In 2008 we published the first set of guidelines for standardizing research in autophagy. Since then, research on this topic has continued to accelerate, and many new scientists have entered the field. Our knowledge base and relevant new technologies have also been expanding. Accordingly, it is important to update these guidelines for monitoring autophagy in different organisms. Various reviews have described the range of assays that have been used for this purpose. Nevertheless, there continues to be confusion regarding acceptable methods to measure autophagy, especially in multicellular eukaryotes.

For example, a key point that needs to be emphasized is that there is a difference between measurements that monitor the numbers or volume of autophagic elements (e.g., autophagosomes or autolysosomes) at any stage of the autophagic process versus those that measure flux through the autophagy pathway (i.e., the complete process including the amount and rate of cargo sequestered and degraded). In particular, a block in macroautophagy that results in autophagosome accumulation must be differentiated from stimuli that increase autophagic activity, defined as increased autophagy induction coupled with increased delivery to, and degradation within, lysosomes (in most higher eukaryotes and some protists such as Dictyostelium) or the vacuole (in plants and fungi). In other words, it is especially important that investigators new to the field understand that the appearance of more autophagosomes does not necessarily equate with more autophagy. In fact, in many cases, autophagosomes accumulate because of a block in trafficking to lysosomes without a concomitant change in autophagosome biogenesis, whereas an increase in autolysosomes may reflect a reduction in degradative activity. It is worth emphasizing here that lysosomal digestion is a stage of autophagy and evaluating its competence is a crucial part of the evaluation of autophagic flux, or complete autophagy.

Here, we present a set of guidelines for the selection and interpretation of methods for use by investigators who aim to examine macroautophagy and related processes, as well as for reviewers who need to provide realistic and reasonable critiques of papers that are focused on these processes. These guidelines are not meant to be a formulaic set of rules, because the appropriate assays depend in part on the question being asked and the system being used. In addition, we emphasize that no individual assay is guaranteed to be the most appropriate one in every situation, and we strongly recommend the use of multiple assays to monitor autophagy. Along these lines, because of the potential for pleiotropic effects due to blocking autophagy through genetic manipulation, it is imperative to target by gene knockout or RNA interference more than one autophagy-related protein. In addition, some individual Atg proteins, or groups of proteins, are involved in other cellular pathways implying that not all Atg proteins can be used as a specific marker for an autophagic process. In these guidelines, we consider these various methods of assessing autophagy and what information can, or cannot, be obtained from them. Finally, by discussing the merits and limits of particular assays, we hope to encourage technical innovation in the field.

/pdf/guidelines-for-the-use-and-interpretation-of-assays-for-ijf2t30pbq.pdf

Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition)

In 2008 we published the first set of guidelines for standardizing research in autophagy. Since then, research on this topic has continued to accelerate, and many new scientists have entered the field. Our knowledge base and relevant new technologies have also been expanding. Accordingly, it is important to update these guidelines for monitoring autophagy in different organisms. Various reviews have described the range of assays that have been used for this purpose. Nevertheless, there continues to be confusion regarding acceptable methods to measure autophagy, especially in multicellular eukaryotes. A key point that needs to be emphasized is that there is a difference between measurements that monitor the numbers or volume of autophagic elements (e.g., autophagosomes or autolysosomes) at any stage of the autophagic process vs. those that measure flux through the autophagy pathway (i.e., the complete process); thus, a block in macroautophagy that results in autophagosome accumulation needs to be differentiated from stimuli that result in increased autophagic activity, defined as increased autophagy induction coupled with increased delivery to, and degradation within, lysosomes (in most higher eukaryotes and some protists such as Dictyostelium) or the vacuole (in plants and fungi). In other words, it is especially important that investigators new to the field understand that the appearance of more autophagosomes does not necessarily equate with more autophagy. In fact, in many cases, autophagosomes accumulate because of a block in trafficking to lysosomes without a concomitant change in autophagosome biogenesis, whereas an increase in autolysosomes may reflect a reduction in degradative activity. Here, we present a set of guidelines for the selection and interpretation of methods for use by investigators who aim to examine macroautophagy and related processes, as well as for reviewers who need to provide realistic and reasonable critiques of papers that are focused on these processes. These guidelines are not meant to be a formulaic set of rules, because the appropriate assays depend in part on the question being asked and the system being used. In addition, we emphasize that no individual assay is guaranteed to be the most appropriate one in every situation, and we strongly recommend the use of multiple assays to monitor autophagy. In these guidelines, we consider these various methods of assessing autophagy and what information can, or cannot, be obtained from them. Finally, by discussing the merits and limits of particular autophagy assays, we hope to encourage technical innovation in the field.

