Mammalian skeletal muscle comprises different fiber types, whose identity is first established during embryonic development by intrinsic myogenic control mechanisms and is later modulated by neural and hormonal factors. The relative proportion of the different fiber types varies strikingly between species, and in humans shows significant variability between individuals. Myosin heavy chain isoforms, whose complete inventory and expression pattern are now available, provide a useful marker for fiber types, both for the four major forms present in trunk and limb muscles and the minor forms present in head and neck muscles. However, muscle fiber diversity involves all functional muscle cell compartments, including membrane excitation, excitation-contraction coupling, contractile machinery, cytoskeleton scaffold, and energy supply systems. Variations within each compartment are limited by the need of matching fiber type properties between different compartments. Nerve activity is a major control mechanism of the fiber type profile, and multiple signaling pathways are implicated in activity-dependent changes of muscle fibers. The characterization of these pathways is raising increasing interest in clinical medicine, given the potentially beneficial effects of muscle fiber type switching in the prevention and treatment of metabolic diseases.

Fiber types in mammalian skeletal muscles.

Focal and segmental glomerulosclerosis (FSGS) is a common, non-specific renal lesion Although it is often secondary to other disorders, including HIV infection, obesity, hypertension and diabetes, FSGS also appears as an isolated, idiopathic condition FSGS is characterized by increased urinary protein excretion and decreasing kidney function Often, renal insufficiency in affected patients progresses to end-stage renal failure, a highly morbid state requiring either dialysis therapy or kidney transplantation Here we present evidence implicating mutations in the gene encoding alpha-actinin-4 (ACTN4; ref 2), an actin-filament crosslinking protein, as the cause of disease in three families with an autosomal dominant form of FSGS In vitro, mutant alpha-actinin-4 binds filamentous actin (F-actin) more strongly than does wild-type alpha-actinin-4 Regulation of the actin cytoskeleton of glomerular podocytes may be altered in this group of patients Our results have implications for understanding the role of the cytoskeleton in the pathophysiology of kidney disease and may lead to a better understanding of the genetic basis of susceptibility to kidney damage

https://www.childrenshospital.org/~/media/research-and-innovation/research-labs/beggs-lab/pdfs/44.ashx?la=en

Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis.

There is increasing evidence for strong genetic influences on athletic performance and for an evolutionary “trade-off” between performance traits for speed and endurance activities. We have recently demonstrated that the skeletal-muscle actin-binding protein α-actinin-3 is absent in 18% of healthy white individuals because of homozygosity for a common stop-codon polymorphism in the ACTN3 gene, R577X. α-Actinin-3 is specifically expressed in fast-twitch myofibers responsible for generating force at high velocity. The absence of a disease phenotype secondary to α-actinin-3 deficiency is likely due to compensation by the homologous protein, α-actinin-2. However, the high degree of evolutionary conservation of ACTN3 suggests function(s) independent of ACTN2. Here, we demonstrate highly significant associations between ACTN3 genotype and athletic performance. Both male and female elite sprint athletes have significantly higher frequencies of the 577R allele than do controls. This suggests that the presence of α-actinin-3 has a beneficial effect on the function of skeletal muscle in generating forceful contractions at high velocity, and provides an evolutionary advantage because of increased sprint performance. There is also a genotype effect in female sprint and endurance athletes, with higher than expected numbers of 577RX heterozygotes among sprint athletes and lower than expected numbers among endurance athletes. The lack of a similar effect in males suggests that the ACTN3 genotype affects athletic performance differently in males and females. The differential effects in sprint and endurance athletes suggests that the R577X polymorphism may have been maintained in the human population by balancing natural selection.

/pdf/actn3-genotype-is-associated-with-human-elite-athletic-2z5kcdnpic.pdf

ACTN3 Genotype Is Associated with Human Elite Athletic Performance

▪ Abstract Striated muscle is an intricate, efficient, and precise machine that contains complex interconnected cytoskeletal networks critical for its contractile activity. The individual units of the sarcomere, the basic contractile unit of myofibrils, include the thin, thick, titin, and nebulin filaments. These filament systems have been investigated intensely for some time, but the details of their functions, as well as how they are connected to other cytoskeletal elements, are just beginning to be elucidated. These investigations have advanced significantly in recent years through the identification of novel sarcomeric and sarcomeric-associated proteins and their subsequent functional analyses in model systems. Mutations in these cytoskeletal components account for a large percentage of human myopathies, and thus insight into the normal functions of these proteins has provided a much needed mechanistic understanding of these disorders. In this review, we highlight the components of striated muscle cyt...

