Showing papers on "Keratan sulfate published in 1995"

Large and small proteoglycans of osteoarthritic and rheumatoid articular cartilage.

Abstract: Objective. To identify characteristic changes in large aggregating (aggrecan) and small proteoglycan (PG) populations in articular cartilages during osteoarthritis (OA) and rheumatoid arthritis (RA). Methods. Aggrecan populations in guanidine extracts of femoral condylar cartilages of 46 OA and 8 RA patients who underwent total knee arthroplasty, as well as of 2 fetuses and 6 normal adults, were separated in agarose-polyacrylamide composite gels. Small PGs (biglycan, decorin, and fibromodulin) in the same extracts were analyzed in 12% polyacrylamide gels. Gels were stained or electrophoretically transferred and probed with antibodies to aggrecan epitopes and to small PGs. Epitope contents of the samples were also compared by inhibition radioimmunoassay. Results. There were significant differences found among normal and diseased samples in their electrophoretic mobilities, band distributions, and antibody staining. OA and especially RA samples were heavily degraded, lacked certain aggrecan populations, and contained fewer keratan sulfate and chondroitin-6-sulfate epitopes compared with normal samples. Levels of chondroitin-4-sulfate and “fetal-type” epitopes were elevated in the OA samples compared with the normal ones. More core proteins of small PGs were found in diseased than in normal cartilages, but they were more heterogeneous in size and glycosaminoglycan substitution. Conclusion. There is extensive degradation of both large and small PGs in diseased cartilages, but a repair process does exist, especially in OA cartilages. Chondrocytes of diseased cartilages are able to synthesize fetal-type aggrecans. Small PGs are glycosylated differently in diseased cartilages than in normal ones.

OSTEOARTHRITIS and CARTILAGE Markers of cartilage matrix metabolism in human joint fluid and serum: the effect of exercise

Abstract: The concentrations of cartilage proteoglycan (aggrecan), stromelysin-1, tissue inhibitor of metalloproteinases-1 (TIMP-1) and procollagen II C-propeptide in knee joint fluid and the levels of aggrecan, hyaluronan and keratan sulfate in serum were measured before and after exercise in 33 healthy athletes. The samples before exercise were obtained after 24 h rest from running or soccer and the samples after exercise were obtained 30-60 min after the exercise. Nine athletes ran on a treadmill for 60 min, 16 ran on road for 80 rain and 8 played one soccer game (90 rain). A reference group of 28 patients with knee pain but not evidence of joint pathology or injury was used for comparison. In joint fluid no single marker from the degradative processes in cartilage matrix changed significantly with exercise but all showed a rising trend. All markers except stromelysin showed lower concentrations in athletes at rest compared to the reference group. In serum from runners before exercise the concentration of keratan sulfate was significantly higher than in both the soccer and reference groups and further increased after exercise. The increase in markers after exercise may reflect an effect of mechanical loading in combination with a possible high turnover rate of body cartilage matrix in these individuals.

Sulfated polyanions block Chlamydia trachomatis infection of cervix-derived human epithelia.

Abstract: Using a cell line derived from the human cervix and a rapid fluorescence cytotoxicity assay, we have shown that Chlamydia trachomatis infection can be blocked by certain sulfated polysaccharides (carrageenan, pentosan polysulfate, fucoidan, and dextran sulfate) and glycosaminoglycans (heparin, heparan sulfate, and dermatan sulfate) but not by other glycosaminoglycans (chondroitin sulfate A or C, keratan sulfate, and hyaluronic acid). The most negatively charged molecules are the most effective at blocking infection. Results of infection at 4 degrees C suggest that sulfated polyanions act by preventing the adherence of chlamydiae to target cells. These and additional blocking studies with enzymes suggest that a heparan sulfate-like glycosaminoglycan on the surface of elementary bodies is involved in the adherence of chlamydiae to target cells, probably through a nonspecific charge interaction or possibly a heparin-binding protein. We previously observed that the same sulfated polysaccharides inhibit transmission of human immunodeficiency virus in vitro and suggested that these compounds could be used in a vaginal formulation to inhibit infection by human immunodeficiency virus. The results of the present study suggest that the same type of formulation may inhibit sexual transmission of chlamydia.