/pdf/guidelines-for-the-use-and-interpretation-of-assays-for-28d1pi1jvo.pdf

Guidelines for the use and interpretation of assays for monitoring autophagy

Research in autophagy continues to accelerate,(1) and as a result many new scientists are entering the field Accordingly, it is important to establish a standard set of criteria for monitoring macroautophagy in different organisms Recent reviews have described the range of assays that have been used for this purpose(2,3) There are many useful and convenient methods that can be used to monitor macroautophagy in yeast, but relatively few in other model systems, and there is much confusion regarding acceptable methods to measure macroautophagy in higher eukaryotes A key point that needs to be emphasized is that there is a difference between measurements that monitor the numbers of autophagosomes versus those that measure flux through the autophagy pathway; thus, a block in macroautophagy that results in autophagosome accumulation needs to be differentiated from fully functional autophagy that includes delivery to, and degradation within, lysosomes (in most higher eukaryotes) or the vacuole (in plants and fungi) Here, we present a set of guidelines for the selection and interpretation of the methods that can be used by investigators who are attempting to examine macroautophagy and related processes, as well as by reviewers who need to provide realistic and reasonable critiques of papers that investigate these processes This set of guidelines is not meant to be a formulaic set of rules, because the appropriate assays depend in part on the question being asked and the system being used In addition, we emphasize that no individual assay is guaranteed to be the most appropriate one in every situation, and we strongly recommend the use of multiple assays to verify an autophagic response

/pdf/guidelines-for-the-use-and-interpretation-of-assays-for-4sx3t3he7d.pdf

Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes

Molecular studies of drought stress in plants use a variety of strategies and include different species subjected to a wide range of water deficits. Initial research has by necessity been largely descriptive, and relevant genes have been identified either by reference to physiological evidence or by differential screening. A large number of genes with a potential role in drought tolerance have been described, and major themes in the molecular response have been established. Particular areas of importance are sugar metabolism and late-embryogenesis-abundant (LEA) proteins. Studies have begun to examine mechanisms that control the gene expression, and putative regulatory pathways have been established. Recent attempts to understand gene function have utilized transgenic plants. These efforts are of clear agronomic importance.

The molecular basis of dehydration tolerance in plants

Abscisic acid (ABA) regulates many agronomically important aspects of plant development, including the synthesis of seed storage proteins and lipids, the promotion of seed desiccation tolerance and dormancy, and the inhibition of the phase transitions from embryonic to germinative growth and from

