Medicinal attributes of 1,2,3-triazoles: Current developments

Cu(I)-catalyzed azide–alkyne 1,3-dipolar cycloaddition (CuAAC), popularly known as the “click reaction”, serves as the most potent and highly dependable tool for facile construction of simple to complex architectures at the molecular level. Click-knitted threads of two exclusively different molecular entities have created some really interesting structures for more than 15 years with a broad spectrum of applicability, including in the fascinating fields of synthetic chemistry, medicinal science, biochemistry, pharmacology, material science, and catalysis. The unique properties of the carbohydrate moiety and the advantages of highly chemo- and regioselective click chemistry, such as mild reaction conditions, efficient performance with a wide range of solvents, and compatibility with different functionalities, together produce miraculous neoglycoconjugates and neoglycopolymers with various synthetic, biological, and pharmaceutical applications. In this review we highlight the successful advancement of Cu(I)...

Cu-Catalyzed Click Reaction in Carbohydrate Chemistry

DNA and RNA can adopt various secondary structures. Four-stranded G-quadruplex (G4) structures form through self-recognition of guanines into stacked tetrads, and considerable biophysical and structural evidence exists for G4 formation in vitro. Computational studies and sequencing methods have revealed the prevalence of G4 sequence motifs at gene regulatory regions in various genomes, including in humans. Experiments using chemical, molecular and cell biology methods have demonstrated that G4s exist in chromatin DNA and in RNA, and have linked G4 formation with key biological processes ranging from transcription and translation to genome instability and cancer. In this Review, we first discuss the identification of G4s and evidence for their formation in cells using chemical biology, imaging and genomic technologies. We then discuss possible functions of DNA G4s and their interacting proteins, particularly in transcription, telomere biology and genome instability. Roles of RNA G4s in RNA biology, especially in translation, are also discussed. Furthermore, we consider the emerging relationships of G4s with chromatin and with RNA modifications. Finally, we discuss the connection between G4 formation and synthetic lethality in cancer cells, and recent progress towards considering G4s as therapeutic targets in human diseases.

/pdf/the-regulation-and-functions-of-dna-and-rna-g-quadruplexes-wfyyt96h7s.pdf

The regulation and functions of DNA and RNA G-quadruplexes.

The intriguing structural diversity in folded topologies available to guanine-rich nucleic acid repeat sequences have made four-stranded G-quadruplex structures the focus of both basic and applied research, from cancer biology and novel therapeutics through to nanoelectronics. Distributed widely in the human genome as targets for regulating gene expression and chromosomal maintenance, they offer unique avenues for future cancer drug development. In particular, the recent advances in chemical and structural biology have enabled the construction of bespoke selective DNA based aptamers to be used as novel therapeutic agents and access to detailed structural models for structure based drug discovery. In this critical review, we will explore the important underlying characteristics of G-quadruplexes that make them functional, stable, and predictable nanoscaffolds. We will review the current structural database of folding topologies, molecular interfaces and novel interaction surfaces, with a consideration to their future exploitation in drug discovery, molecular biology, supermolecular assembly and aptamer design. In recent years the number of potential applications for G-quadruplex motifs has rapidly grown, so in this review we aim to explore the many future challenges and highlight where possible successes may lie. We will highlight the similarities and differences between DNA and RNA folded G-quadruplexes in terms of stability, distribution, and exploitability as small molecule targets. Finally, we will provide a detailed review of basic G-quadruplex geometry, experimental tools used, and a critical evaluation of the application of high-resolution structural biology and its ability to provide meaningful and valid models for future applications (255 references).

The application of DNA and RNA G-quadruplexes to therapeutic medicines

Cellular signaling networks are the foundation which determines the fate and function of cells as they respond to various cues and stimuli. The discovery of fluorescent proteins over 25 years ago enabled the development of a diverse array of genetically encodable fluorescent biosensors that are capable of measuring the spatiotemporal dynamics of signal transduction pathways in live cells. In an effort to encapsulate the breadth over which fluorescent biosensors have expanded, we endeavored to assemble a comprehensive list of published engineered biosensors, and we discuss many of the molecular designs utilized in their development. Then, we review how the high temporal and spatial resolution afforded by fluorescent biosensors has aided our understanding of the spatiotemporal regulation of signaling networks at the cellular and subcellular level. Finally, we highlight some emerging areas of research in both biosensor design and applications that are on the forefront of biosensor development.

Genetically Encoded Fluorescent Biosensors Illuminate the Spatiotemporal Regulation of Signaling Networks.

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.

Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction

Cytochrome P450-dependent electron transfer systems represent a diverse and important class of metalloproteins that show significant promise as a source of new materials for bioelectronics, design of new biosensors and multistage enzyme processing systems (for discussion see Nicolini et al., 1995; Pashkevitch et al., 1996).

Targeted Expression of Mammalian Cytochromes P450SCC and P4502B4 in Yeast Saccharomyces cerevisiae

Construction of a diphtheria toxin-streptavidin chimeric gene and its expression in escherichia coli

Recombinant protein PGEk, consisting of the human epidermal growth factor (hEGF) and a DNA-binding domain, proved to be capable of interacting with the hEGF receptor and inducing cell proliferation, as characteristic of hEGF. PGEk complexes with the telomere-mimic oligonucleotide d(TTAGGG)4 (TMO) and its thio analog (TMS) were efficiently and selectively internalized by cells with a high-level expression of the hEGF receptors. The extent of internalization was studied as a function of the PGEk: oligonucleotide ratio in the complex. The intracellular location of the oligonucleotides was determined. PGEk was found to ensure a more efficient delivery of the oligonucleotides and to protect them from nuclease degradation. The oligonucleotides contained in the complexes exerted a far greater cytotoxic effect as compared with the free oligonucleotides.

/pdf/complexes-of-telomeric-oligonucleotides-with-the-pgek-1b5wk9n8b1.pdf

Galina E. Pozmogova

Papers

Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction

Targeted Expression of Mammalian Cytochromes P450SCC and P4502B4 in Yeast Saccharomyces cerevisiae

Construction of a diphtheria toxin-streptavidin chimeric gene and its expression in escherichia coli

Complexes of telomeric oligonucleotides with the PGEk protein vector: Internalization by target cells and antiproliferative activity

Identification of chalcone synthase genes specifically expressed in petalsof two cotton species