Efficient patient management relies on early diagnosis of disease and monitoring of treatment. In this regard, much effort has been made to find informative, blood-based biomarkers for patients with cancer. Owing to their attributes-which are specifically modulated by the tumour-circulating cell-free microRNAs found in the peripheral blood of patients with cancer may provide insights into the biology of the tumour and the effects of therapeutic interventions. Moreover, the role of microRNAs in the regulation of different cellular processes points to their clinical utility as blood-based biomarkers and future therapeutic targets. MicroRNAs are optimal biomarkers owing to high stability under storage and handling conditions and their presence in blood, urine and other body fluids. In particular, detection of levels of microRNAs in blood plasma and serum has the potential for an earlier cancer diagnosis and to predict prognosis and response to therapy. This Review article considers the latest developments in the use of circulating microRNAs as prognostic and predictive biomarkers and discusses their utility in personalized medicine.

Clinical relevance of circulating cell-free microRNAs in cancer

https://aasldpubs.onlinelibrary.wiley.com/doi/pdf/10.1002/hep.24538

Circulating microRNAs as potential markers of human drug‐induced liver injury

Plasma microRNAs as potential biomarkers for non-small-cell lung cancer

MicroRNAs (miRNAs) are master regulators of gene expression. By degrading or blocking translation of messenger RNA targets, these non-coding RNAs can modulate the expression of more than half the protein-coding genes in mammalian genomes. MiRNAs play important regulatory roles in a variety of cellular functions and in several diseases, including cancer. Aberrant miRNA expression has been well characterized in cancer, with implications for progression and prognosis. Recently, the discovery of miRNAs in body fluids, such as serum and plasma, opens up the possibility of using them as noninvasive biomarkers of disease and therapy response. In this chapter, we discuss the use of circulating miRNAs as biomarkers of disease and therapy response and as diagnostic and prognostic markers in breast cancer. We also discuss the main issues related to establishing circulating miRNAs as biomarkers in cancer.

Circulating MicroRNAs as Noninvasive Biomarkers in Breast Cancer

Aberrant microRNA (miRNA) expression is a defining feature of human malignancy. Specific miRNAs have been identified as promoters or suppressors of metastatic progression. miRNAs control metastasis through divergent or convergent regulation of metastatic gene pathways. Some miRNA regulatory networks govern cell-autonomous cancer phenotypes, whereas others modulate the cell-extrinsic composition of the metastatic microenvironment. The use of small RNAs as probes into the molecular and cellular underpinnings of metastasis holds promise for the identification of candidate genes for potential therapeutic intervention.

/pdf/control-of-metastatic-progression-by-microrna-regulatory-588cprpki5.pdf

Control of metastatic progression by microRNA regulatory networks.

https://www.gynecologiconcology-online.net/article/S0090-8258(10)00550-0/pdf

Correlation and quantitation of microRNA aberrant expression in tissues and sera from patients with breast tumor

Background Subcutaneous immunotherapy (SCIT) is an effective treatment for children with allergic rhinitis (AR), but its efficacy fluctuates among patients. There are no reliable candidate biomarkers for monitoring and predicting the response to SCIT. The present study aims to identify novel biomarkers for early predicting the efficacy of SCIT in pediatric AR patients based on multiple cytokine profiling. Methods We prospectively recruited 72 children with house dust mite (HDM)-induced AR who were assigned to receive SCIT. The serum samples were collected and multiple cytokine profiling was conducted by Luminex assay at baseline. All patients were followed-up for 1 year and then categorized into effective and ineffective group based on their efficacy, and levels of 48 selected cytokines were tested and compared between the two groups. The potential cytokines were further validated by enzyme-linked immunosorbent assay (ELISA) in a cohort with 54 responders and 26 non-responders. Results Sixty-nine of 72 children completed one-year follow-up schedule with 46 included in effective group and 23 in ineffective group. The results of multiple cytokine profiling showed that 15 cytokines (eotaxin, G-CSF, GM-CSF, IFN-γ, IL-12(p40), IL-13, IL-15, IL-16, IL-4, MIF, MIP-1α, RANTES, SCF, SDF-1α and VEGF) were dysregulated between effective and ineffective group (all P < 0.05). Unadjusted and adjusted multivariate analysis models highlighted that serum eotaxin, IFN-γ, IL-4 and MIF levels closely associated with the efficacy of SCIT in pediatric HDM-induced AR patients. In addition, receiver operating characteristic (ROC) curves revealed potential values of these four biomarkers in predicting the response to SCIT. Further ELISA validation results in the cohort of 80 pediatric patients demonstrated that serum eotaxin and IL-4 levels were elevated in responders while IFN-γ levels decreased in responders (all P < 0.05). ROC curves demonstrated that serum IL-4 exhibited more reliable accuracy in predicting SCIT efficacy than eotaxin and IFN-γ. Conclusion Our discover–validation study suggested that cytokines including IL-4, eotaxin and IFN- γ may serve as robust biomarkers for early predicting response of SCIT in children with HDM-induced AR. These results strengthen the evidence that cytokines were associated with the response of SCIT and contributed to understand its underlying therapeutic mechanisms.

