Showing papers in "International Journal of Biosciences in 2020"
TL;DR: A package of fertilizer technology based on biological materials using indigenous endomycorrhiza and Rhizobium is designed to improve nitrogen and phosporus uptake and show the best effect on the number of effective root nodules per plant and nutrient uptake by plant.
Abstract: Increasing the productivity of soybeans in dry land can be done by designing a package of fertilizer technology based on biological materials using indigenous endomycorrhiza and Rhizobium. The application of indigenous endomycorrhizal biofertilizer combined with Rhizobium is expected to be able to improve nitrogen and phosporus uptake so as to increase the productivity of soybeans in dry land. The experiment used two-factor factorial randomized block design. The first factor was dose of endomycorrhizal spores of Glomus that consisted of four levels, namely, treatment without endomycorrhiza inoculation, dose of 50 endomycorrhizal spores, dose of 100 endomycorrhizal spores, and dose of 150 endomycorrhizal spores. The second factor was inoculation of Rhizobium inoculum that consisted of two levels, namely, treatment without Rhizobium inoculation and Rhizobium inoculation. The results showed that combination of 50 endomycorrhizal spores with Rhizobium inoculation gave the best effect on the number of effective root nodules per plant, endomycorrhizal infection per plant, nutrient uptake by plant, number of pods per plant, number of seeds per plant, and oven-dry weight of seeds per plant.
8 citations
TL;DR: In this article, colchicine in hydrogen peroxide was administered as mutagen on seeds three species of crops i.e. mutan M2 cowpea, yardlong bean, and common bean by soaking method.
Abstract: Research on doubling plant chromosome using colchicine has been carried out for years with water as its solvent. In this study, an innovation was carried out by trying to do colchicine treatment in hydrogen peroxide. In this in vivo induced mutagenesis research, colchicine in hydrogen peroxide was administered as mutagen on seeds three species of crops i.e. mutan M2 cowpea, yardlong bean, and common bean by soaking method. The results of this research showed that three times multistep mutant (M3) of cowpea was having mutant characteristics that the shape of its leaflet changed from rhombus to ovate. Besides, both yardlong bean varieties used in this research (BLR and KTR) showed indication of a mutant crop that having compound leaves with more than three leaflets in a stalk. Common bean of PTW variety was not attacked by any aphid but it was attacked by leafminer. Finally, we found “rainbow common bean” from this research.
5 citations
TL;DR: This research aimed to obtain basic data on DNA polymorphism, genetic relationship, genetic similarity level, and molecular accession of Bali’s unique local mango.
Abstract: Creation of new superior varieties of mango through the empowerment of local genetic resources requires information about the potential properties of mango germplasm, including DNA polymorphism and its genetic diversity. This research aimed to obtain basic data on DNA polymorphism, genetic relationship, genetic similarity level, and molecular accession of Bali’s unique local mango. Sampling was conducted in four regencies in the Province of Bali. DNA preparation, PCR, and microsatellite analysis were carried out at the Laboratory of Genetics and Plant Breeding, Faculty of Agriculture, Gadjah Mada University. It found 44 accessions of mangoes in Bali. The test results with 10 pairs of SSR markers showed that all primers produced polymorphic loci. There were 825 amplified DNA bands. Primer of AY31 produced the highest number of loci, which were 14 loci, while AY21 produced the fewest loci, i.e., 3 loci. Forty-four mango accessions showed a genetic similarity coefficient of 0.27 to 0.97. At a coefficient of 0.27, accessions were divided into 2 major groups: group A and group B. Group A consisted of two accessions, namely, KRA-005 and BDG-006 (Mangifera foetida Lour.), which had a similar coefficient of 0.657. Group B was divided into two smaller groups, namely, groups B1 and B2, at a similarity coefficient of 0.342. Group B1 consisted of 39 accessions, while group B2 consisted of 3 accessions. Accessions Madu Anggur, Gading, Sambuk Mengwi, Kakul and Pakel Sulangai were identified as having unique alleles.
5 citations
TL;DR: The results showed that the ethanol extract of Gracilaria sp.
