Showing papers on "Molecular models of DNA published in 2017"

Hyperplectonemes: A Higher Order Compact and Dynamic DNA Self-Organization

Abstract: Bacterial chromosome has a compact structure that dynamically changes its shape in response to bacterial growth rate and growth phase. Determining how chromatin remains accessible to DNA binding proteins, and transcription machinery is crucial to understand the link between genetic regulation, DNA structure, and topology. Here, we study very large supercoiled dsDNA using high-resolution characterization, theoretical modeling, and molecular dynamics calculations. We unveil a new type of highly ordered DNA organization forming in the presence of attractive DNA–DNA interactions, which we call hyperplectonemes. We demonstrate that their formation depends on DNA size, supercoiling, and bacterial physiology. We compare structural, nanomechanic, and dynamic properties of hyperplectonemes bound by three highly abundant nucleoid-associated proteins (FIS, H-NS, and HU). In all these cases, the negative supercoiling of DNA determines molecular dynamics, modulating their 3D shape. Overall, our findings provide a mech...

Supramolecular Protein Assemblies Based on DNA Templates.

Abstract: DNA plays an important role in the process of protein assembly. DNA viruses such as the M13 virus are typical examples in which single DNA genomes behave as templates to induce the assembly of multiple major coat protein (PVIII) monomers. Thus, the design of protein assemblies based on DNA templates attracts much interest in the construction of supramolecular structures and materials. With the development of DNA nanotechnology, precise 1D and 3D protein nanostructures have been designed and constructed by using DNA templates through DNA–protein interactions, protein–ligand interactions, and protein–adapter interactions. These DNA-templated protein assemblies show great potential in catalysis, medicine, light-responsive systems, drug delivery, and signal transduction. Herein, we review the progress on DNA-based protein nanostructures that possess sophisticated nanometer-sized structures with programmable shapes and stimuli-responsive parameters, and we present their great potential in the design of biomate...

The “sugar” coarse-grained DNA model

Abstract: More than 20 coarse-grained (CG) DNA models have been developed for simulating the behavior of this molecule under various conditions, including those required for nanotechnology. However, none of these models reproduces the DNA polymorphism associated with conformational changes in the ribose rings of the DNA backbone. These changes make an essential contribution to the DNA local deformability and provide the possibility of the transition of the DNA double helix from the B-form to the A-form during interactions with biological molecules. We propose a CG representation of the ribose conformational flexibility. We substantiate the choice of the CG sites (six per nucleotide) needed for the "sugar" GC DNA model, and obtain the potentials of the CG interactions between the sites by the "bottom-up" approach using the all-atom AMBER force field. We show that the representation of the ribose flexibility requires one non-harmonic and one three-particle potential, the forms of both the potentials being different from the ones generally used. The model also includes (i) explicit representation of ions (in an implicit solvent) and (ii) sequence dependence. With these features, the sugar CG DNA model reproduces (with the same parameters) both the B- and A- stable forms under corresponding conditions and demonstrates both the A to B and the B to A phase transitions. Graphical Abstract The proposed coarse-grained DNA model allows to reproduce both the B- and A- DNA forms and the transitions between them under corresponding conditions.

Intrinsic Dynamics Analysis of a DNA Octahedron by Elastic Network Model.

Abstract: DNA is a fundamental component of living systems where it plays a crucial role at both functional and structural level. The programmable properties of DNA make it an interesting building block for the construction of nanostructures. However, molecular mechanisms for the arrangement of these well-defined DNA assemblies are not fully understood. In this paper, the intrinsic dynamics of a DNA octahedron has been investigated by using two types of Elastic Network Models (ENMs). The application of ENMs to DNA nanocages include the analysis of the intrinsic flexibilities of DNA double-helices and hinge sites through the calculation of the square fluctuations, as well as the intrinsic collective dynamics in terms of cross-collective map calculation coupled with global motions analysis. The dynamics profiles derived from ENMs have then been evaluated and compared with previous classical molecular dynamics simulation trajectories. The results presented here revealed that ENMs can provide useful insights into the intrinsic dynamics of large DNA nanocages and represent a useful tool in the field of structural DNA nanotechnology.

Coarse-Grained Molecular Dynamics Model of Double-Stranded DNA for DNA Nanostructure Design

Abstract: A new coarse-grained molecular dynamics double-stranded DNA model (nCG-dsDNA model) using an improved beads–spring model was proposed. In this model, nucleotide comprising phosphate, sugar, and base group were replaced by a single bead. The double stranded model with 202 base pairs was created to tune the parameters of the bond, the nonbond, stack, angle bending, and electrostatic interaction. The average twisted angle and the persistence length of the model without electrostatic interaction were calculated at 35.3° and 120.3 bp, confirming that the proposed model successfully realized the experimentally observed double-stranded DNA structure. Moreover, the model with electrostatic interaction was discussed. From calculation results, we confirmed that the dependency of the salt concentration on the persistence length of the nCG-dsDNA model at the 30% charge is in good agreement with the Poisson–Boltzmann theoretical model.

Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model

Abstract: Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

Theoretical Methods for Studying DNA Structural Transitions under Applied Mechanical Constraints

Abstract: Recent progress in single-molecule manipulation technologies has made it possible to exert force and torque on individual DNA biopolymers to probe their mechanical stability and interaction with various DNA-binding proteins. It was revealed in these experiments that the DNA structure and formation of nucleoprotein complexes by DNA-architectural proteins can be strongly modulated by an intricate interplay between the entropic elasticity of DNA and its global topology, which is closely related to the mechanical constraints applied to the DNA. Detailed understanding of the physical processes underlying the DNA behavior observed in single-molecule experiments requires the development of a general theoretical framework, which turned out to be a rather challenging task. Here, we review recent advances in theoretical methods that can be used to interpret single-molecule manipulation experiments on DNA.

Design of Geometric Molecular Bonds

Abstract: An example of a specific molecular bond is the affinity of the DNA base A for T, but not for C, G, or another A. This contrasts nonspecific bonds, such as the affinity of any positive charge for any negative charge (like-unlike), or of nonpolar material for itself when in aqueous solution (like-like). Recent experimental breakthroughs in DNA nanotechnology demonstrate that a particular nonspecific like-like bond (“blunt-end DNA stacking” that occurs between the ends of any pair of DNA double-helices) can be used to create specific “macrobonds” by careful geometric arrangement of many nonspecific blunt ends, motivating the need for sets of macrobonds that are orthogonal : two macrobonds not intended to bind have relatively low binding strength, even when misaligned. To address this need, we introduce geometric orthogonal codes that abstractly model the engineered DNA macrobonds as 2-D binary codewords. While motivated by completely different applications, geometric orthogonal codes share similar features to the optical orthogonal codes studied by Chung et al. The main technical difference is the importance of 2-D geometry in defining codeword orthogonality.

Exploring the consequences of lack of closure in codon models

Abstract: Models of codon evolution are commonly used to identify positive selection. Positive selection is typically a heterogeneous process, i.e., it acts on some branches of the evolutionary tree and not others. Previous work on DNA models showed that when evolution occurs under a heterogeneous process it is important to consider the property of model closure, because non-closed models can give biased estimates of evolutionary processes. The existing codon models that account for the genetic code are not closed; to establish this it is enough to show that they are not linear (meaning that the sum of two codon rate matrices in the model is not a matrix in the model). This raises the concern that a single codon model fit to a heterogeneous process might mis-estimate both the effect of selection and branch lengths. Codon models are typically constructed by choosing an underlying DNA model (e.g., HKY) that acts identically and independently at each codon position, and then applying the genetic code via the parameter $\omega$ to modify the rate of transitions between codons that code for different amino acids. Here we use simulation to investigate the accuracy of estimation of both the selection parameter $\omega$ and branch lengths in cases where the underlying DNA process is heterogeneous but $\omega$ is constant. We find that both $\omega$ and branch lengths can be mis-estimated in these scenarios. Errors in $\omega$ were usually less than 2% but could be as high as 17%. We also assessed if choosing different underlying DNA models had any affect on accuracy, in particular we assessed if using closed DNA models gave any advantage. However, a DNA model being closed does not imply that the codon model constructed from it is closed, and in general we found that using closed DNA models did not decrease errors in the estimation of $\omega$.

Model Checking Temporal Logic Formulas Using Sticker Automata

Abstract: As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method.

Charge transport in DNA model with vibrational and rotational coupling motions.

Abstract: The dynamics of the Peyrard-Bishop model for vibrational motion of DNA dynamics, which has been extended by taking into account the rotational motion for the nucleotides (Silva et al., J. Biol. Phys. 34, 511-519, 2018) is studied. We report on the presence of the modulational instability (MI) of a plane wave for charge migration in DNA and the generation of soliton-like excitations in DNA nucleotides. We show that the original differential-difference equation for the DNA dynamics can be reduced in the continuum approximation to a set of three coupled nonlinear equations. The linear stability analysis of continuous wave solutions of the coupled systems is performed and the growth rate of instability is found numerically. Numerical simulations show the validity of the analytical approach with the generation of wave packets provided that the wave numbers fall in the instability domain.

Voltage dependency of transmission probability of aperiodic DNA molecule

Abstract: Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.