/pdf/abscisic-acid-signaling-in-seeds-and-seedlings-21b3w9tc2t.pdf

Abscisic Acid Signaling in Seeds and Seedlings

Plant Cells Contain Two Functionally Distinct Vacuolar Compartments

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

https://www.pnas.org/content/pnas/88/16/7266.full.pdf

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

Plant cell vacuoles may have storage or lytic functions, but biochemical markers specific for the tonoplasts of functionally distinct vacuoles are poorly defined. Here, we use antipeptide antibodies specific for the tonoplast intrinsic proteins alpha-TIP, gamma-TIP, and delta-TIP in confocal immunofluorescence experiments to test the hypothesis that different TIP isoforms may define different vacuole functions. Organelles labeled with these antibodies were also labeled with antipyrophosphatase antibodies, demonstrating that regardless of their size, they had the expected characteristics of vacuoles. Our results demonstrate that the storage vacuole tonoplast contains delta-TIP, protein storage vacuoles containing seed-type storage proteins are marked by alpha- and delta- or alpha- and delta- plus gamma-TIP, whereas vacuoles storing vegetative storage proteins and pigments are marked by delta-TIP alone or delta- plus gamma-TIP. In contrast, those marked by gamma-TIP alone have characteristics of lytic vacuoles, and results from other researchers indicate that alpha-TIP alone is a marker for autophagic vacuoles. In root tips, relatively undifferentiated cells that contain vacuoles labeled separately for each of the three TIPs have been identified. These results argue that plant cells have the ability to generate and maintain three separate vacuole organelles, with each being marked by a different TIP, and that the functional diversity of the vacuolar system may be generated from different combinations of the three basic types.

/pdf/tonoplast-intrinsic-protein-isoforms-as-markers-for-vacuolar-37rf086osb.pdf

Tonoplast Intrinsic Protein Isoforms as Markers for Vacuolar Functions

An individual plant cell may contain at least two functionally and structurally distinct types of vacuoles: protein storage vacuoles and lytic vacuoles. Presumably a cell that stores proteins in vacuoles must maintain these separate compartments to prevent exposure of the storage proteins to an acidified environment with active hydrolytic enzymes where they would be degraded. Thus, the organization of the secretory pathway in plant cells, which includes the vacuoles, has a fascinating complexity not anticipated from the extensive genetic and biochemical studies of the secretory pathway in yeast. Plant cells must generate the membranes to form two separate types of tonoplast, maintain them as separate organelles, and direct soluble proteins from the secretory flow specifically to one or the other via separate vesicular pathways. Individual soluble and membrane proteins must be recognized and sorted into one or the other pathway by distinct, specific mechanisms. Here we review the emerging picture of how separate plant vacuoles are organized structurally and how proteins are recognized and sorted to each type.

/pdf/sorting-of-proteins-to-vacuoles-in-plant-cells-5fvebwqzef.pdf

Sorting of proteins to vacuoles in plant cells

Plant cells may contain two functionally distinct vacuolar compartments. Membranes of protein storage vacuoles (PSV) are marked by the presence of α-tonoplast intrinsic protein (TIP), whereas lytic vacuoles (LV) are marked by the presence of γ-TIP. Mechanisms for sorting integral membrane proteins to the different vacuoles have not been elucidated. Here we study a chimeric integral membrane reporter protein expressed in tobacco suspension culture protoplasts whose traffic was assessed biochemically by following acquisition of complex Asn-linked glycan modifications and proteolytic processing, and whose intracellular localization was determined with confocal immunofluorescence. We show that the transmembrane domain of the plant vacuolar sorting receptor BP-80 directs the reporter protein via the Golgi to the LV prevacuolar compartment, and attaching the cytoplasmic tail (CT) of γ-TIP did not alter this traffic. In contrast, the α-TIP CT prevented traffic of the reporter protein through the Golgi and caused it to be localized in organelles separate from ER and from Golgi and LV prevacuolar compartment markers. These organelles had a buoyant density consistent with vacuoles, and α-TIP protein colocalized in them with the α-TIP CT reporter protein when the two were expressed together in protoplasts. These results are consistent with two separate pathways to vacuoles for membrane proteins: a direct ER to PSV pathway, and a separate pathway via the Golgi to the LV.

https://rupress.org/jcb/article-pdf/143/5/1183/1281236/9805047.pdf

John C. Rogers

Papers

Plant Cells Contain Two Functionally Distinct Vacuolar Compartments

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

Tonoplast Intrinsic Protein Isoforms as Markers for Vacuolar Functions

Sorting of proteins to vacuoles in plant cells

Integral Membrane Protein Sorting to Vacuoles in Plant Cells: Evidence for Two Pathways