Abstract: The purpose of this study was to know the effectiveness of Gracilaria sp. ethanol extract to inhibit the growth of Aspergillus niger. The results showed that the ethanol extract of Gracilaria sp. was not effective to inhibit the growth of A. niger. The minimum inhibitory concentration test (MIC) was carried out using extracts with 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7 %, 0.8 %, 0.9%, 1%, 2% and 0% percentage. The MIC results showed that the minimum extract inhibiting A. niger was 0.8%. The results of the antifungal activity test showed that the ethanol extract of Gracilaria sp. was fungistatic against A. niger. On the third day incubation, the 4% extract inhibited the growth of fungi with an average diameter of 5 mm. The fungal colony test was carried out using extract with 0.5%, 1%, 2%, 4% and 0% concentration, and the results showed that extract with 4% concentration can inhibit fungi colony growth by 69%. Phytochemical analysis was conducted using the UV-Vis Spectrophotometry, and the results showed that the ethanol extract of Gracilaria sp. contained 366.33 mg/100g/GAE phenol, 2041.47 mg/100g flavonoids, and 3041.60 mg/100g/TAE tannins. Tannins are suspected to be the most dominant fungistatic compound with the largest amount.
3 citations
TL;DR: Both direct and indirect organogenesis (multiple shoot induction) were carried out on media with very similar contents, so very simple and practical methods tissue culture for different improved programs in Citrus genius genius are used.
Abstract: Citrus is an important genius for economy and human health but a susceptible genius against biotic and abiotic stresses, so it needs to improved programs. Different basal media (MS, 1⁄2MA, 1⁄3MS and DKW) and different kind and concentrations of plant growth regulators i.e. BA, KIN, 2ip, ZE and TDZ (0 – 2 mg/l) and NAA, IAA and IBA (0 – 2 mg/l) added with 30 g/l sucrose, 3 g/l active charcoal and 7.5 g/l bacteriological agar] were used for organogenesis include shooting and rooting, also callusing from nodal explant of Citrus latifolia. MS medium supplemented with 1 mg/l BA, and 0.01 mg/l NAA is the best media for multiple shoot induction on nodal explants and elongation of them. Other cytokinins had not significant effects on shoot induction and multiplication. Using of 0.01 mg/l IBA instead of 0.01 mg/l NAA on medium with 1 mg/l BA, led to multiple shoot induction on nodal explant indirectly. Rooting was induced on DKW medium plus 1.5 mg/l NAA in the best way compared another media. Both direct and indirect organogenesis (multiple shoot induction) were carried out on media with very similar contents. So we can use very simple and practical methods tissue culture for different improved programs in Citrus genius genius.
3 citations
TL;DR: In this paper, the authors investigated the response of four Indonesian improved soybean varieties based on the application of Bio-Detas input package in rainfed lowland, and found that varieties had a significant influence on the number of leaves, number of nodus and number of flowers during the vegetative phase.
Abstract: Soybean is one of the most important food crops in Indonesia after rice and corn, due to its protein content reaches 40%. Rainfed lowland can be used as expansion planting area in hopes of obtaining high productivity with efficient inputs. In order to increase yield, it is necessary to apply the Bio-Detas input package that priorities the use of adaptive improved varieties, organic fertilizers and biological pesticides. This research aim to investigate the response of four Indonesian improved soybean varieties based on the application of Bio-Detas input package in rainfed lowland. The experiment was conducted from March to July 2018 in Pengembur Village, Central Lombok Regency of West Nusa Tenggara Province, Indonesia. The experiment was conducted using a non-factorial randomized block design with varieties as treatments, namely Argomulyo, Burangrang, Dega-1, and Dena-1. Each treatment was repeated three times therefore there were 12 experimental plots in total. Parameters observed during the vegetative and generative phases including plant height, number of branches, number of leaves, number of nodus, number of flowers and number of pods. Data were collected from five plants for each replication. Results showed that varieties had a significant influence on the number of leaves, number of nodus and number of flowers during the vegetative phase. While during the generative phase there were a significant effect of varieties on plant height, number of leaves and number of nodus. Due to dry season occurred earlier in April, yield on Bio-Detas input package was reached 578 kg/ha compared to farmer’s existing technology was 393 kg/ha.
3 citations
TL;DR: The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei, and the phylogenetic analysis shows that the mtCOI sequence of P. minei from Bali has the highest percentage among others.
Abstract: One of the pests of citrus is whitefly that causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.
3 citations
TL;DR: This research found that only the seed tip-cutting and imbibition plants amplified along the 550-bp band, while those of the prick and coat method did not.
