Showing papers by "Michaela Vorlíčková published in 2021"

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Abstract: Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Revealing structural peculiarities of homopurine GA repetition stuck by i-motif clip.

Abstract: Non-canonical forms of nucleic acids represent challenging objects for both structure-determination and investigation of their potential role in living systems. In this work, we uncover a structure adopted by GA repetition locked in a parallel homoduplex by an i-motif. A series of DNA oligonucleotides comprising GAGA segment and C3 clip is analyzed by NMR and CD spectroscopies to understand the sequence–structure–stability relationships. We demonstrate how the relative position of the homopurine GAGA segment and the C3 clip as well as single-base mutations (guanine deamination and cytosine methylation) affect base pairing arrangement of purines, i-motif topology and overall stability. We focus on oligonucleotides C3GAGA and methylated GAGAC3 exhibiting the highest stability and structural uniformity which allowed determination of high-resolution structures further analyzed by unbiased molecular dynamics simulation. We describe sequence-specific supramolecular interactions on the junction between homoduplex and i-motif blocks that contribute to the overall stability of the structures. The results show that the distinct structural motifs can not only coexist in the tight neighborhood within the same molecule but even mutually support their formation. Our findings are expected to have general validity and could serve as guides in future structure and stability investigations of nucleic acids.