Molecular breeding

About: Molecular breeding is a research topic. Over the lifetime, 2120 publications have been published within this topic receiving 56908 citations.

Molecular Breeding of Barley for Droughted Low Input Agricultural Conditions

Abstract: Molecular genetic markers and other enabling technologies are now sufficiently developed for exploitation in breeding programmes. They allow the possibility of accelerating, and improving the efficiency, of breeding for abiotic and biotic stress tolerances. Barley is a good model species in which to demonstrate this. Barley is a diploid species in which genetic analysis is relatively easy, its short life cycle and inbred nature has also provided for good physiological research. The results of genetic and physiology studies can now be exploited more efficiently in breeding using the tools of contemporary biotechnologies. A programme of work has been initiated aimed at developing more stable yields in barley (Hordeum vulgare) for droughted, low input agricultural conditions of Mediterranean rim countries. Various molecular breeding approaches are to be compared which vary in gene donors, recipients and methods. Two of the approaches exploit wild barley (H. spontaneum) as a source of genetic variation for abiotic stress tolerance, the third uses an adapted landrace. Results from controlled environment experimentation will be compared with field performance in naturally stressed environments of N. Africa. The work will provide a testing ground for the application of ideas and technologies developed from research.

Molecular marker SNP6 coseparated from cucumber-sour cucumber introgression line powdery mildew-resistant gene

Abstract: The invention firstly discloses a molecular marker SNP6 coseparated from a cucumber-sour cucumber introgression line powdery mildew-resistant gene, and belongs to the field of plant molecular breeding. Sequences of forward primer and reverse primer of the marker are respectively 5' TTTCTTGTACAGGGGAAGGTGG 3' and 5' TGTTTTGGTCAGGCAAAGGGT 3'. In an F2 colony constructed by a powdery mildew-infected cucumber variety 'Changchun mici' and a powdery mildew-resistant cucumber-sour cucumber introgression line 'IL52', a homozygous C/C basic group can be detected in a single powdery mildew-resistant plant at the position of SNP6, and a homozygous T/T basic group or heterozygous T/C basic group can be detected in a single powdery mildew-infected plant at the position of SNP6. The molecular marker SNP6disclosed by the invention can be applied for fine mapping of the cucumber-sour cucumber introgression line powdery mildew-resistant gene and molecular marker assistant breeding, and has important theory and practice guiding significance on accelerating the breeding of cucumber powdery mildew resistance.