OSTEOARTHRITIS and CARTILAGE Characterization of proteoglycan accumulation during formation - of cartilagenous tissue in vitro

Abstract: Summary In order to study proteoglycan retention and accumulation, we optimized a chondrocyte cell culture system in which isolated bovine articular chondrocytes accumulate extracellular matrix to form a continuous layer of cartilagenous tissue. The tissue can attain a thickness of up to ll0pm by 35 days. The cells synthesize large keratan sulfate containing proteoglycans and type II collagen indicating that the chondrocytes maintain their phenotype in these culture conditions. Matrix accumulation is enhanced by increased cell density and the presence of serum and ascorbic acid. The amount of proteoglycans synthesized by the chondrocytes increases up to day 21 and then decreases to the same levels as are synthesized during the first week of culture. The percentage of newly synthesized proteoglycans retained in the matrix increases from 20% on day 6 to a maximum of 85% by day 35. The proteoglycan and collagen content in the tissue increases with time in culture. The changes in the percentage of proteoglycans retained parallels the increase in proteoglycan content. After day 35, there is no further increase in the amount of proteoglycans and collagen nor in the percentage of newly synthesized proteoglycans retained in the extracellular matrix. These studies demonstrate that the cultures are going through two phases: one of matrix accumulation and then one of maintaining the existing matrix. The period of matrix accumulation occurs between days 10-21 whereas matrix maintenance is observed after day 35. Using this culture system to study proteoglycan accumulation and maintenance during these culture periods may prove useful in identifying the mechanisms regulating these processes.

Expression of chondroitin sulfate and keratan sulfate proteoglycans in the path of growing retinal axons in the developing chick.

Abstract: Previous investigations have identified proteoglycans in the central nervous system during development and have implicated some proteoglycans as axon guidance molecules that act by inhibiting axon extension. The present study investigated the pattern of immunoreactivity for several glycosaminoglycans common to certain proteoglycans relative to growing retinal axons in the developing chick visual system and in retinal explant cultures. Immunostaining for chondroitin-6-sulfate, chondroitin-4-sulfate, and keratan sulfate was observed to colocalize with retinal axons throughout the retinofugal pathway during the entire period of retinal axon growth. The proteoglycan form of collagen IX, however, was only observed in the retina, primarily peripheral to the areas with actively growing axons, The pattern of immunostaining for chondroitin sulfate in tissue sections suggested that the retinal axons might be a source for some of the chondroitin sulfate immunostaining in the developing visual pathway. This was confirmed in that chondroitin sulfate immunostaining was also observed on neurites emanating from cultured retinal explants. These findings indicate that retinal axons grow in the presence of chondroitin sulfate and keratan sulfate proteoglycans and that these proteoglycans in the developing chick visual pathway have functions other than to inhibit axon growth. © 1995 Wiley-Liss, Inc.

Synthesis of stromal glycosaminoglycans in response to injury

Abstract: Our goal is to examine the synthesis and deposition of corneal glycosaminoglycans (GAGs) in response to a wound created by the insertion of porous discs into stromal interlamellar pockets. The disc and the surrounding stromal tissue were assayed and compared to contralateral control stroma and to sham operated corneas at 14, 42, and 84 days. The tissue and/or discs were removed and labeled with 35S-sulfate for 18 h; GAGs were extracted with 4 M guanidine-HCl. Extracts were chromatographed on Q-Sepharose columns, bound proteoglycans were eluted with a linear salt gradient, and radioactive fractions were analyzed. Total GAG content was determined colorimetrically, using dimethylmethylene blue. Specific GAGs were determined using enzymatic digestion with selective polysaccharide lyases and protein cores were examined using SDS-PAGE. The nonbound fractions from the chromatography were assayed for TGF-beta using Western blot analysis and for hyaluronic acid using an 125I-radiometric assay. Specific GAGs were localized 42 days after the disc had been implanted in the stroma. The placement of the discs into the stroma resulted in a decrease in the total amount of GAG. However, the ratio of dermatan-chondroitin sulfate and heparan sulfate to keratan sulfate increased in the surrounding tissue and disc. Hyaluronic acid was elevated at day 14 in the surrounding tissue, and not until day 84 in the disc. Western blot analysis of surrounding tissue extracts revealed forms of TGF-beta that migrated with an apparent molecular mass of 63 and 43 kDa. The results indicate that the insertion of discs into interlamellar pockets causes changes in the sulfation and proportion of the glycosaminoglycans in the surrounding tissue and the disc. These changes are coincident with the appearance of TGF-beta. After 84 days, the population of glycosaminoglycans in the disc begins to resemble the surrounding stroma. This model will allow us to examine further the synthesis and deposition of proteins following an extensive wound in which cells must migrate to the wound site and then undergo extensive remodeling.

