Showing papers on "Leaf spot published in 2012"

Leaf microbiota in an agroecosystem: spatiotemporal variation in bacterial community composition on field-grown lettuce.

Abstract: The presence, size and importance of bacterial communities on plant leaf surfaces are widely appreciated. However, information is scarce regarding their composition and how it changes along geographical and seasonal scales. We collected 106 samples of field-grown Romaine lettuce from commercial production regions in California and Arizona during the 2009-2010 crop cycle. Total bacterial populations averaged between 10(5) and 10(6) per gram of tissue, whereas counts of culturable bacteria were on average one (summer season) or two (winter season) orders of magnitude lower. Pyrosequencing of 16S rRNA gene amplicons from 88 samples revealed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria were the most abundantly represented phyla. At the genus level, Pseudomonas, Bacillus, Massilia, Arthrobacter and Pantoea were the most consistently found across samples, suggesting that they form the bacterial 'core' phyllosphere microbiota on lettuce. The foliar presence of Xanthomonas campestris pv. vitians, which is the causal agent of bacterial leaf spot of lettuce, correlated positively with the relative representation of bacteria from the genus Alkanindiges, but negatively with Bacillus, Erwinia and Pantoea. Summer samples showed an overrepresentation of Enterobacteriaceae sequences and culturable coliforms compared with winter samples. The distance between fields or the timing of a dust storm, but not Romaine cultivar, explained differences in bacterial community composition between several of the fields sampled. As one of the largest surveys of leaf surface microbiology, this study offers new insights into the extent and underlying causes of variability in bacterial community composition on plant leaves as a function of time, space and environment.

Hyperspectral imaging for small-scale analysis of symptoms caused by different sugar beet diseases.

Abstract: Hyperspectral imaging (HSI) offers high potential as a non-invasive diagnostic tool for disease detection. In this paper leaf characteristics and spectral reflectance of sugar beet leaves diseased with Cercospora leaf spot, powdery mildew and leaf rust at different development stages were connected. Light microscopy was used to describe the morphological changes in the host tissue due to pathogen colonisation. Under controlled conditions a hyperspectral imaging line scanning spectrometer (ImSpector V10E) with a spectral resolution of 2.8 nm from 400 to 1000 nm and a spatial resolution of 0.19 mm was used for continuous screening and monitoring of disease symptoms during pathogenesis. A pixel-wise mapping of spectral reflectance in the visible and near-infrared range enabled the detection and detailed description of diseased tissue on the leaf level. Leaf structure was linked to leaf spectral reflectance patterns. Depending on the interaction with the host tissue, the pathogens caused disease-specific spectral signatures. The influence of the pathogens on leaf reflectance was a function of the developmental stage of the disease and of the subarea of the symptoms. Spectral reflectance in combination with Spectral Angle Mapper classification allowed for the differentiation of mature symptoms into zones displaying all ontogenetic stages from young to mature symptoms. Due to a pixel-wise extraction of pure spectral signatures a better understanding of changes in leaf reflectance caused by plant diseases was achieved using HSI. This technology considerably improves the sensitivity and specificity of hyperspectrometry in proximal sensing of plant diseases.

Combined expression of a barley class II chitinase and type I ribosome inactivating protein in transgenic Brassica juncea provides protection against Alternaria brassicae

Abstract: Alternaria leaf spot caused by Alternaria brassicae, or A. brassicola, is one of the major fungal diseases of Brassica juncea (Indian mustard). To develop resistance against this fungal disease, the barley antifungal genes class II chitinase (AAA56786) and type I ribosome inactivating protein (RIP; AAA32951) were coexpressed in Indian mustard via Agrobacterium-mediated transformation. The stable integration and expression of transgenes in T0 plants were confirmed by Southern blot and Western analysis. The transgenic lines showing inheritance in Mendalian fashion (3:1) were further evaluated by in vitro studies and under greenhouse conditions for resistance to the A. brassicae fungal pathogen. The transgenic plants showed up to 44% reduction in A. brassicae hyphal growth in in vitro antifungal assays. In green house screening, the transgenic plants sprayed with A. brassicae spores showed resistance through delayed onset of the disease and restricted number, size, and expansion of lesions as compared to wild type plants. These results indicate that the expression of chitinase and RIP from a heterologous source in B. juncea provide subsequent protection against Alternaria leaf spot disease and can be helpful in increasing the production of Indian mustard.

Chilling stress--the key predisposing factor for causing Alternaria alternata infection and leading to cotton (Gossypium hirsutum L.) leaf senescence.

Abstract: Leaf senescence plays a vital role in nutrient recycling and overall capacity to assimilate carbon dioxide. Cotton premature leaf senescence, often accompanied with unexpected short-term low temperature, has been occurring with an increasing frequency in many cotton-growing areas and causes serious reduction in yield and quality of cotton. The key factors for causing and promoting cotton premature leaf senescence are still unclear. In this case, the relationship between the pre-chilling stress and Alternaria alternata infection for causing cotton leaf senescence was investigated under precisely controlled laboratory conditions with four to five leaves stage cotton plants. The results showed short-term chilling stress could cause a certain degree of physiological impairment to cotton leaves, which could be recovered to normal levels in 2–4 days when the chilling stresses were removed. When these chilling stress injured leaves were further inoculated with A. alternata, the pronounced appearance and development of leaf spot disease, and eventually the pronounced symptoms of leaf senescence, occurred on these cotton leaves. The onset of cotton leaf senescence at this condition was also reflected in various physiological indexes such as irreversible increase in malondialdehyde (MDA) content and electrolyte leakage, irreversible decrease in soluble protein content and chlorophyll content, and irreversible damage in leaves' photosynthesis ability. The presented results demonstrated that chilling stress acted as the key predisposing factor for causing A. alternata infection and leading to cotton leaf senescence. It could be expected that the understanding of the key factors causing and promoting cotton leaf senescence would be helpful for taking appropriate management steps to prevent cotton premature leaf senescence.

