Bean common mosaic necrosis virus (BCMNV) is a major disease in common bean (Phaseolus vulgaris L.). Host plant resistance is the primary disease control. We sought to identify candidate genes to better understand the host-pathogen interaction and develop tools for marker-assisted selection (MAS). A genome-wide association study (GWAS) approach using 182 lines from a race Durango Diversity Panel (DDP) challenged by BCMNV isolates NL-8 [Pathogroup (PG)-III] and NL-3 (PG-VI), and genotyped with 1.26 million single-nucleotide polymorphisms (SNPs), revealed significant peak regions on chromosomes Pv03 and Pv05, which correspond to bc-1 and bc-u resistance gene loci, respectively. Three candidate genes were identified for NL-3 and NL-8 resistance. Side-by-side receptor-like protein kinases (RLKs), Phvul.003G038700 and Phvul.003G038800 were candidate genes for bc-1. These RLKs were orthologous to linked RLKs associated with virus resistance in soybean (Glycine max). A basic Leucine Zipper (bZIP) transcription factor protein is the candidate gene for bc-u. bZIP protein gene Phvul.005G124100 carries a unique non-synonymous mutation at codon 14 in the first exon (Pv05: 36,114,516 bases), resulting in a premature termination codon that causes a nonfunctional protein. SNP markers for bc-1 and bc-u and new markers for I and bc-3 genes were used to genotype the resistance genes underpinning BCMNV phenotypes in the DDP, host group (HG) differentials, and segregating F3 families. Results revealed major adjustments to the current host-pathogen interaction model: (i) there is only one resistance allele bc-1 for the Bc-1 locus, and differential expression of the allele is based on presence vs. absence of bc-u; (ii) bc-1 exhibits dominance and incomplete dominance; (iii) bc-1 alone confers resistance to NL-8; (iv) bc-u was absent from HGs 2, 4, 5, and 7 necessitating a new gene symbol bc-ud to reflect this change; (v) bc-ud alone delays susceptible symptoms, and when combined with bc-1 enhanced resistance to NL-3; and (vi) bc-ud is on Pv05, not Pv03 as previously thought. These candidate genes, markers, and adjustments to the host-pathogen interaction will facilitate breeding for resistance to BCMNV and related Bean common mosaic virus (BCMV) in common bean.

/pdf/genome-wide-association-mapping-of-bc-1-and-bc-u-reveals-12fbi0ebfb.pdf

Genome-Wide Association Mapping of bc-1 and bc-u Reveals Candidate Genes and New Adjustments to the Host-Pathogen Interaction for Resistance to Bean Common Mosaic Necrosis Virus in Common Bean.

Lima bean (Phaseolus lunatus) is a popular cultivated legume vegetable grown in the United States for dry bean or canned bean production. In 2017, two symptomatic P. lunatus plants exhibiting mosaic, vein banding, and growth retardation were collected in a public garden in Honolulu, HI. Both samples contained bean common mosaic virus (BCMV), and the two BCMV isolates were subjected to biological characterization on a panel of 11 differential cultivars of common bean (P. vulgaris), and to molecular characterization through whole genome sequencing. Both samples contained nearly identical BCMV sequences, named BCMV-A1, which, in turn, were 93% identical to the peanut stripe virus strain of BCMV. BCMV-A1 induced an unusually severe systemic necrosis in cultivar 'Dubbele Witte', and pronounced necrotic or chlorotic reaction in inoculated leaves of five other bean differentials. BCMV-A1 was able to partially overcome resistance alleles bc-1 and bc-2 expressed singly in common bean, inducing no systemic symptoms. Phylogenetic analysis of the BCMV-A1 sequence, and distinct biological reactions in common bean differentials suggested that BCMV-A1 represented a new lima bean strain of BCMV. In 2017, two BCMV isolates were collected in Idaho from common bean, and based on partial genome sequences were found 99% identical to the BCMV-A1 sequence. The data suggest that the lima bean strain of BCMV may have a wider circulation, including common bean as a host. This new strain of BCMV may thus pose a significant threat to common bean production.

https://apsjournals.apsnet.org/doi/pdf/10.1094/PDIS-08-18-1307-RE

A New Strain of Bean Common Mosaic Virus From Lima Bean (Phaseolus lunatus): Biological and Molecular Characterization