Sequence, molecular properties, and chromosomal mapping of mouse lumican.

Abstract: PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Distribution and changes of glycosaminoglycans in neoplasias of rectum.

Abstract: The content, composition and physicochemical characteristics of glycosaminoglycans in human rectum and rectum carcinoma were investigated by chemical analyses, enzymic treatments, chromatographic and electrophoretic techniques. The overall glycosaminoglycan content was increased about 2 fold in neoplastic tissues compared to nonneoplastic tissues. The absolute amounts of chondroitin sulfate, hyaluronic acid and dermatan sulfate significantly increased but the amounts of heparan sulfate decreased in neoplastic tissues compared with nonneoplastic tissues. In addition an increased fraction of keratan sulfate and undersulfated chondroitin was identified in neoplastic tissues. HPLC analysis of chondroitinase AC and ABC digests showed a marked increase in delta di-6S and delta di-OS disaccharides in tumor chondroitin sulfate, revealing significant alterations on the sulfation pattern. The results indicate that specific glycosaminoglycan alterations occur in human rectum carcinoma and suggest that proteoglycan metabolism is also altered in this carcinoma.

MMP-8 (neutrophil collagenase) mRNA and aggrecanase cleavage products are present in normal and osteoarthritic human articular cartilage.

Abstract: Osteoarthrosis is characterized by a progressive destruction of articular cartilage resulting from an imbalance of synthesis and degradation of aggrecan and collagen, the major matrix components. The process is governed by inflammatory episodes, thus the disease is called Osteoarthritis (OA). Aggrecan is a large proteoglycan (PG) which is responsible for the biomechanical function of the cartilage to withstand compressive loading. Aggrecan consists of a core protein to which chains of chondroitin and keratan sulfate are attached (Hascall 1988; Heinegard 1992). Cleavage of the core protein between the two globular domains at the animo terminal end results in loss of aggrecan from the cartilage and impaired function. A number of potential cleavage sites have been identified within the interglobular domain for different proteases including members of the family of matrix metalloproteinases (MMPs), lysosomal enzymes, plasmin, elastase and urokinase (Fosang et al. 1991; 1992; 1993). The predominant proteolytic...

Significance of the levels of carboxy terminal type II procollagen peptide, chondroitin sulfate isomers, tissue inhibitor of metalloproteinases, and metalloproteinases in osteoarthritis joint fluid.

Abstract: The joint fluid levels of several molecules that reflect the anabolism and catabolism of cartilage matrix and its inflammation were quantitated in patients with primary osteoarthritis (OA) and traumatic arthritis. The carboxy terminal type II procollagen increased in primary OA and traumatic arthritis joint fluid and was thought to be a good marker of the repair response of chondrocytes. We found that the increase of this molecule in the joint correlated well with body mass index in primary OA and the degree of cartilage erosion caused by joint instability in traumatic arthritis. Chondroitin 6-sulfate, an integral part of human aggrecan, was also high in OA and traumatic arthritis joint fluids, and showed a similar distribution with keratan sulfate in each disease group. Stromelysin-1 and tissue inhibitor of metalloproteinases-1 levels in joint fluid were very high in RA, but levels in patients with OA were low. Carboxy terminal type II procollagen appeared most sensitive in the evaluation of risk factors of OA such as obesity and joint instability, compared to other markers tested.

Localization of mouse lumican (keratan sulfate proteoglycan) to distal chromosome 10.

