The development of photoactive and biocompatible nanomaterials is a current major challenge of materials science and nanotechnology, as they will contribute to promoting current and future biomedical applications. A growing strategy in this direction consists of using biologically inspired hybrid materials to maintain or even enhance the optical properties of chromophores and fluorophores in biological media. Within this area, porphyrinoids constitute the most important family of organic photosensitizers. The following extensive review will cover their incorporation into different kinds of photosensitizing biohybrid materials, as a fundamental research effort toward the management of light for biomedical use, including technologies such as photochemical internalization (PCI), photoimmunotherapy (PIT), and theranostic combinations of fluorescence imaging and photodynamic therapy (PDT) or photodynamic inactivation (PDI) of microorganisms.

/pdf/porphyrinoid-biohybrid-materials-as-an-emerging-toolbox-for-1rd1khnqpo.pdf

Porphyrinoid biohybrid materials as an emerging toolbox for biomedical light management.

/pdf/study-of-the-stabilization-of-zinc-phthalocyanine-in-sol-gel-p867s06ai7.pdf

Study of the stabilization of zinc phthalocyanine in sol-gel TiO2 for photodynamic therapy applications

Solid-phase synthesis of azaphthalocyanine-oligonucleotide conjugates and their evaluation as new dark quenchers of fluorescence.

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 � 10 � 11 mol.dm � 3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection.

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides.

From cuvette to cells: How the central metal ion modulates the properties of phthalocyanines and porphyrazines as photosensitizers

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate
sequence-specific modification of DNA by them Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1 O 2 , while phthalocyanine of Co(II) promoted
DNA oxidation by molecular oxygen through the catalysis of
formation of reactive oxygen species
( ⋅ 2 − , H 2 O 2 , OH) Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target
d(TGAATGGGAAGAGGGTCAGGTT) A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide
was found to modify the DNA target in the presence of O 2 

and 2-mercaptoethanol or in the presence of H 2 O 2 
Under both sensitized and catalyzed conditions, the nucleotides
 G 13 – G 15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide
These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial
regulators of gene expression and therapeutic agents for treatment of cancer

/pdf/conjugates-of-phthalocyanines-with-oligonucleotides-as-5dthck7ejf.pdf

Eugenii A. Lukyanets

Papers

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification