to the dengue 4 virus E protein alone.

Serological evidence of dengue fever among refugees, Hargeysa, Somalia.

Abstract: Epidemics of a malaria-like illness affected several thousand residents of the Dam Camp, a refugee camp near Hargeysa in Somalia, during 1985, 1986, and 1987. The disease was characterized by fever, chills, sweats, headache, back and joint pains for as long as 10 days in some patients. Blood smears from acutely ill patients were negative for malaria. Of 28 acute and 10 convalescent sera tested by the indirect fluorescent antibody (IFA) and by the hemagglutination inhibition (HI) tests, all were negative for antibody to Rift Valley fever, Crimean-Congo hemorrhagic fever, Sindbis, Chikungunya, yellow fever, and Zika viruses. However, antibody reactive to dengue 2 virus was detected by the IFA test in 39% (15/38), and 11 of 29 (38%) of the same sera were antibody positive by the HI test. Also, IgG antibody reactive to dengue 2 was demonstrated in 60% (17/28) of the same sera by the enzyme immunoassay (EIA), and 14% (4/28) were positive for IgM antibody. Of ten patients for which acute and convalescent sera were available, two developed four fold or greater rises in antibody titer evidencing infection. These data suggested that dengue virus may have been the cause of the epidemic among the Dam Camp refugees.

Enzyme immunoassay for the detection of dengue IgG and IgM antibodies using infected mosquito cells as antigen.

Abstract: The detection of immunoglobulin (Ig)G and IgM antibodies to dengue 1 virus was studied by a simple enzyme immunoassay, in which infected cultured cells infected with dengue virus were used as antigen (EIA-ICC). Detection of anti-dengue 1 IgG by EIA-ICC was correlated with haemagglutination assays. EIA-ICC anti-dengue 1 IgM detection was less sensitive than IgM capture enzyme-linked immunosorbent assay. IgG and IgM responses in dengue 1 infection were studied by EIA-ICC, using sera collected at different intervals after onset of illness: IgM and IgG appeared on the 4th day of disease; the highest IgM mean titres were detected on the 7th day and IgM was not detected in sera obtained after the 60th day; the highest mean titres of anti-dengue 1 IgG were seen in sera obtained between 22 and 30 d after onset of illness. EIA-ICCs for 6 flaviviruses and 1 alphavirus were conducted with sera from patients infected with dengue 1, and primary and secondary infections of other flaviviruses. The results showed that anti-dengue 1 IgG detection was sensitive, and the antibodies were cross-reactive among the flaviviruses. Anti-dengue 1 IgM detected in dengue 1 patients was mostly type specific. The pattern of secondary dengue infection, i.e. the presence of IgG and a low titre or absence of IgM antibodies, was observed in the sera of 6 patients obtained in the first week after onset of illness. EIA-ICC is useful for dengue diagnosis, surveillance and sero-epidemiological studies.

Stimulation of plasminogen activator inhibitor activity in human monocytes infected with dengue virus.

Abstract: Human monocytes, in an essentially serum-free culture medium, were infected with dengue 2 virus in the presence of sub-neutralizing concentrations of antibody. Changes in procoagulant activity (PCA), in the plasminogen activator urokinase (UK), and the plasminogen activator inhibitor-2 (PAI-2) were quantitated. One day after exposure to dengue virus, the cell-associated PAI-2 activity in the infected monocytes was 562 +/- 9 mU/10(6) cells (mean +/- SE) compared to 206 +/- 56 mU/10(6) cells for uninfected monocytes. Supernatants of the infected cells also showed greater than 2-fold increase in PAI-2 activity. This increase in cell-associated and supernatant PAI-2 activity was maintained during 4 days of culture. UK activity was not detected in control and infected cells nor in their supernatants. PCA activity was the same in control and dengue virus infected monocytes when measured during 4 days of culture. These data suggest that dengue infected monocytes may affect fibrinolysis at a localized level through increased production of PAI-2.

[MAC-ELISA for the detection of IgM antibodies to dengue type I virus (rapid diagnosis of dengue type I virus infection)].

Abstract: The commercial rapid diagnostic reagents for Dengue virus infection is still not available at present. An ABC MAC-ELISA (Avidin Biotin Complex IgM Antibody Capture Enzyme Linked Immunosorbent Assay) for the detection of Dengue type I virus infection has been described. IgG purified from high titer (HI = 2560) human anti-flavivirus serum is labelled with biotin for the rapid diagnosis of Dengue type I virus infection. 389 serum specimens of suspected Dengue Fever patients including 226 HI(+) paired sera and 163 HI(-) paired sera which were collected from 1 to 150 days after onset of the disease in 1988 have been assayed for IgM antibodies to Dengue type I virus. Cut off value is based on the mean of OD490 of 162 Dengue negative serum specimens plus 4 SD. The positivity of IgM antibody increased as the viremia disappeared and IgM antibody for Dengue-1 serum specimens collected 9 days after onset of the disease is 100% detectable.

A preliminary report of the fetal effects of dengue infection in pregnancy

Abstract: This Manuscript was read at the Clinical Aspects on Dengue Fever and Dengue Hemorrhagic Fever held at Kaohsiung Medical College, Kaohsiung City, Taiwan, Republic of China, November 13, 1988. There is not enough evidence to prove that the dengue virus will cause teratogenicity, abortion, or intrauterine growth retardation of a fetus during pregnancy. Nine cases of women infected with dengue fever in early pregnancy received amniocentesis (or chorion villi sampling) in the Department of Obstetrics and Gynecology, KMCH. The chromosome analysis revealed that all were normal, and the level of alpha-fetoprotein in amniotic fluids and maternal sera were within normal range. Antibodies to the dengue virus in the dengue infected mother can cross the placenta and transfer to the fetus, which can cause new born infants to develop dengue hemorrhagic fever or dengue shock syndrome easily when they are primarily infected with dengue virus. Anti-dengue activity was found in the lipid component of human milk and colostrum. This suggests that breast feeding will protect the infant from the dengue virus in the endemic area of dengue infection.