First Report of Glomerella Leaf Spot of Apple Caused by Glomerella cingulata in China.

Abstract: A new destructive apple disease, causing black spots and necrotic lesions on leaves and defoliation on cvs. Gala and Golden Delicious (Malus × domestica Borkh.), was observed in August 2011 in Fengxian, Jiangsu Province, China. More than 90% of trees of those cultivars in the area were defoliated by the disease and almost no leaves were left on trees before harvest. The disease was similar to Glomerella leaf spot reported first in Brazil in 1988 (2) and in the United States in 1998 (1) on cvs. Gala and Golden Delicious. The initial symptom was small black lesions on leaves. Above 30°C, the lesions developed quickly and grew to 2 to 3 cm, with a blurred edge. Diseased leaves became dark and were shed. At lower temperatures, the black lesions stopped enlarging after 5 to 6 days and formed large necrotic spots with clear edges; these leaves gradually grew yellow and were shed. When incubated at 30°C and 100% relative humidity for 1 to 2 days, the black lesions produced a mass of saffron-yellow conidia. On fruit, the pathogen only caused circular, necrotic, sunken, red-bordered lesions 2 to 3 mm in diameter, which was different from bitter rot. Three monospored cultures were isolated from diseased leaves and new conidia were obtained from isolates. The colony, with abundant mycelium, was white but turned gray to black. Conidia were 12 to 17 × 5 to 7 μm, and were cylindrical with rounded ends. After germination, conidia formed appressoria, oval, or circular cells with black thick walls 7 to 12 × 5 to 7 um. Based on morphological characteristics, the pathogen was putatively identified as Glomerella cingulata. The conidia were inoculated in vitro on leaves of cvs. Gala and Fuji by dripping a suspension of about 104 conidia/ml of water onto upper leaf surfaces. Dark necrotic lesions were observed on all inoculated Gala leaves, which were similar to those observed in orchards, after 4 days incubation in a chamber at 30°C with 100% humidity. Only small black lesions, about 1 to 2 mm in diameter, were observed on Fuji leaves. No symptoms developed on leaves inoculated with distilled water. The internal transcribed spacer (ITS) region of ribosomal DNA and part of the 18S and 28S ribosomal RNA of the three isolates were amplified with the universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-CCTCCGCTTATTGATATGC-3'). The amplified ITS sequences confirmed that the three isolates belonged to the same species, with only one base pair variation among sequences. The nucleotide sequence of isolate 1 and 2 was deposited in GenBank (JN714400 and JN714401). BLAST analysis showed that the sequence had 99% homology with the sequence of G. cingulata (EU008836), the causal agent of Glomerella leaf spot. However, the sequence of isolate 1 had 100% homology with that of G. cingulata (HQ845103.1) isolated from walnut in Shandong, China, while the sequence of isolate 2 had 100% homology with that of G. cingulata (HM015004.1) isolated from sweet pepper in Taiwan. Results suggested the disease is Glomerella leaf spot and the causal agent is G. cingulata. The disease will eliminate sensitive apple cultivars, such as Gala, from wet, warm production areas if effective control measures are not developed within a few years. To our knowledge, this was the first finding of the disease in China and will provide useful information for developing effective control strategies. References: (1) E. Gonzalez and T. B. Sutton. Plant Dis. 83:1074, 1999. (2) T. B. Sutton and R. M. Sanhueza. Plant Dis. 82:267, 1998.

Enhance Resistance to Alternaria Alternata Causing Potato Brown Leaf Spot Disease by Using Some Plant Defense Inducers

Abstract: Host resistance is an efficient and effective component in integrated management of plant diseases. The aim of this study was to test whether Acibenzolar-S-methyl (ASM), Chitosan, Heads-up and Acetyl Salicylic Acid (ASA), known to induce resistance against various diseases, can help protect potato crop against brown leaf spot. The effect of these inducers, on two potato cultivars, Goldrush and FL1879 against Alternaria alternata, causal agent of brown leaf spot at two different field sites were evaluated. To determine the effects of the application of inducers on disease resistance, the foliage of the potato cultivars was sprayed with appropriate concentrations of ASA, chitosan, and ASM. Heads-up was also applied as a pre-plant treatment on potato tubers. The results obtained from the both field experiments indicated the highest yield performance was achieved in plots treated with ASM, followed by Heads-up and chitosan treat- ments. However, no significant difference in terms of tuber yield production has been noted between ASA treated potato foliage, and the untreated control plants. Results of experiments with detached leaves showed that there was a significant difference regarding disease index reduction between plots which been treated with defense inducers and untreated, inoculated plots. It was clear that on both po- tato cultivars, application of chitosan and ASM encouraged enhancement of the disease resistance compared to the ASA and Heads-up treatments. In the laboratory experiment, disease progress was recorded on leaves from three different heights of the crop canopy. The results indicated that disease severity was low in the apex, moderate in the middle and high in the lower parts of the crop, in both potato cultivars. These results suggest that chitosan and ASM may offer alternative methods for controlling brown leaf spot of potato.

