Keratan sulfate

About: Keratan sulfate is a research topic. Over the lifetime, 1253 publications have been published within this topic receiving 57984 citations. The topic is also known as: keratan sulfate & KS.

Biochemical, histochemical, and immunohistochemical characterization of distal tibial osteochondrosis in horses.

Abstract: OBJECTIVE To compare the biochemical, histochemical, and immunohistochemical profiles of articular cartilage from horses with naturally acquired distal tibial osteochondrosis (OC) with cartilage from a similar location in clinically normal horses. ANIMALS 9 affected horses (group 1, 16 OC lesions) and 4 control horses (group 2, 8 normal osteochondral specimens). PROCEDURE OC specimens were collected during arthroscopic removal of the fragment, and control specimens were collected by aseptic osteotomy. Uronic acid, total protein, total glycosaminoglycan (GAG), chondroitin sulfate (CS), and keratan sulfate (KS) contents were determined. Histomorphologic, histochemical, and immunohistochemical examinations were performed on specimens after snap freezing at -80 C and cryosectioning. Monoclonal antibodies (MAB) 3B3 and 5D4 were applied for location of epitopes of CS and KS, respectively. RESULTS OC lesions had significantly lower quantity of uronic acid, total GAG, and CS, compared with normal cartilage. OC cartilage had significantly less intense staining with toluidine blue, along with irregular cellularity and tidemark characteristics, compared with normal cartilage. Monoclonal antibodies 3B3 and 5D4 stained OC cartilage, whereas MAB 5D4 did not stain control cartilage. Additionally, MAB 3B3 and 5D4 stained the fibrous tissue that was found firmly attached to the OC lesion located between the parent distal portion of the tibia and OC fragment. CONCLUSION OC cartilage lesions of the distal intermediate ridge of the tibia in horses are biochemically, histochemically, and immunohistochemically distinct from normal cartilage from the same location. Results may reflect the inability of the chondrocyte of the developing joint to alter matrix components that would allow proper maturation and differentiation into bone.

O-Linked glycome and proteome of high-molecular-mass proteins in human ovarian cancer ascites: Identification of sulfation, disialic acid and O-linked fucose.

Abstract: The O-linked glycosylation of the main acidic high-molecular-weight glycoprotein from ascites fluid from patients with ovarian cancer were analyzed. The O-linked oligosaccharides were shown to consist of mainly highly sialylated core 1 and 2 structures with a smaller amount of sulfated core 2 structures. These structures were shown to be able to be further extended into small keratan sulfate (KS)-type oligosaccharides with up to four N-acetyllactosamine units. Proteomic studies of the acidic fraction of ascites fluid from patients with ovarian cancer showed that this fraction was enriched in proteoglycans. Among them, lumican, agrin, versican and dystroglycans were potential candidates, with threonine- and serine-rich domains that could carry a significant amount of O-linked glycosylation, including also the O-linked KS. Glycomic analysis using liquid chromatography (LC)-tandem mass spectrometry (MS/MS) also showed that the disialic acid NeuAc-NeuAc- was frequently found as the terminating structure on the O-linked core 1 and 2 oligosaccharides from one ascites sample. Also, a small amount of the epidermal growth factor (EGF)-associated O-linked fucose structure Gal-GlcNAc-Fucitol was detected with and without sialic acid in the LC-MS/MS analysis. Candidate proteins containing O-linked fucose were suggested to be proteoglycan-type molecules containing the O-linked fucose EGF consensus domain.

Involvement of host cell heparan sulfate proteoglycan in Trypanosoma cruzi amastigote attachment and invasion

Abstract: Cell surface glycosaminoglycans (GAGs) play an important role in the attachment and invasion process of a variety of intracellular pathogens. We have previously demonstrated that heparan sulfate proteoglycans (HSPG) mediate the invasion of trypomastigote forms of Trypanosoma cruzi in cardiomyocytes. Herein, we analysed whether GAGs are also implicated in amastigote invasion. Competition assays with soluble GAGs revealed that treatment of T. cruzi amastigotes with heparin and heparan sulfate leads to a reduction in the infection ratio, achieving 82% and 65% inhibition of invasion, respectively. Other sulfated GAGs, such as chondroitin sulfate, dermatan sulfate and keratan sulfate, had no effect on the invasion process. In addition, a significant decrease in infection occurred after interaction of amastigotes with GAG-deficient Chinese Hamster Ovary (CHO) cells, decreasing from 20% and 28% in wild-type CHO cells to 5% and 9% in the mutant cells after 2 h and 4 h of infection, respectively. These findings suggest that amastigote invasion also involves host cell surface heparan sulfate proteoglycans. The knowledge of the mechanism triggered by heparan sulfate-binding T. cruzi proteins may provide new potential candidates for Chagas disease therapy.

Localization of mouse lumican (keratan sulfate proteoglycan) to distal chromosome 10.

Abstract: Lumican, a member of the small interstitial proteoglycan gene (SIPG) family, is a keratan sulfate proteoglycan present in large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle (Hassell et al. 1993), skin (Chakravarti et al. submitted), and intervertebral discs (B. Johnstone, personal communication). Like decorin, another SIPG member, lumican also interacts with collagen and limits growth of fibrils in diameter (Rada et al. 1993; Scott 1988). In the cornea, lumican not only interacts with collagen molecules to limit fibril growth, but by virtue of its keratan sulfate-containing glycosaminoglycan side chains plays a crucial role in the regular spacing of fibrils and acquisition of corneal transparency (Scott 1991). The primary structure of lumican, derived from cDNA sequencing of chicken, bovine, and human clones, shows all the characteristic features of the SIPG family, namely, four and two cysteines in the Nand C-terminal globular domains, I and III, and a central, cysteine-free domain l_I, with 9 ~ sheet-forming leucine motifs (Blochberger et al. 1992; Funderburgh et al. 1993; Chakravarti et al. submitted). In the human, lumican localizes to Chromosome (Chr) 12q21.3-22 (Chakravarti et al. submitted). We report localization of the mouse lumican gene to distal Chr 10 by segregation analysis of restriction fragment length variants (RFLV) in recombinant inbred (RI) strains of mice. This study further extends the conservation of synteny between human Chr 12q21.3-22 and distal mouse Chr 10. We used a lumican coding sequence, PCR amplified from a mouse lumican genomic clone in Southern analyses for chromosome localization. Mouse genomic clones for lumican were obtained by screening a 129/Sv genomic DNA library (Stratagene) with a human lumican cDNA probe. The mouse lumican coding sequence was amplified from one of these genomic clones, with oligonucleotide primers that amplify nucleotides 263-681 from human lumican cDNA. PCR amplification yielded a product of expected size (primer pairs, upper 5'AGTGTACCAATGGTGCCTCCTG3' and lower 5 'CAGTCTGGCTATCTGATTGAAGCTC3'; PCR conditions: hold at 94~ 5 rain, cycle program 94~ 1 rain, 50~ anneal, extend at 72~ The nucleotide sequence of this PCR product (data not shown) yielded the derived amino acid sequence of 108 amino acids from the highly conserved central domain II of lumican sharing 96% identity with bovine, 93% identity with human, and 77% identity with chicken at the amino acid level (Funderburgh et al. 1993; Chakravarti et al. submitted; Blochberger et al. 1992). The mouse coding sequence was used to identify lumican