Effect of dengue virus on procoagulant and fibrinolytic activities of monocytes.

Abstract: Some of the fibrinolytic and coagulation enzymes that monocytes produce are urokinase, a plasminogen activator (PA); a PA-specific inhibitor (PAI); and procoagulant activity (PCA), which has been characterized as tissue factor. Dengue infection in vivo is restricted to monocytes; however, it is unknown if dengue-infected monocytes undergo alterations in the production of PA, PAI, and PCA. This issue was addressed in studies in which monocytes were infected in vitro with dengue 2 virus in serum-free medium in the presence of enhancing antibody. No urokinase activity was detected in either control or infected cells or in their supernatants. Infection of monocytes with dengue 2 virus resulted in an almost threefold increase in PAI activity in cells and supernatants. No change in relation to the control was observed in PCA generated by the infected cells. These data indicate that dengue 2 infection enhances the production of PAI from monocytes without altering PA or PCA.

Nucleotide sequence of the envelope protein gene of a Malaysian dengue-2 virus isolated from a patient with dengue fever.

Abstract: 1 AUGCGUUGCAUAGGAAUAUC 51 AGGAAGCUGGGUUGACAUAG 101 UGGCAAAAAACAAACCGACA 151 AAACAACCUGCCACUCUCAG 201 CACGACAACAGAAUCUCGUU 251 AAGAGCAGGACAAAAGGUUA 301 UGGGGAAAUGGAUGUGGAUU 351 UAUGUUUACCUGCAAAAAGA 401 AUWJGGAAUACACCAUCGUG 451 GUCGGUAAUGACACAGGAAA 501 GAGUUCCAUCACAGAAGCAG 551 AGUGCUCUCCGAGAACGOGC 601 AUGGAAGACAAAGCUUGGCU 651 GUUACCAUGGCUACCCGGAG 701 AAGAGACAUUGGUCACUUUC 751 QUUGUCUUAGGAUCCCAAGA 801 CGCAGAAAUCCAGAUGUCAU 851 AGUGCAGGCUGAGAAUGGAC 901 AUGUGUACAGGAAAGUUUAA 951 UGGAACCAUCGUUAUCAGAG 1001 AGAUCCCUUUUGAGAUCAUC 1051 CUUAUUACAGUUUACCCGAU 1101 AGAUACAGACCCUCCAUUCG 1151 CGGGACAAUUGAAACUCCAC 1201 AUGUUUGAGACAACAAUGAG 1251 CACAGCCUGGGAUUUUGGAU 1301 AGGCUCUCAACCAAGUUUUC 1351 GUCUCAUGGACUCUGAAAAU 1401 AAUGAAUUCACGUAGCACCU 1451 UCCUAACACUGUACUUGGGA AAAUAGGAACUUUGUAGAAG UCUUAGAACAUGGAAGUUGU UUGGAUUUUGAAGUGAUAAA GAAGUCCUGUUUCGAAGCCA GCCCAACACUAGGQGAACCC GUCUGCAAACAUUCCAUGGU AUUUGGAAAGGGAGOCAUUG ACAUGGAAGGAAAAUUUGUG AUUACACCUCACUCUQGAGA ACAUGGCAAGGAAUUAAAGA AACUUACAGGCUAUGGCACU CUCGACUUCAAUGAQAUAGU GGUGCACAGGCAAUGGUUCC CGGACACACAAGGAUCAAAU AAAAAUCCCCACGCGAAAAA AGQGQCCAUQCACACGGCAC CAGGAAACUUACUAUUCACA AAGCUACAGCUCAAAGGGAU AAUUGUGAAGQAAUUCGCUG UGCAAUAUGAAGGQGACOQC GAUITUQGAAAAAAGACAUGU CGUAACAGAAAAAGAUAQCC GAGACAGCUACAUAAUCAUA UGGUUGAAGAAAGGAAGUUC AQGAGCGAAGAGAAUGGCCA CCCUOOGAGQAQUGUCUACA GGAACAAUCUAUGGQGCUGC CCUCAUCGGUGUCAUCAUCA CACUCACUGUGACACUAGUA GGCAUGGUGCACGCC GGGUUUCAGG GUGACGACGA AACUGAAGCC AGCUGACCAA AGUCUGAAUG AGACAGAGGA UGACCUGUGC CAUCCAGAAA AGAGCACGCU UAACACCACA GUCACGAUGC GCUGCUGCAG UAGACCUGCC UGOAUACAGA ACAGGAUGUC UCACAGGGGC GGACAUCUCA CUCAAUACUC AAACACAACA UCUCCAUGUA CUUAGGUUGC CAGUCAACAU GGAAUAGAGC CAUAGGCAAA UUUUAGGUGA UCUAUAGGAA CUUUAGUGGG CCUGCAUAGG UUGGUUGGAG

A Case of Dengue Hemorrhagic Fever in a Japanese Child

Abstract: A 6-year-old Japanese girl contracted a febrile illness with hemorrhagic manifestations when she traveled in Indonesia. A remarkable decrease in the numbers of platelets and white blood cells was observed in her acute-phase blood specimens. Her father, who accompanied her, showed dengue fever-like symptoms at almost the same time as her illness. It was determined by serological tests that they were infected with dengue virus type 1. Moreover, she showed a secondary antibody response to the flavivirus due to the pre-existing antibody to Japanese encephalitis virus. This is the first confirmed case of dengue hemorrhagic fever (DHF) in Japanese people.