Bioefficacy of some plant extracts on growth parameters and control of diseases in Lycopersicum esculentum

Abstract: The present study was undertaken to determine the effect of some medicinal plants on growth parameters and diseases, like alternaria canker, blight, leafspot, fruitspot, blossom end rot and sunscald of Lycopersicum esculentum. To understand the mechanism, the phytochemical analysis of plants and its effect on bacterial and fungal cultures were investigated. The effects of selected plant extracts on tomato were observed. Ten medicinal plants were applied for the control of diseases, and its antibacterial and antifungal effect was tested against Clavibacter michigenesis, Alternaria solani, and Septoria lycopersici, Pythium debaryanumand and Phytopthora capsici that cause alternaria canker,early blight, leaf spot, fruit spot, blossom end rot and sunscald disease in Lycopersicum esculentum..Extract of Ageratum.conyzoides was efficient in inhibiting the growth of Clavibacter michigenesis while mycelial growth of Alternaria solani,Septoria lycopersici,Pythium debaryanum & Phytopthora capsici was inhibited by Tagetes patula, Piper nigrum, Aegle marmelos & Ageratum conyzoides.Among the plant extract tested in field, Ageratum.conyzoides was found most effective in reducing the Alternaria canker disease by 78.20% and Azadirachta.indica reduced the Early blight & leaf spot disease by 53.84% & 40.78%respectivilly,Aegle marmelos reduced the fruit spot disease by 61.29%.Pongamia pinata & Brassica campestris reduced the Blossom end rot disease by 86.95% and 82.17% and Ageratum.conyzoides& Pongmia pinata reduced the sunscald disease by90.08% & 76.85% respectively in Lycopersicum esculentum. The result suggests the applications are also growth promotive and cost effective and non-hazardous in agro-ecosystem.

Suppression of Fungal and Bacterial Diseases of Cucumber Plants by Using the Spent Mushroom Substrate of Lyophyllum decastes and Pleurotus eryngii

Abstract: The protective effect of autoclaved water extract from spent mushroom substrate (AWESMS) and autoclaved spent mushroom substrate (ASMS) of the edible mushrooms Lyophyllum decastes (hatakeshimeji) and Pleurotus eryngii (eringi) against fungal and bacterial diseases was investigated on cucumber plants. When the plants were treated with AWESMS by spraying the first true leaves and inoculated with the target pathogen 7 days later, AWESMS of hatakeshimeji significantly reduced powdery mildew by Podosphaera xanthii, angular leaf spot by Pseudomonas syringae pv. lachrymans, but not Corynespora leaf spot by Corynespora cassiicola and scab by Cladosporium cucumerinum. When the plants were grown in a mixture (1 : 2, v ⁄ v) of ASMS of hatakeshimeji and soil, a significant disease reduction was observed in powdery mildew, scab and angular leaf spot. The protective effect was also observed against anthracnose on plants treated with AWESMS or on plants grown in a mixture of ASMS of eringi (1 : 3, v ⁄ v). Our results indicated that AWESMS and ASMS, independently of the mushroom type, provide a protective effect against fungal and bacterial diseases. Therefore, SMS should be considered an easily available source of active compounds to protect plants from fungal and bacteria infections, helping alleviate the waste disposal problem in the mushroom industry and creating an environmentally friendly method to reduce plant pathogens.

Increased resistance to late leaf spot disease in transgenic peanut using a combination of PR genes

Abstract: Peanut (Arachis hypogaea L.) is the sixth most important oil seed crop in the world. Yield loss due to Cercospora leaf spot (early and late leaf spots) is a serious problem in cultivating this crop. Non-availability of resistant genes within crossable germplasms of peanut necessitates the use of a genetic engineering strategy to develop genetic resistance against various biotic stresses. The pathogenesis-related (PR) proteins are a group of plant proteins that are toxic to invading fungal pathogens, but are present in trace amounts in plants. The PR proteins, PR-5 and defensins, are potent antifungal proteins. A double gene construct with SniOLP (Solanum nigrum osmotin-like protein) and Rs-AFP2 (Raphanus sativus antifungal protein-2) genes under separate constitutive 35S promoters was used to transform peanut plants. Transgenic peanut plants expressing the SniOLP and Rs-AFP2 genes showed enhanced disease resistance to late leaf spot based on a reduction in number and size of lesions on leaves and delay in the onset of Phaeoisariopsis personata leaf spot disease. PCR, RT–PCR, and Southern hybridization analyses confirmed stable integration and expression of these genes in peanut transgenics. The results demonstrate the potential of SniOLP and Rs-AFP2 genes in developing late leaf spot disease resistance in transgenic peanut.