Abstract: Lumican, a member of the small interstitial proteoglycan gene (SIPG) family, is a keratan sulfate proteoglycan present in large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle (Hassell et al. 1993), skin (Chakravarti et al. submitted), and intervertebral discs (B. Johnstone, personal communication). Like decorin, another SIPG member, lumican also interacts with collagen and limits growth of fibrils in diameter (Rada et al. 1993; Scott 1988). In the cornea, lumican not only interacts with collagen molecules to limit fibril growth, but by virtue of its keratan sulfate-containing glycosaminoglycan side chains plays a crucial role in the regular spacing of fibrils and acquisition of corneal transparency (Scott 1991). The primary structure of lumican, derived from cDNA sequencing of chicken, bovine, and human clones, shows all the characteristic features of the SIPG family, namely, four and two cysteines in the Nand C-terminal globular domains, I and III, and a central, cysteine-free domain l_I, with 9 ~ sheet-forming leucine motifs (Blochberger et al. 1992; Funderburgh et al. 1993; Chakravarti et al. submitted). In the human, lumican localizes to Chromosome (Chr) 12q21.3-22 (Chakravarti et al. submitted). We report localization of the mouse lumican gene to distal Chr 10 by segregation analysis of restriction fragment length variants (RFLV) in recombinant inbred (RI) strains of mice. This study further extends the conservation of synteny between human Chr 12q21.3-22 and distal mouse Chr 10. We used a lumican coding sequence, PCR amplified from a mouse lumican genomic clone in Southern analyses for chromosome localization. Mouse genomic clones for lumican were obtained by screening a 129/Sv genomic DNA library (Stratagene) with a human lumican cDNA probe. The mouse lumican coding sequence was amplified from one of these genomic clones, with oligonucleotide primers that amplify nucleotides 263-681 from human lumican cDNA. PCR amplification yielded a product of expected size (primer pairs, upper 5'AGTGTACCAATGGTGCCTCCTG3' and lower 5 'CAGTCTGGCTATCTGATTGAAGCTC3'; PCR conditions: hold at 94~ 5 rain, cycle program 94~ 1 rain, 50~ anneal, extend at 72~ The nucleotide sequence of this PCR product (data not shown) yielded the derived amino acid sequence of 108 amino acids from the highly conserved central domain II of lumican sharing 96% identity with bovine, 93% identity with human, and 77% identity with chicken at the amino acid level (Funderburgh et al. 1993; Chakravarti et al. submitted; Blochberger et al. 1992). The mouse coding sequence was used to identify lumican

Keratan sulfate oligosaccharide fraction and drug containing the same

Abstract: A keratan sulfate oligosaccharide comprising a di- to penta-saccharide which has a sulfated N-acetylglucosamine at the reducing end and wherein at least two hydroxyl groups per molecule have been sulfated, preferably one containing a disaccharide of the formula Gal(6S)-G1cNAc(6S) (wherein Gal, G1cN, Ac and 6S represent, respectively, galactose, glucosamine, acetyl and 6-0-sulfate) as the constituent; and antiphlogistic agent, antiallergic agent, immunoregulator, cell differentiation inducer and apoptosis inducer each containing the above oligosaccharide and/or a pharmaceutically acceptable salt thereof as the active ingredient.

Highly sulphated glycosaminoglycans in articular cartilage and other tissues containing beta 2 microglobulin dialysis amyloid deposits.

Abstract: Background. Highly sulphated glycosaminoglycans (GAGs) are a common constituent of amyloid deposits and an integral component of auricular connective tissues where β 2 -microglobulin (β 2 M) amyloid is most often found. Methods. Using alcian blue, magnesium chloride, critical electrolyte concentration, mucin histochemistry, and immunohistochemistry, the GAGs composition of β 2 M amyloid deposits in joint capsule and cartilage, carpal, and heart tissues of 22 uraemic patients was determined. Results. Highly sulphated GAGs were found in β 2 M amyloid deposits not only within cartilage, where such GAGs are normally found in high concentration, but also in other articular and extra-articular connective tissues. Keratan sulphate was often specifically localized to β 2 M amyloid deposits in articular cartilage and to a lesser extent in periarticular tissues, with one case showing colocalization with systemic vascular amyloid deposition. Other sulphated GAGS, chondroitin 4 and 6 sulphate, dermatan sulphate, and heparan sulphate were also identified in tissues containing β 2 M amyloid deposits, but with the exception of heparan sulphate (identified by mucin histochemistry) were not specifically localized to the deposits themselves. Conclusions. These findings suggest that qualitative or quantitative changes in the composition of highly sulphated GAGs may play a role in localization of β 2 M amyloid deposits in articular and extra-articular tissues.