Abstract: The SoSPS1 gene of sugar cane plants previously subjected to Agrobacterium tumefacienmediated cloning was to be transferred to citrus plants to increase metabolism of sucrose in plant. The T-DNA harbored the SoSPS1 gene under the control of the CaMV 35S promoter from the cauliflower mosaic virus and contained the NPTII gene (kanamycin resistance gene) as a selectable marker for transformant selection. Generally, gene transformation in plants is carried out by tissue culture. However, tissue culture has several disadvantages such as its being time-consuming, its sometimes resulting in somatic mutations and somaclonal variations, and the requirement of sterile conditions in the procedure of gene transfer. In planta transformation is a useful system for those plants that lack tissue culture and regeneration system. The main function of in planta transformation is to recover the advantages of tissue culture as an efficient, quick method, including its ability to produce a large number of transgenic plants and to accumulate a high concentration of total soluble protein in short time. There are two procedures of in planta transformation for the seeds of citrus plants, namely “prick and coat” and “seed tip-cutting and imbibition”. In the prick and coat method, seeds are pricked on their entire surfaces and smeared with a suspension of Agrobacterium tumefaciens. In the seed tip-cutting and imbibition method, on the other hand, seeds are cut at the tip and soaked in a suspension of Agrobacterium tumefaciens. The leaves derived from seeds treatment were taken as samples for DNA extraction and PCR using primers of the NPTII gene (Forward: 5’-GTCATCTCACCTTCCTCCTGCC-3’; Reverse: 5’GTCGCTTGGTCGGTCATTTCG-3’). This research found that only the seed tip-cutting and imbibition plants amplified along the 550-bp band, while those of the prick and coat method did not. Additionally, the T-DNA was successfully integrated into the genome of the plants treated with the seed tip-cutting and imbibition method but not with the prick and coat.
2 citations
TL;DR: The development of strawberry farming in Bali experiencing some obstacles that cause a decline in production, such as wilting disease, the disease was reported caused by the fungi base on morphological recognition and the identification of strawberry wilt disease using molecular analysis was conducted.
Abstract: The development of strawberry farming in Bali experiencing some obstacles that cause a decline in production, such as wilting disease. The disease was reported caused by the fungi base on morphological recognition. There are two fungi were recognized caused the strawberry wilt disease in Bali, they are from genus Verticillium and Fusarium. More specific information about causal agent of wilt disease in strawberry especially in Bali is needed. The one accurate identification is done through the molecular approach by analyzing DNA that encode the ribosomal DNA (rDNA). The 18S rDNA, including the internal areas of transcribed spacers (ITS), ITS1 and ITS4 have been widely used in phylogenetic studies. The amplification results of this area produce bands in different sizes that can be used to identify fungal species. Based on that the identification of strawberry wilt disease using molecular analysis was conducted. The 542 bp of Internal Transcribed Spacer (ITS) DNA was successfully amplified using PCR with pairing primers ITS 1 (5TCCGTAGGTGAACCTGCGG-3’), and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’). The sequences of three isolates were successfully obtained through sequencing. Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Based on phylogeny analysis of Pancasari, Gobleg and Candi Kuning isolates were obtained in one group with Fusarium oxysporum identified in America and Brazil, and also in one group with Fusarium oxysporum f. sp. fragariae that identified in China.
2 citations
Journal Article•
1 citations
TL;DR: The activity test of antioxidants quantitatively by DPPH using UV-Vis spectrophotometry found out that purnajiwa extract has strong antioxidant activity that could be used as natural antioxidant resources.
Abstract: Antioxidant is a chemical compound that could give one or more electrons to inhibit the free radical reaction. One of the plants that potentially produce antioxidants is purnajiwa (Euchresta horsfieldii (Lesch.) Benn.). The research was conducted using the fruit of purnajiwa. The purpose of this study is to know antioxidant activity from purnajiwa fruit using the DPPH method and measured by UV-Vis spectrophotometry. The extract of purnajiwa fruit gained by the maceration method using 96% ethanol solvent. The results of phytochemistry screening found out that the extract contains flavonoid, alkaloid, saponin, tannin, and terpenoid. According to flavonoid testing using quercetin, the results obtained from purnajiwa extract contained flavonoid of 1,651 mg QE/g. The activity test of antioxidants quantitatively by DPPH using UV-Vis spectrophotometry found out that purnajiwa extract has IC50 value of 57,28 ppm so that purnajiwa extract has strong antioxidant activity that could be used as natural antioxidant resources.
TL;DR: This study designed some primers that amplified only CVPD DNA fragment from T. trifolia which considers as the resistant plant and a primer that amplifiedonly DNA fragmen from Citrus nobilis which consider as the susceptible citrus plants.