Genera of diaporthalean coelomycetes associated with leaf spots of tree hosts

Abstract: Four different genera of diaporthalean coelomycetous fungi associated with leaf spots of tree hosts are morphologically treated and phylogenetically compared based on the DNA sequence data of the large subunit nuclear ribosomal DNA gene (LSU) and the internal transcribed spacers and 5.8S rRNA gene of the nrDNA operon. These include two new Australian genera, namely Auratiopycnidiella, proposed for a leaf spotting fungus occurring on Tristaniopsis laurina in New South Wales, and Disculoides, proposed for two species occurring on leaf spots of Eucalyptus leaves in Victoria. Two new species are described in Aurantiosacculus, a hitherto monotypic genus associated with leaf spots of Eucalyptus in Australia, namely A. acutatus on E. viminalis, and A. eucalyptorum on E. globulus, both occurring in Tasmania. Lastly, an epitype specimen is designated for Erythrogloeum hymenaeae, the type species of the genus Erythrogloeum, and causal agent of a prominent leaf spot disease on Hymenaea courbaril in South America. All four genera are shown to be allied to Diaporthales, although only Aurantiosacculus (Cryphonectriaceae) could be resolved to family level, the rest being incertae sedis.

Five Species of Xanthomonads Associated with Bacterial Leaf Spot Symptoms in Tomato from Tanzania.

Abstract: From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 μl of sterile distilled water and 50 μl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5'GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5'CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Quantitative phenotyping of grey leaf spot disease in maize using real-time PCR

Abstract: Grey leaf spot is an important maize foliar disease caused by the fungal pathogens Cercospora zeae-maydis and Cercospora zeina. Although methods exist to detect these Cercospora species in maize, current techniques do not allow quantification of the fungi in planta. We developed a real-time SYBR® Green PCR assay for quantification of grey leaf spot disease in maize based on the amplification of a fragment of a cytochrome P450 reductase (cpr1) gene. In planta fungal DNA content was normalised to a maize glutathione S-transferase III gene (gst3) to yield values of ng Cercospora DNA/mg maize DNA. The assay was specific to the two Cercospora spp., and we observed no amplification of the cpr1 fragment in non-target maize leaf pathogens or saprophytes. The assay was employed to quantify C. zeina in glasshouse inoculated maize plants and grey leaf spot infected field plants of resistant and susceptible maize lines. In both instances, C. zeina DNA content correlated with symptomatic leaf lesion area, and the susceptible maize line contained significantly more C. zeina DNA than the resistant line. Sequence differences between the C. zeina and C. zeae-maydis cpr1 amplicons enabled us to perform melt curve analyses to identify the Cercospora species causing grey leaf spot at a particular location. This assay has application in the early detection and quantification of Cercospora spp., both of which are important tools in grey leaf spot disease management and maize breeding programmes.

First Report of Target Spot Caused by Corynespora cassiicola on Cotton in Georgia

Abstract: In 2005, crop consultants in southwestern Georgia reported an unusual occurrence of leaf spot in cotton (Gossypium hirsutum L.). Initial symptoms first developed as brick red dots that led to the formation of irregular to circular lesions with tan-to-light brown centers. Lesions further enlarged and often demonstrated a targetlike appearance formed from concentric rings within the spot. Observations included estimates of premature defoliation up to 70%, abundant characteristic spots on the leaves and bracts, and losses of several hundred kg of lint/ha. When symptomatic leaves were submitted to the University of Georgia Tifton Plant Disease Clinic in Tifton, GA, for identification in 2008, the causal agent was tentatively diagnosed as Corynespora cassiicola (Berk. & M.A. Curtis) C.T. Wei on the basis of similar symptoms and signs previously reported on cotton (3). In September 2011, symptomatic leaves were obtained from diseased cotton within a field (var. DP 1048B2RF) near Attapulgus, GA. Symptomatic tissue from diseased leaves was surface disinfested in 0.5% sodium hypochlorite for 1 min and plated on potato dextrose agar (PDA). Ten isolates were incubated at 21.1°C for 2 weeks with a 12/12 h light/dark cycle using fluorescent light located approximately 70 cm above the cultures. After 1 week, two isolates were transferred to quarter strength PDA for enhanced sporulation and were grown under the same conditions. Conidiophores from the isolated fungus were simple, erect, intermittently branching and septate, and gave rise to single, subhyaline conidia. Conidia had 4 to 17 pseudosepta and were 50 to 197 μm long and 7 to 16 μm wide, straight to curved, and obclavate to cylindrical. Pathogenicity tests were conducted by spraying 10 cotton seedlings (DP 555BR and DP 1048B2RF, two to four true leaf stage) until runoff with a blended suspension from a 2-week-old pure culture of the fungus diluted with 100 mL of sterile water. Five plants were sprayed with sterile water as noninoculated controls. Cotton seedlings were then incubated in a moist chamber at 21.1°C for 48 h. Within 1 week, all inoculated plants showed symptoms similar to those of diseased field plants. Symptoms were not observed on noninoculated control plants. The fungus was reisolated five times from symptomatic leaves and grown in pure culture. Conidia and conidiophores were identical to the morphology of the original isolates, and were similar to descriptions of C. cassiicola (2). To confirm the identity of the pathogen, DNA was extracted from a week-old culture and amplified with specific primers for loci "ga4" and "rDNA ITS" (1). DNA sequences obtained with the Applied Biosystems 3730xl 96-capillary DNA Analyzer showed 99% identity to C. cassiicola from BLAST analysis in GenBank. The resulting sequence was deposited into GenBank (Accession No. JQ717069). To our knowledge, this is the first report of this pathogen in Georgia. Given the increasing prevalence of this disease in southwestern Georgia, its confirmation is a significant step toward management recommendations for growers. Because foliar diseases caused by C. cassiicola are commonly referred to as "target spot" in other crops (e.g., soybeans), it is proposed that Corynespora leaf spot of cotton be known as "target spot of cotton." References: (1) L. J. Dixon et al. Phytopathology 99:1015, 2009. (2) M. B. Ellis and P. Holliday. CMI Description of Pathogenic Fungi and Bacteria, 303, 1971. (3) J. P. Jones. Phytopathology 51:305, 1961.