Proteoglycan Synthesis by Corneal Explants from Developing Embryonic Chicken

Abstract: Proteoglycan biosynthesis in developing chicken corneas was studied. Corneas free of scleral rims were prepared from 5- to 18-day-old chick embryos and labeled in vitro with [3H]glucosamine and [35S]sulfate. Then, the labeled medium and corneal proteoglycans were analyzed. Day 5 corneas synthesized mainly chondroitin sulfate/dermatan sulfate proteoglycan and a sudden increase in keratan sulfate proteoglycan synthesis was found on Day 7. Keratan sulfate proteoglycan in Day 7 cornea appeared to be synthesized by fibroblasts which invaded the stroma between Day 5 and Day 7. The proportion of keratan sulfate proteoglycan synthesis increased with advancing embryonic age until Day 14 and declined a little on Day 18. The relative proportion of chondroitin sulfate/dermatan sulfate proteoglycan synthesis changed in a reverse curve during Day 7 to Day 18. Because embryonic cornea begins to become transparent on Day 14, this change in proteoglycan synthesis may be correlated with the onset of transparency. The labeled glycosaminoglycans were isolated from cultured embryonic corneas by pronase digestion, and then digested with chondroitinase ABC or keratanase II. Disaccharides in the enzymatic digests were analyzed by HPLC, and the extents and positions of sulfation of proteoglycans were determined. Sulfation of keratan sulfate proteoglycan continued to increase with advancing age until Day 18. Moreover, it has been shown by HPLC of unsaturated disaccharides of chondroitinase ABC digests that, whereas a comparable amount of non-sulfated "chondroitin sulfate/dermatan sulfate" was synthesized during Day 7 to Day 9, its amount declined during late development (Day 12 to Day 18). Such increases in sulfation of proteoglycans with advancing age may be correlated with progress of corneal transparency, which begins on Day 14 and continues until hatching. Analysis of proteoglycans of the culture medium has shown that most of the medium proteoglycans were keratan sulfate proteoglycan and free keratan sulfate chain (or keratan sulfate chain with a short peptide) during all ages after Day 7, although the major proteoglycan of Day 5 medium was chondroitin sulfate/dermatan sulfate proteoglycan. Sulfation of medium keratan sulfate also increased with advancing age. In addition, the proportion of free keratan sulfate chain in the medium increased during late corneal development, suggesting that catabolism of keratan sulfate proteoglycan might be preferentially accelerated during those times.

Nitrous acid degradation of glycosaminoglycans.

Abstract: Glycosaminoglycans (GAGs) are made up of disaccharide units that are distinguished from each other by the monosaccharide units of which they are composed and by the degree and position of sulfation. These disaccharide units represent the monomeric units of the GAG; thus, measurement of the disaccharide composition of a GAG represents the first step in the characterization of the polymer. In this unit, cleavage of the glycosidic bonds of the N-sulfated GlcN residues in heparin and heparan sulfate is described, in addition to cleavage of the bonds between the N-acetylated amino sugar residues in heparin, heparan sulfate, chondroitin sulfate, dermatan sulfate, and keratan sulfate, and hyaluronic acid. Using these procedures involving, all GAGs can be converted completely to their constituent disaccharides and reduced with NaB[3H]4) to yield labeled disaccharides that can be assayed qualitatively or quantitatively. The procedure may also be used to analyze metabolically labeled GAGs (with or without the use of NaB[3H]4).

Localized amyloid deposition in cartilage is glycosaminoglycans-associated.

Abstract: Localized amyloid deposition is known to occur commonly in the articular cartilage of elderly patients. Its pathogenesis is uncertain and it is not known if other cartilage-containing tissues also contain amyloid deposits. Systemic amyloid deposits are known to contain highly sulphated glycosaminoglycans, a major constituent of cartilage. As the composition of articular cartilage glycosaminoglycans is known to change with age, we sought to identify whether localized amyloid deposition in cartilage was glycosaminoglycan-related. We examined specimens of articular cartilage over a wide age range and also examined a variety of cartilaginous tumours and tumour-like lesions for the presence or absence of amyloid deposits. Using mucin histochemistry (alcian blue: MgCl2 critical electrolyte concentration) and immunohistochemistry, we found that highly sulphated glycosaminoglycans (0.9 M and 1 M MgCl2), in particular keratan sulphate, localized to amyloid deposits in both articular cartilage and loose bodies derived from the articular surface. Other cartilaginous lesions (including loose bodies of primary synovial chondromatosis) were negative for amyloid and did not contain highly sulphated glycosaminoglycans. These findings suggest that changes in specific highly sulphated glycosaminoglycans may play a role in localized amyloid deposition in articular cartilage.