Showing papers on "Chromosomal region published in 1980"

Cytogenetic analysis of the chromosomal region immediately adjacent to the rosy locus in Drosophila melanogaster.

Abstract: This report describes the genetic analysis of a region of the third chromosome of Drosophila melanogaster extending from 87D2–4 to 87E12–F1, an interval of 23 or 24 polytene chromosome bands. This region includes the rosy (ry, 3–52.0) locus, carrying the structural information for xanthine dehydrogenase (XDH). We have, in recent years, focused attention on the genetic regulation of the rosy locus and, therefore, wished to ascertain in detail the immediate genetic environment of this locus. Specifically, we question if rosy is a solitary genetic unit or part of a larger complex genetic unit encompassing adjacent genes. Our data also provide opportunity to examine further the relationship between euchromatic gene distribution and polytene chromosome structure.——The results of our genetic dissection of the rosy microregion substantiate the conclusion drawn earlier (Schalet, Kernaghan and Chovnick 1964) that the rosy locus is the only gene in this region concerned with XDH activity and that all adjacent genetic units are functionally, as well as spatially, distinct from the rosy gene. Within the rosy micro-region, we observed a close correspondence between the number of complementation groups (21) and the number of polytene chromosome bands (23 or 24). Consideration of this latter observation in conjunction with those of similar studies of other chhromosomal regions supports the hypothesis that each polytene chromosome band corresponds to a single genetic unit.

Coordinately expressed members of two chorion multi-gene families are clustered, alternating and divergently orientated.

Abstract: The chorion (eggshell) of silkmoths consists of more than 100 distinct proteins. Individual components are synthesised in characteristic and overlapping sequence, at early, middle, late or very late developmental periods of choriogenesis (which lasts 2 days in total)1,2. Protein sequencing3,4 indicates that components which belong to two size classes, A and B, are encoded by two respective families of evolutionarily homologous genes (multi-gene families). Genetic analysis in Bombyx mori5,6 has shown that chorion genes are tightly linked in three clusters on a single chromosome (n = 28). Total chorion mRNA of the wild silkworm, Antheraea polyphemus, has been copied into double-stranded cDNA and cloned by recombinant DNA procedures7. Many distinct cDNA clones have been selected and identified as members of the A and B multi-gene families by detailed cross-hybridisation7 and sequencing8 analysis. Stringent conditions which minimise cross-hybridisation permit use of these clones as specific probes. In many cases, we know the protein encoded and the developmental period when the clone sequence can be found in cytoplasmic RNA7,8. Thus, we may now use these cDNA clones as probes to determine how genes of known developmental properties and evolutionary history are arranged within the chorion chromosomal region. We report here that two cloned, 14-kilobase chromosomal DNA segments contain multiple chorion genes. In each segment, the genes represent both A and B families, but only one developmental class: one segment contains only middle-period A and B genes and the other only late-period A and B genes. In both segments, members of the two families are arranged in alternating sequence and divergent orientation.

Random segretation of multiple genetic markers from CHO-CHO hybrids: evidence for random distribution of functional hemizygosity in the genome.

Abstract: The linkage relationship between various recessive markers isolated in Chinese hamster ovary (CHO) cells has been investigated. For such studies, multiple recessive markers conferring resistance to various drugs, e.g., resistance to emetine (Emtr), thioguanine (Thgr), azaadenine (Azar), phytohemagglutinin (Phar), diphtheria toxin (Dipr), toyocamycin (Toyr), aminopterin (Amnr), and methylglyoxalbisguanyl hydrazone (Mbgr), were introduced into CHO lines by selecting successively for one drug at a time. Hybrids were constructed between the multiply marked lines and the sensitive cells, and segregation frequencies for the various markers, singly and in different pairs, were examined. Results of such studies show that of the recessive markers examined, none cosegregated from the hybrid cells. The independent segregation of the X-chromosome-linked Thgr and of the rest of the markers indicates that none of these other mutations are located on the X chromosome. These results also provide strong suggestive evidence that functional hemizygosity in CHO cells is not restricted to one or a few chromosomal regions, but rather appears to be widespread.