Plant viruses cause significant losses in agricultural crops worldwide, affecting the yield and quality of agricultural products. The emergence of novel viruses or variants through genetic evolution and spillover from reservoir host species, changes in agricultural practices, mixed infections with disease synergism, and impacts from global warming pose continuous challenges for the management of epidemics resulting from emerging plant virus diseases. This review describes some of the most devastating virus diseases plus select virus diseases with regional importance in agriculturally important crops that have caused significant yield losses. The lack of curative measures for plant virus infections prompts the use of risk-reducing measures for managing plant virus diseases. These measures include exclusion, avoidance, and eradication techniques, along with vector management practices. The use of sensitive, high throughput, and user-friendly diagnostic methods is crucial for defining preventive and management strategies against plant viruses. The advent of next-generation sequencing technologies has great potential for detecting unknown viruses in quarantine samples. The deployment of genetic resistance in crop plants is an effective and desirable method of managing virus diseases. Several dominant and recessive resistance genes have been used to manage virus diseases in crops. Recently, RNA-based technologies such as dsRNA- and siRNA-based RNA interference, microRNA, and CRISPR/Cas9 provide transgenic and nontransgenic approaches for developing virus-resistant crop plants. Importantly, the topical application of dsRNA, hairpin RNA, and artificial microRNA and trans-active siRNA molecules on plants has the potential to develop GMO-free virus disease management methods. However, the long-term efficacy and acceptance of these new technologies, especially transgenic methods, remain to be established. 

Plant Viruses of Agricultural Importance: Current and Future Perspectives of Virus Disease Management Strategies

‘Lamon bean’ is a protected geographical indication (PGI) for a product of four varieties of bean (Phaseolus vulgaris L.) grown in a specific area of production, which is located in the Belluno district, Veneto region (N.E. of Italy). In the last decade, the ‘Lamon bean’ has been threatened by severe virus epidemics that have compromised its profitability. In this work, the full virome of seven bean samples showing different foliar symptoms was obtained by MinION sequencing. Evidence that emerged from sequencing was validated through RT-PCR and ELISA in a large number of plants, including different ecotypes of Lamon bean and wild herbaceous hosts that may represent a virus reservoir in the field. Results revealed the presence of bean common mosaic virus (BCMV), cucumber mosaic virus (CMV), peanut stunt virus (PSV), and bean yellow mosaic virus (BYMV), which often occurred as mixed infections. Moreover, both CMV and PSV were reported in association with strain-specific satellite RNAs (satRNAs). In conclusion, this work sheds light on the cause of the severe diseases affecting the ‘Lamon bean’ by exploitation of MinION sequencing.

/pdf/the-virome-of-lamon-bean-application-of-minion-sequencing-to-3b62av69.pdf

The Virome of ‘Lamon Bean’: Application of MinION Sequencing to Investigate the Virus Population Associated with Symptomatic Beans in the Lamon Area, Italy

Legume crops, belonging to the Fabaceae family, are of immense importance for sustaining global food security. Many legumes are profitable crops for smallholder farmers due to their unique ability to fix atmospheric nitrogen and their intrinsic ability to thrive on marginal land with minimum inputs and low cultivation costs. Recent progress in genomics shows promise for future genetic gains in major grain legumes. Still it remains limited in minor legumes/underutilized legumes, including adzuki bean, cluster bean, horse gram, lathyrus, red clover, urd bean, and winged bean. In the last decade, unprecedented progress in completing genome assemblies of various legume crops and resequencing efforts of large germplasm collections has helped to identify the underlying gene(s) for various traits of breeding importance for enhancing genetic gain and contributing to developing climate-resilient cultivars. This review discusses the progress of genomic resource development, including genome-wide molecular markers, key breakthroughs in genome sequencing, genetic linkage maps, and trait mapping for facilitating yield improvement in underutilized legumes. We focus on 1) the progress in genomic-assisted breeding, 2) the role of whole-genome resequencing, pangenomes for underpinning the novel genomic variants underlying trait gene(s), 3) how adaptive traits of wild underutilized legumes could be harnessed to develop climate-resilient cultivars, 4) the progress and status of functional genomics resources, deciphering the underlying trait candidate genes with putative function in underutilized legumes 5) and prospects of novel breeding technologies, such as speed breeding, genomic selection, and genome editing. We conclude the review by discussing the scope for genomic resources developed in underutilized legumes to enhance their production and play a critical role in achieving the “zero hunger” sustainable development goal by 2030 set by the United Nations.

