The global economy of the international trade of herbal products has been increasing by 15% annually, with the raw material for most herbal products being sourced from South and Southeast Asian countries. In India, of the 8000 species of medicinal plants harvested from the wild, approximately 960 are in the active trade. With increasing international trade in herbal medicinal products, there is also increasing concern about the widespread adulteration and species admixtures in the raw herbal trade. The adverse consequences of such species adulteration on the health and safety of consumers have only recently begun to be recognised and documented. We provide a comprehensive review of the nature and magnitude of species adulteration in the raw herbal trade, and identify the underlying drivers that might lead to such adulteration. We also discuss the possible biological and chemical equivalence of species that are used as adulterants and substitutes, and the consequences thereof to consumer health and safety, and propose a framework for the development of a herbal trade authentication service that can help regulate the herbal trade market.

Species Adulteration in the Herbal Trade: Causes, Consequences and Mitigation.

DNA barcoding detects contamination and substitution in North American herbal products

Progress in the use of DNA barcodes in the identification and classification of medicinal plants.

Ayurveda is one of the oldest systems of medicine in the world, but the growing commercial interest in Ayurveda based products has increased the incentive for adulteration and substitution within this herbal market. Fraudulent practices such as the use of undeclared fillers and use of other species of inferior quality is driven both by the increased as well as insufficient supply capacity of especially wild plant species. Developing novel strategies to exhaustively assess and monitor both the quality of raw materials and final marketed herbal products is a challenge in herbal pharmacovigilance. Seventy-nine Ayurvedic herbal products sold as tablets, capsules, powders, and extracts were randomly purchased via e-commerce and pharmacies across Europe, and DNA metabarcoding was used to assess the ability of this method to authenticate these products. Our analysis reveals that only two out of 12 single ingredient products contained only one species as labeled, eight out of 27 multiple ingredient products contained none of the species listed on the label, and the remaining 19 products contained 1 to 5 of the species listed on the label along with many other species not specified on the label. The fidelity for single ingredient products was 67%, the overall ingredient fidelity for multi ingredient products was 21%, and for all products 24%. The low level of fidelity raises concerns about the reliability of the products, and detection of threatened species raises further concerns about illegal plant trade. The study highlights the necessity for quality control of the marketed herbal products and shows that DNA metabarcoding is an effective analytical approach to authenticate complex multi ingredient herbal products. However, effort needs to be done to standardize the protocols for DNA metabarcoding before this approach can be implemented as routine analytical approaches for plant identification, and approved for use in regulated procedures.

/pdf/dna-metabarcoding-authentication-of-ayurvedic-herbal-1cqfws48kr.pdf

DNA Metabarcoding Authentication of Ayurvedic Herbal Products on the European Market Raises Concerns of Quality and Fidelity

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

/pdf/derivative-technology-of-dna-barcoding-nucleotide-signature-3vgi6z7iqh.pdf

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

Saraca asoca (Roxb.) Willd, commonly known as “Asoka” or “Ashoka,” is one of the most important medicinal plants used in raw herbal trade in India. The bark extracts of the tree are used in the treatment of leucorrhea and other uterine disorders besides also having anti-inflammatory, anti-bacterial, anti-pyretic, anti-helminthic, and analgesic activity. The indiscriminate and rampant extraction of the wood to meet the ever-increasing market demand has led to a sharp decline in naturally occurring populations of the species in the country. Consequently, the species has recently been classified as “vulnerable” by the International Union for Conservation of Nature (IUCN). Increasing deforestation and increasing demand for this medicinal plant have resulted in a limited supply and suspected widespread adulteration of the species in the raw herbal trade market. Adulteration is a serious concern due to: (i) reduction in the efficacy of this traditional medicine, (ii) considerable health risk to consumers, and (iii) fraudulent product substitution that impacts the economy for the Natural Health Product (NHP) Industry and consumers. In this paper, we provide the first attempt to assess the extent of adulteration in the raw herbal trade of S. asoca using DNA barcoding validated by NMR spectroscopic techniques. Analyzing market samples drawn from 25 shops, mostly from peninsular India, we show that more than 80 % of the samples were spurious, representing plant material from at least 7 different families. This is the first comprehensive and large-scale study to demonstrate the widespread adulteration of market samples of S. asoca in India. These results pose grave implications for the use of raw herbal drugs, such as that of S. asoca, on consumer health and safety. Based on these findings, we argue for a strong and robust regulatory framework to be put in place, which would ensure the quality of raw herbal trade products and reassure consumer confidence in indigenous medicinal systems.

/pdf/dna-barcoding-and-nmr-spectroscopy-based-assessment-of-3zvn77cnhu.pdf

DNA barcoding and NMR spectroscopy-based assessment of species adulteration in the raw herbal trade of Saraca asoca (Roxb.) Willd, an important medicinal plant.

Santhosh Kumar Jayanthinagar Urumarudappa

Papers

DNA barcoding and NMR spectroscopy-based assessment of species adulteration in the raw herbal trade of Saraca asoca (Roxb.) Willd, an important medicinal plant.