Striated muscle cytoarchitecture: an intricate web of form and function.

The history of click-speaking Khoe-San, and African populations in general, remains poorly understood. We genotyped ~2.3 million single-nucleotide polymorphisms in 220 southern Africans and found that the Khoe-San diverged from other populations ≥100,000 years ago, but population structure within the Khoe-San dated back to about 35,000 years ago. Genetic variation in various sub-Saharan populations did not localize the origin of modern humans to a single geographic region within Africa; instead, it indicated a history of admixture and stratification. We found evidence of adaptation targeting muscle function and immune response; potential adaptive introgression of protection from ultraviolet light; and selection predating modern human diversification, involving skeletal and neurological development. These new findings illustrate the importance of African genomic diversity in understanding human evolutionary history.

/pdf/genomic-variation-in-seven-khoe-san-groups-reveals-45jy12a557.pdf

Genomic Variation in Seven Khoe-San Groups Reveals Adaptation and Complex African History

T he α-actinins are actin-binding proteins encoded by a multigene family. In skeletal muscle, they are a major structural component of the Z-lines that anchor the actin-containing thin filaments and maintain the spatial relationship between myofilaments 1. In humans, two genes (ACTN2 and ACTN3) encode the closely related α-actinin-2 and α-actinin-3 skeletal muscle iso-forms 2. ACTN2 is expressed in all skeletal muscle fibres, whereas expression of ACTN3 is limited to a subset of type 2 (fast) fibres 3. We have previously demonstrated absence of α-actinin-3 in muscle biopsies from several patients with muscular dystrophy 3. A follow-up study identified additional α-actinin-3−negative biopsies from neuromuscular patients with other known diseases, suggesting that this deficiency was not the primary cause of muscle weakness 4. Subsequently, we screened muscle specimens with dys-trophic (118 specimens), myopathic (74), neurogenic (20) and normal (55) features (Fig. 1a−d). Although these biopsies contained normal α-actinin-2 expression, deficiency of α-actinin-3 was identified by immunocytochemistry and western blot in 51 of 267 cases (19%), a finding not associated with any particular histo-pathological or clinical phenotype. To ascertain whether α-actinin-3 deficiency was associated with mutations of ACTN3, we used an RT-PCR approach to amplify mRNA isolated from diagnostic muscle biopsies. Using primer pairs AB16/AB9 (5´–GATGGTTATGCAGCCCGAGG–3ánd 5´–AGCAACGCCCGCACCTCCT–3´) and AB8/AB1 (5´–TGCACGAAGCCTG-GACCC–3ánd 5´–AGAGAGGGATCTT-TATTCAG–3´), we PCR-amplified two overlapping fragments encompassing bases 24−2,852 of ACTN3 mRNA (ref. 2). Initially, we focused on one family with two affected male siblings with congenital muscular dystrophy and complete deficiency of α-actinin-3. Sequencing of ACTN3 cDNA from the proband identified two changes relative to controls and the previously determined sequence M86407. These were an A→G transition at nt 1,586 in exon 15, changing a gluta-mine (CAG) to an arginine (CGG) at residue 523 (Q523R), and a C→T trans-version at position 1,747 in exon 16, converting an arginine to a stop codon at residue 577 (R577X; Fig. 1e−g). Direct sequencing of genomic DNA from the proband and the affected sibling confirmed homozygosity for both point mutations. Subsequent testing of the parents and two unaffected siblings revealed that these phenotypically normal individuals had the same genotype as the proband and were thus homozygous for the ACTN3 577X nonsense mutation. The R577X change creates a novel DdeI site (Fig. 1h). An additional 125 biopsies for which matched DNA samples were available were tested for α-actinin-3 expression and ACTN3 genotype (48 α-actinin-3−deficient and 77 α-actinin-3− positive biopsies with a mixture of histological and clinical …

Michelle Mills

Papers

A common nonsense mutation results in alpha-actinin-3 deficiency in the general population.