Pichia pastoris

About: Pichia pastoris is a research topic. Over the lifetime, 7937 publications have been published within this topic receiving 162645 citations. The topic is also known as: Komagataella pastoris.

A novel metagenome-derived β-galactosidase: gene cloning, overexpression, purification and characterization

Abstract: A novel β-galactosidase gene, zd410, was isolated by screening a soil metagenomic library. Sequence analysis revealed that zd410 encodes a protein of 672 amino acids with a predicted molecular weight of 78.6 kDa. The recombinant ZD410 was expressed and purified in Pichia pastoris, with a yield of ca. 300 mg from 1 L culture. The purified enzyme displayed optimal activity at 38°C and pH 7.0. Given that the enzyme had 54% of the maximal activity at 20°C and 11% of the maximal activity at close to 0°C, ZD410 was regarded as a cold-adapted β-galactosidase. ZD410 displays high enzymatic activity for its synthetic substrate-ONPG (o-nitrophenyl-β-d-galactopyranoside, 243 U/mg) and its natural substrate-lactose (25.4 U/mg), while its activity was slightly stimulated by addition of Na+, K+, or Ca2+ at low concentrations. ZD410 is a good candidate of β-galactosidases for food industry after further study.

An upstream activation sequence controls the expression of AOX1 gene in Pichia pastoris

Abstract: Alcohol oxidase I gene (AOX1) promoter (P(AOX1)) is a key promoter in the methylotrophic yeast Pichia pastoris. To identify the cis-acting element in the AOX1 promoter, we constructed expression plasmids in which the green fluorescent protein (GFP) gene coding region was fused to a series of internal deletion mutants of the AOX1 promoter. By analyzing the expression and transcription level of GFP by each plasmid, we identified a positive cis-element, Region D, which is located between positions -638 and -510 of the AOX1 promoter. This region contains an invert repeat-like sequence GTGGGGTCAAATAGTTTCATGTTCCCCAA that is similar to the upstream activation sequence 1 (UAS1) of alcohol dehydrogenase II gene (ADH2) in Saccharomyces cerevisiae. The inverted repeat sequence in the UAS1 is known to contain the binding site for alcohol dehydrogenase II synthesis regulator (Adr1p). When three tandem copies of Region D were inserted into the Region D-deleted AOX1 promoter, the expression of GFP at the protein level and the mRNA level increased to 157% and 135% of the wild type, respectively. An electrophoretic mobility shift assay indicated that Region D could form a DNA-protein complex with cell extracts under methanol-induced and glucose/methanol-repressed conditions. These data suggest that Region D may function as a cis-acting regulatory element in the AOX1 promoter to positively regulate the expression of AOX1.

Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity.

Abstract: Glutaminyl cyclase (QC, EC 2.3.2.5) catalyzes the formation of pyroglutamate residues from glutamine at the N-terminus of peptides and proteins. In the current study, human QC was functionally expressed in the secretory pathway of Pichia pastoris, yielding milligram quantities after purification from the supernatant of a 5 L fermentation. Initial characterization studies of the recombinant QC using MALDI-TOF mass spectrometry revealed correct proteolytic processing and N-glycosylation at both potential sites with similar 2 kDa extensions. CD spectral analysis indicated a high α-helical content, which contrasts with plant QC from Carica papaya. The kinetic parameters for conversion of H-Gln-Tyr-Ala-OH by recombinant human QC were almost identical to those previously reported for purified bovine pituitary QC. However, the results obtained for conversion of H-Gln-Gln-OH, H-Gln-NH2, and H-Gln-AMC were found to be contradictory to previous studies on human QC expressed intracellularly in E. coli. Expression of...