Showing papers by "Louis J. Ignarro published in 2010"

CXCR4/YY1 inhibition impairs VEGF network and angiogenesis during malignancy.

Abstract: Tumor growth requires neoangiogenesis. VEGF is the most potent proangiogenic factor. Dysregulation of hypoxia-inducible factor (HIF) or cytokine stimuli such as those involving the chemokine receptor 4/stromal-derived cell factor 1 (CXCR4/SDF-1) axis are the major cause of ectopic overexpression of VEGF in tumors. Although the CXCR4/SDF-1 pathway is well characterized, the transcription factors executing the effector function of this signaling are poorly understood. The multifunctional Yin Yang 1 (YY1) protein is highly expressed in different types of cancers and may regulate some cancer-related genes. The network involving CXCR4/YY1 and neoangiogenesis could play a major role in cancer progression. In this study we have shown that YY1 forms an active complex with HIF-1alpha at VEGF gene promoters and increases VEGF transcription and expression observed by RT-PCR, ELISA, and Western blot using two different antibodies against VEGFB. Long-term treatment with T22 peptide (a CXCR4/SDF-1 inhibitor) and YY1 silencing can reduce in vivo systemic neoangiogenesis (P < 0.01 and P < 0.05 vs. control, respectively) during metastasis. Moreover, using an in vitro angiogenesis assay, we observed that YY1 silencing led to a 60% reduction in branches (P < 0.01) and tube length (P < 0.02) and a 75% reduction in tube area (P < 0.001) compared with control cells. A similar reduction was observed using T22 peptide. We demonstrated that T22 peptide determines YY1 cytoplasmic accumulation by reducing its phosphorylation via down-regulation of AKT, identifying a crosstalk mechanism involving CXCR4/YY1. Thus, YY1 may represent a crucial molecular target for antiangiogenic therapy during cancer progression.

Melatonin synergistically increases resveratrol-induced heme oxygenase-1 expression through the inhibition of ubiquitin-dependent proteasome pathway: a possible role in neuroprotection.

Abstract: Melatonin is an indoleamine secreted by the pineal gland as well as a plant-derived product, and resveratrol (RSV) is a naturally occurring polyphenol synthesized by a variety of plant species; both molecules act as a neuroprotector and antioxidant. Recent studies have demonstrated that RSV reduced the incidence of Alzheimer's disease and stroke, while melatonin supplementation was found to reduce the progression of the cognitive impairment in AD. The heme oxygenase-1 (HO-1) is an inducible and redox-regulated enzyme that provides tissue-specific antioxidant effects. We assessed whether the co-administration of melatonin and RSV shows synergistic effects in terms of their neuroprotective properties through HO-1. RSV significantly increased the expression levels of HO-1 protein in a concentration-dependent manner both in primary cortical neurons and in astrocytes, while melatonin per se did not. Melatonin + RSV showed a synergistic increase in the expression levels of HO-1 protein but not in the HO-1 mRNA level compared to either melatonin or RSV alone, which is mediated by the activation of PI3K-Akt pathway. Treatment of melatonin + RSV significantly attenuated the neurotoxicity induced by H(2) O(2) in primary cortical neurons and also in organotypic hippocampal slice culture. The blockade of HO-1 induction by shRNA attenuated HO-1 induction by melatonin + RSV and hindered the neuroprotective effects against oxidative stress induced by H(2) O(2) . The treatment of MG132 + RSV mimicked the effects of melatonin + RSV, and melatonin + RSV inhibited ubiquitination of HO-1. These data suggest that melatonin potentiates the neuroprotective effect of RSV against oxidative injury, by enhancing HO-1 induction through inhibiting ubiquitination-dependent proteasome pathway, which may provide an effective means to treat neurodegenerative disorders.

Wei Lun Visiting Professorial Lecture: Nitric oxide in the regulation of vascular function: an historical overview.

Abstract: The field of nitric oxide (NO) research has developed in explosive proportions since the discovery of endogenous NO in 1986. The biological importance of NO was first shown by the findings that nitroglycerin causes vasodilation by liberating NO in the smooth muscle, and activating guanylate cyclase to raise smooth muscle levels of cyclic GMP. NO also inhibits platelet aggregation by cyclic GMP mechanisms. NO activates guanylate cyclase by heme dependent mechanisms involving the formation of a nitrosyl-heme complex. The high pharmacological potency of NO was finally understood when NO was shown to be formed endogenously, and to be the same as EDRF. Based on these properties of NO, new drugs can be developed as vasodilators and antiplatelet agents for the treatment of a variety of vascular disorders including impotency. NO elicits many other actions in mammalian systems including inhibition of cell proliferation, airway bronchodilation, antimicrobial effects, other host defense effects, and also modulates learning and memory as well as other central functions. This allows for an extensive opportunity to develop novel drugs for the diagnosis, prevention, and treatment of a number of different diseases, many of which are vascular in origin.