First Report of Cylindrocladium pseudonaviculatum Causing Leaf Spot of Pachysandra terminalis.

Abstract: Cylindrocladium pseudonaviculatum Crous, J.Z., Groenew. & C.F. Hill 2002 was recently reported infecting common boxwood, Buxus sempervirens L., in Connecticut (2). We isolated the pathogen from leaf and stem lesions of B. sempervirens and obtained single-spored cultures on half-strength potato dextrose agar (½PDA). The pathogen was identified as C. pseudonaviculatum by morphological characteristics (1). Colony size reached 71 mm in diameter after 14 days at room temperature on ½PDA, and was fluffy with white aerial hyphae, mars brown, and reverse color chestnut brown at the center fading to pale brown forming concentric bands. Macroconidiophores were solitary or in a group of up to three, comprised a stipe, a sterile elongation, and one to three penicillate fertile branches. The stipe was up to nine septate, 90 to 250 μm long, colorless, smooth, terminating in a naviculate or broadly ellipsoidal vesicle with a pointed or papillate apex, and 27 to 50 × 6.5 to 9 μm. Primary branches were zero- to one-septate, 20 to 36 × 4 to 5 μm; secondary branches were aseptate and 11 to 20 × 3 to 4.5 μm; tertiary branches were rare, each terminal branch producing two to five phialides; phialides were doliiform or reniform, colorless, 12 to 18 μm. Conidia were cylindrical, rounded at both ends, straight, smooth, colorless, two-celled, 48 to 55 × 4.5 to 5.5 μm, and in colorless slimy cylindrical clusters. Microconidiophores were not observed. Chlamydospores were golden to dark brown, thick-walled, and smooth or rough. Microsclerotia were present on ½PDA. Primers T1 and T22 (3) were used to amplify a portion of the β-tubulin gene from isolates Cps-CT-L1 and Cps-CT-S1. Amplified sequences were used in a BLAST search against the GenBank database to demonstrate 100% sequence identity only with other C. pseudonaviculatum strains. Both sequences were deposited in GenBank (Accession Nos. JQ866628 and JQ866629), using corresponding gene data from C. pseudonaviculatum strain STE-U 3399 (GenBank Accession No. AF449455) to distinguish coding from noncoding regions. Healthy plants of Japanese spurge, Pachysandra terminalis, with three plants per 10 cm diameter pot, were inoculated with water alone or a conidial suspension of C. pseudonaviculatum isolate Cps-CT-L1 (ATCC MYA-4891) (1.0 × 106 conidia/plant) with a handheld sprayer until runoff. Plants were kept moist in a plastic bag for 48 h at laboratory temperature and then transferred to the greenhouse. Circular lesions (1- to 4-mm diameter) were evident on leaves after 10 days. All 12 inoculated plants developed lesions, and no lesions were observed on noninoculated plants. Leaves with lesions were surface sterilized in 0.5% NaOCl for 30 s, rinsed twice in sterile water, and lesion margins plated onto water agar or ½PDA. The pathogen was reisolated from at least one leaf per plant. Koch's postulates were performed again with isolate Cps-CT-S1 (ATCC MYA-4890). After 3 weeks, many of the leaves with lesions yellowed and dropped to the soil surface and heavy sporulation of C. pseudonaviculatum and microsclerotia were observed. To our knowledge, this is the first report of C. pseudonaviculatum causing a leaf spot disease on P. terminalis. Pachysandra is a widely grown ground cover suitable for shady, humid environmental conditions that may be conducive for the development of disease. References: (1) P. Crous, et al. Sydowia 54:23, 2002. (2) K. Ivors et al. Plant Disease. 96:X, 2012. (3) K. O'Donnell and E. Cigelnik Mol. Phylogenet. Evol. 7:103, 1997.

Epidemiology of the Groundnut (Arachis hypogaea L.) Leaf Spot Disease: Genetic Analysis and Developmental Cycles

Abstract: Groundnut leaf spot is one of the important factors limiting groundnut productivity in Africa particularly in the Democratic Republic of Congo (DR Congo). Early and late leaf spot disease of groundnut caused by Cercospora arachidicola Hori and Cercosporidium personatum (Berk & Curt.) Deighton, respectively, can cause considerable yield losses without fungicide management. The main objectives of this research were to analyze plant and disease developmental cycles. Significant differences were observed among the groundnut varieties evaluated for resistance to the leaf spot disease. The results show that plant development cycle can be divided into three developmental stages. A first stage characterized by a low production of leaves, a second stage with a significant leaf development and finally a third stage with a reduction of leaves. Interestingly, the leaf spot disease cycle was also divided in three stages. The disease stage characterized by the highest level of symptom expression was not associated with the plant phase with the highest emerged leaves. Disease symptoms reached the highest pick only after the phase of intense leaf development. The molecular analysis revealed that all the groundnut varieties analyzed were genetically closely related even though they showed different reactions to the leaf spot disease.