Two Drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F

Abstract: One Drosophila melanogaster tRNAGly gene occurs on each 1.1 – 2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.

Coordination between chromosome replication and cell division in Escherichia coli.

Abstract: Cell division properties of Escherichia coli B/r containing either a dnaC or a dnaI mutation were examined. Incubation at nonpermissive temperature resulted in the eventual production of cells of approximately normal size, or slightly smaller, which lacked chromosomal DNA. The cell division patterns in cultures which were grown at permissive temperature and then shifted to nonpermissive temperature were consistent with: first, division and equipartition of chromosomes by cells which were in the C and D periods at the time of the shift; second, an apparent delay in cell division; and third, commencement of the formation of chromosomeless cells. In glucose-grown cultures of the dnaI mutant, production of chromosomeless cells continued for at least 120 min, whereas in the dnaC mutant chromosomeless cells were formed during a single interval between 110 and 130 min after the temperature shift. The results are discussed in light of the hypothesis that replication of a specific chromosomal region is not an obligatory requirement for the initiation and completion of the processes leading to division in a cell which contains at least one functioning chromosome.

The estimation of the number of mutationally silent loci in saturation-mapping experiments

Abstract: When the technique of saturation mapping is employed to estimate the number of loci in a distinct chromosomal region, there is always the possibility that some loci will not be detected. If the number of mutants per locus follows a Poisson distribution, the number of mutationally silent loci can be estimated. This paper describes a method for fitting such data to a Poisson distribution truncated at the zero class and a method for estimating the number of mutationally silent loci. The use of these methods is demonstrated by their application to some published data.

Evidence for the assignment of GUK 1 gene locus to 1q32 leads to q43 segment from gene dosage effect.

Abstract: A male infant with dup (1) (q32 leads to q43) constitution is reported. He had mental and physical retardation and a constellation of dysmorphisms, which are considered characteristic of trisomics for the distal one-third of the long arm of chromosome 1. The assay for guanylate kinase 1 (GUK 1) activity showed a gene dosage effect and confirmed the regional assignment of this marker in the chromosomal region indicated by data derived from somatic hybrids.

Structure and function of major histocompatibility complex.

Abstract: The major histocompatibility complex (MHC) contains genes that control the structure of many important cell surface antigens and influence a variety of important biological functions. The structures of the MHC in the human, rat and mouse show a remarkable similarity both in terms of the location of their genes and the chemical structures of the gene products. Thus, the region of the chromosome containing the MHC has been highly conserved during evolution, and this finding suggests that its genes are important for survival. Another set of genes, which influences growth and development, is linked to the MHC in the mouse (T/t complex) and in the rat (Grc): this entire chromosomal region may function as a "supergene" with broad effects on tissue organization and compatibility.

Association of the herpes simplex-1 viral gene for thymidine kinase with the human gene for adenylate kinase-1 in biochemically transformed cells.

Abstract: The herpes simplex type 1 biochemically transformed human cell line, HB-1, was fused with thymidine kinase deficient rodent cells, and 18 hybrids were isolated using the HAT-ouabain selection system. The selected enzyme, viral thymidine kinase, was present in all 18 hybrids. In 16 of 18 hybrids the viral gene for thymidine kinase cosegregated with the human gene for adenylate kinase-1 (AK-1). Thirty-six bromodeoxyuridine (BrdUrd) resistant sublines were isolated from the 16 human AK-1 positive hybrids. Each BrdUrd-resistant subline was examined for the presence of the viral TK gene by back-selection in HAT medium, and for human AK-1. In all 36 BrdUrd-resistant sublines the viral TK gene cosegregated with the human AK-1 gene. These results indicate that the transforming viral DNA fragment was associated with a specific human chromosomal region in HB-1 cells.