/pdf/identification-of-robust-biomarkers-for-early-predicting-2sarz1gz.pdf

Identification of Robust Biomarkers for Early Predicting Efficacy of Subcutaneous Immunotherapy in Children With House Dust Mite-Induced Allergic Rhinitis by Multiple Cytokine Profiling

The invention discloses a serology biological marker for detecting tumor of breast, which is characterized by comprising at least one of the following miRNA: miR-21:uagcuuaucagacugauguuga; miR-106a:aaaagugcuuacagugcagguag; miR-126:ucguaccgugaguaauaaugcg; miR-155:uuaaugcuaaucgugauaggggu; miR-335:ucaagagcaauaacgaaaaaugu; and miR-199a:cccaguguucagacuaccuguuc. Meanwhile, the invention also discloses the application of the serology biological marker in the preparation of a kit used for screening the tumor of breast or assisting pathology authentication and clinical diagnosis of the tumor of breast; the kit comprises a reverse transcription system and a primer system/primer probe system.

Serology biological marker for detecting tumor of breast and application thereof

The invention relates a method for measuring miRNA absolute expression quantity in biological samples, which comprises the following steps: 1) material selection: 8 weeks and 40 weeks of mouse brain tissues are selected; 2) total RNA extract; 3) RT(reverse transcription)-Polymerase Chain Reaction (PCR); 4) quantifying DNA; 5) drawing specification curve; 6) data processing: loss rate and average loss rate of little RNA is figured out in the process of extracting RNA according to the copy number of spike RNA in the extracted total RNA which is detected by the PCR; the expression quantity of every initial cell of the little RNA at the levels of DNA and RNA is figured out according to the cell number of original sample that is respectively expressed from the levels of DNA and RNA. The methodhas the advantages of miRNA expression quantity is faithfully transformed into the absolute expression quantity in the original sample through the cell number in the sample homogenate which is workedout from the two levels of DNA and RNA; the disadvantage that relative differentiation can only be reflected by taking housekeeping genes as an internal reference, and the analysis is truer and more reliable from the two levels of DNA and RNA.

Detection method of miRNA absolute expression level in biological sample

Simple Summary Recurrent nasopharyngeal carcinoma is one of the major causes of death among NPC patients. However, there are no international guidelines for the treatment of patients with recurrent NPC now. In this article, we summarize past publications on clinical research and mechanistic studies related to recurrent NPC, combined with the experience and lessons learned by our institutional multidisciplinary team in the treatment of recurrent NPC. We propose an objective protocol for the treatment of recurrent NPC. Abstract Recurrent nasopharyngeal carcinoma (NPC), which occurs in 10–20% of patients with primary NPC after the initial treatment modality of intensity-modulated radiation therapy (IMRT), is one of the major causes of death among NPC patients. Patients with recurrent disease without distant metastases still have a chance to be saved, but re-treatment often carries more serious toxicities or higher risks. For this group of patients, both otolaryngologists and oncologists are committed to developing more appropriate treatment regimens that can prolong patient survival and improve survival therapy. Currently, there are no international guidelines for the treatment of patients with recurrent NPC. In this article, we summarize past publications on clinical research and mechanistic studies related to recurrent NPC, combined with the experience and lessons learned by our institutional multidisciplinary team in the treatment of recurrent NPC. We propose an objective protocol for the treatment of recurrent NPC.

https://www.mdpi.com/2072-6694/14/17/4111/pdf?version=1661419229

Fengjun Wang

Papers

Correlation and quantitation of microRNA aberrant expression in tissues and sera from patients with breast tumor

Identification of Robust Biomarkers for Early Predicting Efficacy of Subcutaneous Immunotherapy in Children With House Dust Mite-Induced Allergic Rhinitis by Multiple Cytokine Profiling

Serology biological marker for detecting tumor of breast and application thereof

Detection method of miRNA absolute expression level in biological sample

Treatment of Recurrent Nasopharyngeal Carcinoma: A Sequential Challenge