Nitric Oxide in Vascular Damage and Regeneration

Abstract: Publisher Summary This chapter discusses the molecular mechanisms of nitric oxide (NO) signaling in vascular damage. It emphasizes the promising findings in the field of NO and vascular regeneration. NO controls vasorelaxation, endothelial regeneration, inhibition of platelet adhesion, and leukocyte chemotaxis. NO regulates not only vascular function but also many levels of parenchymal function in organs like the kidney, liver, brain, and lung. The modulation of NO availability by increased release or decreased degradation should be done in a spatially specific manner that would correspond to areas in which a specific isoform plays a regulatory role. Its central position in the regulation of organ physiology and molecular signaling generates the impetus to augment its levels in an attempt to interfere with the pathophysiological cascade that leads to tissue dysfunction and destruction. NO deficiency, critical in the development of atherosclerosis and renovascular diseases, occurs through reduced expression and activity of NO synthase, decreased levels or impaired utilization of L-arginine, and enhanced degradation of NO by oxidation-sensitive mechanisms. Genetic manipulation of NO synthase provides important insights into the pathogenic pathway of vascular diseases. Results from pre-clinical and clinical studies suggest that modulation of oxidation-sensitive mechanisms and augmentation of NO production through the administration of L-arginine and antioxidants improve the neovascularization following bone marrow cell therapy or gene therapy. Moreover, nitrite infusion represents a promising NO-generating approach that offers the potential to modulate vascular function during ischemia.

Nitric Oxide, Oxidative Stress, Immune Response and Critical Care

Abstract: Publisher Summary Nitric oxide (NO), a gaseous free radical produced by a wide variety of cell types, has emerged as a significant signaling molecule involved in many physiological systems. Synthesized by a family of enzymes known as NO synthases (NOS), NO exerts its effects primarily by cyclic guanosine-monophosphate (cGMP)-dependent mechanisms, involving activation of soluble guanylate cyclase (sGC). Critical illness is associated with oxidative stress that could exacerbate organ injury and thus overall outcome. The small amounts of nitric oxide (NO) produced physiologically have beneficial effects contributing to the maintenance of normal homeostasis. Increased and persistent production of NO, as observed in critical illnesses, can lead to an overwhelming inflammatory response and tissue injury, promoting cell injury and death. Microcirculatory dysfunction, as a result of an imbalance between NO availability and reactive oxygen species, plays an important role in the pathogenesis of critical illnesses. The most important physiologic factor for NO synthesis is shear stress; that is, a tangential distortion of the endothelial cells produced by blood flow. NO is also released in response to pharmacological agonists such as acetylcholine. NO has been recognized as an important mediator in liver I/R, occurring during transplantation, surgery, hemorrhagic shock, and late sepsis. While eNOS can exert a protective effect on the liver, the excessive NO production from iNOS with associated peroxynitrite formation is generally considered to mediate hepatic injury. The enhanced production of NO contributes to myocardial dysfunction, mediating the depressant effects of proinflammatory cytokines. NO can reduce myocardial contractility by reducing the calcium affinity of contractile apparatus and cause direct myocyte damage by peroxynitrite production.

Reply to Klar: Key role of YY1 in neoangiogenesis

Abstract: In our study (1), we investigated the role of YY1 and described a potential molecular mechanism of cross-talk between YY1 and the VEGF network. YY1 binds hypoxia-inducible factor-1α on VEGF regulatory region. The specific silencing of YY1 reduced VEGF transcription by approximately 20%, the availability of active VEGF protein via AKT, and neoangiogenesis (1). Klar (2) brings to our attention the possibility that these effects also may be mediated by the homolog protein YY2. First, we consider that proteins that play a critical role in the cell occur often in multiple distinct homologous forms but not necessarily with redundant functions. YY1 and YY2 are encoded by genes mapping on different chromosomes, transcribed mRNAs with different sizes, and the proteins have different molecular masses on SDS/PAGE (70 kDa and 58 kDa, respectively). Until now, all of the studies on YY family proteins have failed to address their interactions, despite their homology (3). Second, Klar suggests that YY1 and YY2 can compete for the same regulatory element. It is well established that the role of YY1 is expression dependent. YY1 is overexpressed in human osteosarcomas (4), and YY1 is essential for murine sarcoma metastasis and survival (5). In contrast, the expression pattern of YY2 is completely unknown, and YY1/YY2 relative expression was reported to be different among cell lines. In HeLa cells (3), YY2 was present as 10.3 ± 7 per nanogram of RNA, and YY1 was present as 751 ± 0.1 mRNA copies. Third, 10% of human genes contain YY1 binding sites on their promoter. However, because YY1 and YY2 recognize the same consensus sequences, they do not bind all of the same promoters (at least in humans), they do not have the same affinity and avidity, and they do not require the same binding partner (3). YY1 can compete with YY2 to bind the target sequence whereas the opposite has not been documented. Klar and Bode (6) reported that fivefold molar excess of YY2 is not able to rescue the effects of YY1 (their figure 6B), indicating that YY1 and YY2 bind the same sequences with a markedly different affinity. Finally, Klar requests technical clarification about the specificity of siRNA against YY1. We designed YY1 siRNA oligonucleotides that did not recognize YY2 mRNA, as demonstrated by BLAST analysis using the National Center for Biotechnology Information Map Viewer Genome Browser. The sequences used in our study were: for the upper strand, 5′GCTCCAAGAACAATAGCTTGCCGAAGCAAGCTATTGTTCTTGGAGC3′; for the bottom strand, 5′GCTCCAAGAACAATAGCTTGCTTCGGCAAGCTATTGTTCTTGGAGC3′. Additionally, there are also commercially available siRNA specific for YY1 (Sigma TRCN0000019894) that can be used alternatively in further investigations.