/pdf/progress-of-genomics-driven-approaches-for-sustaining-1we1dj9i.pdf

Progress of Genomics-Driven Approaches for Sustaining Underutilized Legume Crops in the Post-Genomic Era

Recessive resistance to Bean common mosaic virus (BCMV) in common bean (Phaseolus vulgaris) is governed by four genes that include one strain-nonspecific helper gene bc-u, and three strain-specific genes bc-1, bc-2, and bc-3. The bc-3 gene was identified as an eIF4E translation initiation factor gene mediating resistance through disruption of the interaction between this protein and the VPg protein of the virus. The mode of action of bc-1 and bc-2 in expression of BCMV resistance is unknown, although bc-1 gene was found to affect systemic spread of a related potyvirus, Bean common mosaic necrosis virus. To investigate the possible role of both bc-1 and bc-2 genes in replication, cell-to-cell, and long-distance movement of BCMV in P. vulgaris, we tested virus spread of eight BCMV isolates representing pathogroups I, IV, VI, VII, and VIII in a set of bean differentials expressing different combinations of six resistance alleles including bc-u, bc-1, bc-12, bc-2, bc-22, and bc-3. All studied BCMV isolates were able to replicate and spread in inoculated leaves of bean cultivars harboring bc-u, bc-1, bc-12, bc-2, and bc-22 alleles and their combinations, while no BCMV replication was found in inoculated leaves of cultivar IVT7214 carrying the bc-u, bc-2, and bc-3 genes, except for isolate 1755a, which was capable of overcoming the resistance conferred by bc-2 and bc-3. In contrast, the systemic spread of all BCMV isolates from pathogroups I, IV, VI, VII, and VIII was impaired in common bean cultivars carrying bc-1, bc-12, bc-2, and bc-22 alleles. The data suggest that bc-1 and bc-2 recessive resistance genes have no effect on the replication and cell-to-cell movement of BCMV, but affect systemic spread of BCMV in common bean. The BCMV resistance conferred by bc-1 and bc-2 and affecting systemic spread was found only partially effective when these two genes were expressed singly. The efficiency of the restriction of the systemic spread of the virus was greatly enhanced when the alleles of bc-1 and bc-2 genes were combined together.

https://apsjournals.apsnet.org/doi/pdf/10.1094/PHYTO-01-18-0021-R

Recessive Resistance to Bean common mosaic virus Conferred by the bc-1 and bc-2 Genes in Common Bean (Phaseolus vulgaris) Affects Long-Distance Movement of the Virus.

Alfalfa is an important perennial forage crop in Idaho supporting dairy and cattle industries that is typically grown in the same field for as many as 4 years. Alfalfa stands of different ages were subjected to screening for viruses using high-throughput sequencing and RT-PCR. The two most common viruses found were alfalfa mosaic virus and bean leafroll virus, along with Medicago sativa amalgavirus, two alphapartitiviruses, and one deltapartitivirus. Additionally, a new flavi-like virus with an unusual genome organization was discovered, dubbed Snake River alfalfa virus (SRAV). The 11,745 nt, positive-sense (+) RNA genome of SRAV encodes a single 3835 aa polyprotein with only two identifiable conserved domains, an RNA-dependent RNA polymerase (RdRP) and a predicted serine protease. Notably, unlike all +RNA virus genomes in the similar size range, the SRAV polyprotein contained no predicted helicase domain. In the RdRP phylogeny, SRAV was placed inside the flavi-like lineage as a sister clade to a branch consisting of hepaci-, and pegiviruses. To the best of our knowledge, SRAV is the first flavi-like virus identified in a plant host. Although commonly detected in alfalfa crops in southern Idaho, SRAV sequences were also amplified from thrips feeding in alfalfa stands in the area, suggesting a possible role of Frankliniella occidentalis in virus transmission.

https://www.mdpi.com/1999-4915/14/6/1320/pdf?version=1655381135

A Novel Flavi-like Virus in Alfalfa (Medicago sativa L.) Crops along the Snake River Valley

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1. ABSTRACT We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

Gardenia E Orellana

Papers

Recessive Resistance to Bean common mosaic virus Conferred by the bc-1 and bc-2 Genes in Common Bean (Phaseolus vulgaris) Affects Long-Distance Movement of the Virus.

A Novel Flavi-like Virus in Alfalfa (Medicago sativa L.) Crops along the Snake River Valley

A New Strain of Bean Common Mosaic Virus From Lima Bean (Phaseolus lunatus): Biological and Molecular Characterization

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Genome Sequences of Two Grapevine Rupestris Stem Pitting-Associated Virus Variants from Vitis vinifera cv. Riesling in Idaho, USA