M
Min Su Han
Researcher at Gwangju Institute of Science and Technology
Publications - 140
Citations - 7230
Min Su Han is an academic researcher from Gwangju Institute of Science and Technology. The author has contributed to research in topics: Chemistry & Colloidal gold. The author has an hindex of 29, co-authored 120 publications receiving 6593 citations. Previous affiliations of Min Su Han include Pohang University of Science and Technology & Chung-Ang University.
Papers
More filters
Journal ArticleDOI
Oligonucleotide-Modified Gold Nanoparticles for Intracellular Gene Regulation
Nathaniel L. Rosi,David A. Giljohann,C. Shad Thaxton,Abigail K. R. Lytton-Jean,Min Su Han,Chad A. Mirkin +5 more
TL;DR: By chemically tailoring the density of DNA bound to the surface of gold nanoparticles, a tunable gene knockdown was demonstrated and it was demonstrated that gold nanoparticle-oligonucleotide complexes are nontoxic to the cells under the conditions studied.
Journal ArticleDOI
Colorimetric Detection of Mercuric Ion (Hg2+) in Aqueous Media using DNA-Functionalized Gold Nanoparticles
TL;DR: A highly selective and sensitive colorimetric detection method for Hg that relies on thymidine–Hg–thymidine coordination chemistry and complementary DNA–Au NPs with deliberately designed T–T mismatches is presented.
Journal ArticleDOI
A DNA-gold nanoparticle-based colorimetric competition assay for the detection of cysteine.
TL;DR: A highly sensitive and selective colorimetric detection method for cysteine based upon oligonucleotide-functionalized gold nanoparticle probes that contain strategically placed thymidine-thymidine (T-T) mismatches complexed with Hg2+.
Journal ArticleDOI
Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer
Kyung-Mi Song,Minseon Cho,Hunho Jo,Kyoungin Min,Sung Ho Jeon,Taisun Kim,Min Su Han,Ja Kang Ku,Changill Ban +8 more
TL;DR: A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamyzin-immobilized sepharose beads and was detected down to 25 nM by the gold nanoparticle-based colorimetric method.
Journal ArticleDOI
Colorimetric nitrite and nitrate detection with gold nanoparticle probes and kinetic end points.
TL;DR: The development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents that can be triggered at the EPA limit for this ion in drinking water.