Helianthus annuus as a natural host for Stemphylium vesicarium in Iran

Abstract: Sunflower leaf spot is one of the most common as well as important foliar diseases of this host in northern Iran. Stemphylium vesicarium was revealed to be one of the causal agents of sunflower leaf spot based on morphological and molecular characteristics. The identity of the species was confirmed using sequence data from the ITS rDNA region and glyceraldehyde-3-phosphate dehydrogenase (gpd) gene sequences. Pathogenicity of the fungus was proven by inoculation of four-week-old sunflower plants (cv. Euroflor) under controlled conditions. This is the first report on the incidence of S. vesicarium on H. annuus anywhere in the world.

First Report of Xanthomonas arboricola pv. pruni in Ornamental Prunus laurocerasus in the Netherlands

Abstract: In 2008, Dutch ornamental plant growers observed a leaf spot of cherry laurel (Prunus laurocerasus) at a greater incidence (5 to 50%) than the usual sporadic level (<1%). For advice on disease control, ~5 to 10% of these growers contacted Dutch regulatory officials. In November and December 2008, six symptomatic samples from northern and southern parts of the Netherlands were submitted for diagnosis. Leaf spots were chlorotic, most had a necrotic brown center with a distinct margin, and the spots readily abscised, resulting in a “shot-hole” appearance. Leaf spots from the samples were surface sterilized (2 s in 70% vol/vol alcohol), blotted dry on tissue paper, chopped into pieces (1 to 2 mm in diameter), and incubated for 30 min in 10 mM phosphate-buffered saline (PBS) (1). A 20-μl aliquot of extract per sample was streaked by dilution plating on four plates of yeast peptone glucose agar medium (1), and the plates were incubated for 2 to 3 days at 28°C. Isolations from all six samples yielded Xanthomonas...

Incidence and chemical control of okra leaf spot disease

Abstract: Studies were carried out in Sindh (Pakistan) for survey, identification, incidence and chemical control of leaf spot disease in okra. The disease incidence percent ranged between 53.561.5% at different locations. The maximum incidence (61.5%) was recorded at Hyderabad, followed by Tando Muhammad Khan (58.4%), Tando Allah Yar (55.1%) and Matyari (53.5%). The fungus, Alternaria alternata was isolated and identified as cause of okra leaf spot disease. Severity of leaf spot was significantly reduced in plants sprayed with Ridomil MZ, Dolomile, Topsin-M, Diesomil, protest and Tahfuz as compare to control plants sprayed with water. The results also showed that the mean infected leaves ranged from 4.7-5.9 when the data was recorded before application of fungicides while it was between 2.0-6.4 after two application of tested fungicides. However, significant maximum reduction % in severity of leaf spot disease was recorded in case of Ridomil MZ (2.8), followed by Dolomile (1.9), Topsin-M (1.7), Diesomil (1.6), protest and Tahfuz (1.5). Okra plants infected with leaf spot and sprayed with water (control) showed highly significant reduction in plant height (61.53cm) whereas, the tall plants (95.10) were recorded from plot sprayed with Ridomil M Z followed by Dolomile (91.25 cm), Topsin-M (86.60 cm), Diesomil (78.40 cm), Protest (72.75 cm) and Tahfuz (68.38 cm). Significantly lowest number of fruits per plant of okra (10.50) was recorded in control (sprayed with water), while, highest number of fruits per plant (14.90) were obtained from plot treated with Ridomil M Z, followed by Dolomile (13.90), Topsin -M (13.20), Diesomil (12.70), Protest (12.20), and Tahfuz (11.50). The data also showed highly significant difference between treatments for fruit yield of okra infected with leaf spot. The maximum fruit yield (955 kg per acre) was observed in plot treated with Ridomil MZ, followed by Dolomile (845 kg), Topsin-M (790 kg), Diesomil (738 kg), Tahfuz (594 kg) and Protest (681 kg); whereas minimum fruit yield (495 kg) per acre was recorded in plants not sprayed with fungicides.

Screening of potential antimicrobial compounds against Xanthomonas campestris from 100 essential oils of aromatic plants used in India: an ecofriendly approach

Abstract: Plants are constantly exposed to and threatened by a variety of pathogenic microorganisms present in their environments. Xanthomonas campestris is a major plant pathogen in the world. It is known to cause significant losses in many crop plants due to leaf spot and leaf blight. In the present study, bacteria isolated from infected Citrus limon fruit and identified by 16S rDNA sequencing was X. campestris. In vitro antimicrobial properties of 100 essential oils were evaluated against X. campestris. The chemical composition of the most active essential oils was investigated by gas chromatography–mass spectral (GC–MS) analysis. The potential of these essential oils as ecofriendly and economical biocontrol in agriculture is discussed.

Reduction of the severity of angular leaf spot of cotton mediated by silicon.