Abstract: CVPD is a DNA fragment that indicates that plants are resistant to CVPD. Previous research using primers that amplified 841 bp CVPD fragment was able to amplify the fragment from Triphasia trifolia that considers being a resistant plant, Citrus aurantifolia var. seedless which considers being a tolerant plant, and some susceptible citrus plants to CVPD disease. In this study, we designed some primers that amplified only CVPD DNA fragment from T. trifolia which consider as the resistant plant and a primer that amplified only DNA fragmen from Citrus nobilis which consider as the susceptible citrus plants. The primers for CVPD on T. trifolia are TCATCTGCATGGGATACC for forward primer and GCCTTGAGCTTGTAAGTG for reverse primer which turned out to amplify the DNA of T. trifolia and also the C. nobilis cultivar Denpasar and only succeeded in not amplifying the C. nobilis cultivar Gianyar. The primers for CVPD on C. nobilis are GAATGGCTTAGCAGAAAGG for forward primer and GGTTGTAGATGGACATAGG for reverse primer turned out can not only amplify the DNA C. nobilis but also amplify T. trifolia.
TL;DR: In this paper, Bulung Sangu (Gracilaria spp) was macerated in ethanol 96% followed by extract formulation in cream preparation in two concentrations: 5% and 10%.
Abstract: Bulung Sangu (Gracilaria spp) as many other macroalgae, is a source of beneficial phytochemical for health. Phytochemicals in macroalgae are widely used as active ingredients in cosmetic preparations. The study was aimed to determine the antioxidant properties of Bulung Sangu formulated in topical preparation. Bulung Sangu was macerated in ethanol 96% following by extract formulation in cream preparation in two concentrations: 5% and 10%. Antioxidant activity was determined against DPPH radical, compared to ascorbic acid. Percentage of reducing power in five concentration series (10, 20, 30, 40, and 50 μm/ml) statistical analyzes using one-way ANOVA with 95% of confidence level, following by IC50 measurement. Absorbance was read in wavelength of 517 nm. Concentration of 5% and 10% cream extract exhibited IC50 of 13,091 μg/ml and 11,867 μg/ml, respectively. These values are lower than IC50 of ascorbic acid (18,505 μg/ml), indicating the strong antioxidant properties of Bulung Sangu extract cream which is more potential than ascorbic acid. Bulung Sangu exhibit a potential source for being developed as medicine and cosmetics in topical preparation.
TL;DR: It can be concluded that among medium used in the current research, the medium of MS added with 1 ppm thidiazuron (TDZ) was the most suitable medium for shoot production of strawberry from the explant of runner-tips.
Abstract: A research regarding “Runner-tip culture of strawberry (Fragaria x ananassa Duch) Grown on Several Shoot-induction Medium” has been investigated. The objective of the research was to find out the most suitable medium for shoot production from runner-tip culture of strawberry at establishment step of micropropagation. The research was laid out in a Completely Randomized Design, 4 treatments of medium type for shoot induction and 10 replication, each was represented by one (1) bottle with 6-8 explants. The treatments were summarized as follows: T1 = MS ; T2 = MS + 2 ppm BAP + 0.01 ppm NAA; T3 = MS + 1 ppm of TDZ; T4 = WPM + 2 ppm BAP + 0.01 ppm NAA. The parameters observed were days of the bud emergence, the average number of shoots per explant, and the average number of leaves per explant. It can be concluded that among medium used in the current research, the medium of MS added with 1 ppm thidiazuron (TDZ) was the most suitable medium for shoot production of strawberry from the explant of runner-tips. The treatment was resulted in the earliest time of bud emergence, and producing the highest number of shoots and leaves.
TL;DR: In this article, the authors used Gas Chromatography Mass Spectrometry (GC-MS) and Fourier-transform infrared (FTIR) spectroscopy to analyze limonene and other antioxidants content of the essential oils in the market compared to homemade virgin coconut oil.
Abstract: Essential oil production in the market is very diverse with various brands labeled as antioxidants that have gained more attention in the society recently. The purpose of this study was to analyze limonene and other antioxidants content of the essential oils in the market compared to homemade virgin coconut oil. The method used was Gas Chromatography Mass Spectrometry (GC-MS) and Fourier-transform infrared (FTIR) Spectroscopy. The infrared spectrogram showed the presence of alkanes and esters respectively at wave numbers of 3000-2850 and 1750-1730 cm. Chromatogram results showed the presence of limonene compounds and some antioxidants with a fairly good separation in the several types of oils, which was not detected in the homemade virgin coconut oil.