Abstract: Angular leaf spot, caused by Xanthomonas citri subsp malvacearum, is the major bacterial disease of cotton in Brazil and other countries This study evaluated the effectiveness of silicon (Si) for the control of the disease and the possible resistance mechanisms triggered by this element Calcium silicate (CaSiO3) was incorporated into the soil at concentrations of 000, 025, 050, 150 and 300 g of SiO2 kg-1 soil 25 days before planting Leaves of 33-day-old plants were inoculated by infiltration with 05 ml of a bacterial suspension (108 CFU ml-1) Components of resistance were evaluated every two days up to 10 days post inoculation, when plant development and the accumulation of Si and calcium were determined H2O2 production and the activity of enzymes related to plant defenses were analyzed 6, 12 and 24 h post inoculation in +/-Si plants In vitro inhibition of pathogen growth was also assessed No significant difference was found among treatments regarding incubation period, disease incidence or bacterial growth inhibition However, with the application of 150 g of SiO2 kg-1 of soil, a reduction in disease severity (549%) was observed along an increase in plant height (7%) There was no detectable accumulation of Si in the cotton leaves In the presence of Si (180 g SiO2 kg-1), the level of soluble proteins and the activity of the enzymes SOD, APX, guaiacol- peroxidase, PAL and b-Glu increased, whereas there was a decrease of H2O2 The angular leaf spot reduction observed may be associated with these modification, suggesting resistance induction

Effect of Alginure® (seaweed extract), Myco-Sin®VIN (sulfuric clay) and Polyversum® ( Pythium oligandrum Drechs.) on yield and disease control in organic strawberries

Abstract: In 2011 and 2012 three commercial products Alginure® (seaweed extract), Myco-Sin® VIN (sulfuric acid clay with yeast and plant extracts) and Polyversum® (spores of Pythium oligandrum) were tested in field experiment with strawberry cv. 'Induka' under the conditions of organic growing system. The aim of the study was to determine the effect of the preparations on yield, fruit quality and diseases control. The preparations were applied five times during flowering. We assessed total yield, marketable and unmarketable yields, average fruit weight, grey mould incidence on fruits caused by Botrytis cinerea and leaf spot severity caused by Mycosphaerella fragariae. Efficacy (%) of preparations was calculated. Preparations did not show positive effect on yields parameters. Total and marketable yields were not significantly different to untreated control in both years. Nevertheless considerable increase of yields from 2011 to 2012 was observed in strawberries treated by biofungicide Polyversum®. Preparations did not significantly reduce the incidence of grey mould. Alginure® showed the best results by efficacy 39.6 % and 57.4 %, respectively. All preparations provided very low, less than 10% efficacy to control leaf spot severity.

First Report of Nigrospora oryzae Causing Leaf Spot of Cotton in China

Abstract: Cotton (Gossypium hirsutum L.) is widely cultivated for the important economic value of the fiber. In the summer of 2011, a leaf spot of cotton plants cv. Wanza40 was observed in 11 fields (total of about 4 ha) in Qianshan County in southwest Anhui Province, China. Approximately 30% of the plants in each field were symptomatic. Affected plants exhibited brown to reddish, irregular foliar lesions, each with a brown border near the vein of the leaves. A sign of fungal infection was a dark leaf mold observed on lesions on the abaxial surface of leaves. Sections of symptomatic leaf tissues were surface-sterilized (in 75% ethanol for 30 s, then 1% NaOCl for 1 min), rinsed three times in sterile distilled water, and plated onto potato dextrose agar (PDA). A fungus consistently recovered from symptomatic leaf samples produced colonies that were initially white and then became grayish brown with the onset of sporulation. Black, spherical to subspherical, single-celled conidia (10 to 12 × 14 to 16 μm) were borne o...

Effect of Alternaria alternata on the coccinellid pest Henosepilachna vigintioctopunctata and its implications for biological pest management

Abstract: Twenty-eight spotted potato ladybird beetle (Henosepilachna vigintioctopunctata) is a polyphagous pest that infests various crop plants of the family Solanceae. It extensively infests Withania somnifera, a high-value medicinal plant of this family. Both the beetle and W. somnifera leaf spot pathogen (Alternaria alternata) are individually found to be closely associated with the foliar damage and may rarely infest the same leaf simultaneously. Beetles fed on diseased leaves showed high pupal and larval mortality. Furthermore, the development of the larvae into pupa and from pupa to adult was also delayed, which in turn delayed the overall development of the insect. Adult emergence from pupae is also reduced in the insects fed on diseased leaves. Since the fungal pathogen is host specific to W. somnifera and does not infect the other solanaceous crops, therefore this fungal stain can be used in designing bio-control strategies for the other solanaceous plants frequently infested by the beetle.

Screening new Arachis amphidiploids, and autotetraploids for resistance to late leaf spot by detached leaf technique

Abstract: Cultivated groundnut is susceptible to late leaf spot (LLS) caused by Phaeoisariopsis personata [(Berk. & M.A. Curtis) Aex] and resistance is low to moderate in the primary gene pool of groundnut. Closely related wild species in the secondary gene pool are highly resistant to the disease. All the closely related Arachis species are diploid and cultivated groundnut is a tetraploid. Utilization of diploid Arachis species to transfer LLS resistance is time consuming and cumbersome. New sources of Arachis hypogaea (also called synthetic groundnut) were developed at ICRISAT. These are tetraploids and the present investigation has shown that they are resistant to LLS.

First Report of Pseudomonas cichorii Associated with Leaf Spot on Soybean in South Korea.

Abstract: Unusual symptoms were observed on 5% of the soybean (Glycine max (L.) Merill) plants in commercial fields in South Korea in September 2008 and 2009. The lesions were at first water soaked, then enlarged and turned dark brown or black, often with concentric white rings and sometimes surrounded by a bright yellow halo. Most lesions were roughly circular to irregular. Six bacteria were isolated on tryptic soy agar (TSA) media from plants of soybean cv. Daewon. The isolate JBC1 formed colonies that were whitish to greenish, circular with convex elevation, and unable to grow anaerobically or at 37°C. Cells of the isolate were rod shaped with polar multitrichous flagella. The isolate was positive for the following characteristics: production of fluorescent and diffusible pigment on King's medium B, production of oxidase, ability to rot potato, and utilization of l-arabinose, d-aspartate, citrate, galactose, glucose, meso-inositol, mannitol, and meso-tartrate. However, the isolate was negative in the following tests: formation of yellow colonies on peptone sucrose agar and yeast extract dextrose calcium carbonate agar media, levan formation, production of nondiffusible pigment, urease and arginine dihydrolase, hydrolysis of starch, nitrate reduction, and utilization of d-arabinose, benzoate, geraniol, l-rhamnose, d-sorbitol, sucrose, and trehalose (1). The isolates elicited a clear hypersensitive reaction in tobacco leaves. The carbon source oxidation pattern analyzed by Biolog (Hayward, CA) GN database indicated that the isolate belonged to Pseudomonas cichorii (Swingle 1925) Stapp 1928. DNA was isolated with a commercial genomic DNA extraction kit (Solgent, Daejeon, South Korea) and the 16S rDNA was amplified using universal 27F and 1492R primers. The 1,367-bp amplicon was sequenced (GenBank Accession No. JF951725) and had 100% sequence identity with P. cichorii Accession No. EF101976.1. Phylogenetic analysis based on 1,367 bp of the 16S rDNA sequence also revealed that isolate JBC1 was closely related to P. cichorii. Healthy soybean plants of cv. Jangyeop were spray inoculated with 20 ml of a 108 suspension prepared from a 2-day-old culture grown on TSA. Healthy plants sprayed with just water served as noninoculated checks. Typical disease symptoms that were observed in the field developed on leaves of soybean plants 3 days after spray inoculation, while the check plants remained symptomless. The bacteria reisolated from inoculated plants were confirmed to be identical to the original strain by 16S rDNA analysis and the Biolog test. Inoculation on tomato, watermelon, melon, and oriental melon plants resulted in dark brown or black lesions forming on leaf margins and tips, which is different from those on soybean plants (2,3). With paprika and eggplant, necrotic spots with concentric white rings developed on the leaves of each plant. We propose leaf spot as the name for this disease on soybean. To our knowledge, this is the first report of leaf spot on soybean caused by P. cichorii, which is becoming a more important pathogen in subtropical regions and greenhouses (4). References: (1) B. Cottyn et al. Syst. Appl. Microbiol. 32:211, 2009. (2) A. Obradovic et al. Plant Dis. 86:443, 2002. (3) E. Pauwelyn et al. J. Phytopathol. 159:298, 2011. (4) S. M. Walkil et al. Nigeria J. Appl. Biosci. 38:2540, 2011.

Predicting favorable conditions for early leaf spot of peanut using output from the Weather Research and Forecasting (WRF) model

Abstract: Early leaf spot of peanut (Arachis hypogaea L.), a disease caused by Cercospora arachidicola S. Hori, is responsible for an annual crop loss of several million dollars in the southeastern United States alone. The development of early leaf spot on peanut and subsequent spread of the spores of C. arachidicola relies on favorable weather conditions. Accurate spatio-temporal weather information is crucial for monitoring the progression of favorable conditions and determining the potential threat of the disease. Therefore, the development of a prediction model for mitigating the risk of early leaf spot in peanut production is important. The specific objective of this study was to demonstrate the application of the high-resolution Weather Research and Forecasting (WRF) model for management of early leaf spot in peanut. We coupled high-resolution weather output of the WRF, i.e. relative humidity and temperature, with the Oklahoma peanut leaf spot advisory model in predicting favorable conditions for early leaf spot infection over Georgia in 2007. Results showed a more favorable infection condition in the southeastern coastline of Georgia where the infection threshold were met sooner compared to the southwestern and central part of Georgia where the disease risk was lower. A newly introduced infection threat index indicates that the leaf spot threat threshold was met sooner at Alma, GA, compared to Tifton and Cordele, GA. The short-term prediction of weather parameters and their use in the management of peanut diseases is a viable and promising technique, which could help growers make accurate management decisions, and lower disease impact through optimum timing of fungicide applications.

Inoculum and disease dynamics of circular leaf spot of persimmon caused by Mycosphaerella nawae under semi-arid conditions

Abstract: The epidemiology of circular leaf spot of persimmon, caused by Mycosphaerella nawae, was studied in a semi-arid area in Spain for two consecutive years. No conidia were observed on diseased leaves and all infections were thought to be caused by ascospores formed in the leaf litter. Ascospores were released mainly in April and May, but relatively low numbers in June were able to induce severe symptoms on trap plants. Temperature was not significantly correlated with ascospore catches or disease incidence on trap plants, indicating that it was not a limiting factor for disease development during the period of study. Rainfall was above normal, but still considerably lower than in endemic areas of Korea. Most infections coincided with rains, but the disease was observed also on trap plants exposed to less than 1 mm of precipitation and even in the absence of rain. Orchards were flood irrigated once inoculum deposits in the leaf litter had already been depleted, so it was not possible to determine its effects on ascospore release and disease development. The use of a wind tunnel to determine inoculum production allowed detection of physiologically mature ascospores of M. nawae in the leaf litter 1–2 weeks before they were released to air in the orchard. Disease progress was fitted to the monomolecular growth curve, associated with monocyclic pathogens and diseases with a variable incubation period as a function of the host phenology.