Chromatin, the physiological template of all eukaryotic genetic information, is subject to a diverse array of posttranslational modifications that largely impinge on histone amino termini, thereby regulating access to the underlying DNA. Distinct histone amino-terminal modifications can generate synergistic or antagonistic interaction affinities for chromatin-associated proteins, which in turn dictate dynamic transitions between transcriptionally active or transcriptionally silent chromatin states. The combinatorial nature of histone amino-terminal modifications thus reveals a “histone code” that considerably extends the information potential of the genetic code. We propose that this epigenetic marking system represents a fundamental regulatory mechanism that has an impact on most, if not all, chromatin-templated processes, with far-reaching consequences for cell fate decisions and both normal and pathological development.

/pdf/translating-the-histone-code-l291mddcr9.pdf

Translating the Histone Code

http://experimentationlab.berkeley.edu/sites/default/files/AFMImages/butt_AFM.pdf

Force measurements with the atomic force microscope: Technique, interpretation and applications

Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A.

Interpretation of X-ray Powder Diffraction Patterns . By H. Lipson and H. Steeple. Pp. viii + 335 + 3 plates. (Mac-millan: London; St Martins Press: New York, May 1970.) £4.

X-Ray Diffraction

The basic features of DNA were elucidated during the half-century following the discovery of the double helix. But it is only during the past decade that researchers have been able to manipulate single molecules of DNA to make direct measurements of its mechanical properties. These studies have illuminated the nature of interactions between DNA and proteins, the constraints within which the cellular machinery operates, and the forces created by DNA-dependent motors.

/pdf/ten-years-of-tension-single-molecule-dna-mechanics-3j5v7uo3it.pdf

Ten years of tension: single-molecule DNA mechanics

The authors have identified the disulfide cross-links in bull protamine by titrating intact bull sperm with dithiothreitol (DTT) and following the modification of each cysteine residue with tritiated iodoacetate. The derivatization of each cysteine was monitored by a combination of HPLC, peptide mapping, and protein sequencing. Analyses of total free sulfhydryls show that all seven of the bull protamine cysteines are cross-linked as disulfides in mature sperm. The first disulfide is reduced at a DTT:protamine cysteine (DTT:Cys) ratio of 0.3 and the last at a ratio of 2.0. Intra- and intermolecular disulfides were identified by correlating the reduction of specific disulfides with the dissociation of protamine from DNA in partially reduced sperm and sperm treated with N,N{prime}-ethylenedimaleimide, a bifunctional disulfide cross-linking agent. Three intermolecular and two intramolecular disulfides were identified. The results of these experiments demonstrate that the amino- and carboxy-terminal ends of the bull protamine molecule are folded inward toward the center of the molecule and are locked in place, each by a single intramolecular disulfide bridge. Three intermolecular disulfides cross-link neighboring protamine molecules around the DNA helix in such a manner that the protamines cannot be dissociated from DNA without first reducing the interprotamine disulfides.

Identification of bull protamine disulfides

We have examined the lysine-rich histones from a series of rat and mouse tumors by high-resolution gel electrophoresis and have found a positive correlation between the rate of tumor growth and the extent of lysine-rich histone phosphorylation. This correlation has been found in tumors of a variety of tissues from both rats and mice, further supporting the idea that F1 phosphorylation is an event primarily associated with the process of cell replication. The linear correlation between tumor growth rate and the extent of histone phosphorylation, coupled with cell-cycle data from two of the rat hepatomas, has led to the proposal that the observed increase in F1 phosphorylation in the rapidly dividing tumors results from ( a ) an increase in the fraction of cells actively dividing in the tissue and ( b ) a decrease in the relative proportion of the cell-cycle time occupied by the G1 phase of the cell cycle.

https://cancerres.aacrjournals.org/content/canres/32/8/1775.full.pdf

Comparative High-Resolution Electrophoresis of Tumor Histones: Variation in Phosphorylation as a Function of Cell Replication Rate

Controlling DNA condensation is presently of interest for the development of nonviral approaches to gene therapy. 1 Toward this end, a number of studies have investigated the relationship between the structure of novel DNA condensing agents and the morphology of their associated DNA condensates. 2 Additionally, a wide range of multivalent cations have been studied which condense DNA into toroidal structures. 3 In contrast, the effect of DNA structure (e.g. bends) prior to condensation has received far less attention. 4 Here we report that the introduction of localized static curvature into an otherwise linear duplex DNA polymer can have a profound effect on the size of toroidal condensates formed when the entire polymer is condensed by multivalent cations. Previously, we presented a model for DNA toroid formation in which the initial step is the spontaneous formation of a single loop along the DNA polymer. 5 This loop was proposed to act as a nucleation site for DNA condensation and to be responsible for defining the size and morphology of the toroid. These loops would form as the result of random polymer fluctuations in solution, with their size being a function of the persistence length of DNA. Such a process is supported by real-time studies of DNA condensation which indicate that toroid formation follows a nucleation-growth pathway. 6 The loop initiation model for toroid formation also suggests a mechanism by which toroid size could be altered. That is, if a static loop or multiple loops were introduced into an otherwise linear DNA polymer, these loops would provide a site for toroid nucleation temporally favored over loops formed by random polymer fluctuations. Controlling the size of these static loops would then provide a means for altering toroid dimensions. To investigate the effect of static loops on toroid formation we examined the condensation of a DNA polymer with and without the incorporation of curved DNA. This curved DNA was produced by A-tract sequence-directed curvature. Briefly, an A-tract is a DNA sequence of four to eight consecutive adenine residues. 7 A single A-tract can produce a bend as large as 20 ° in the helical axis of duplex DNA, 8 and long-range static curvature is produced by multiple A-tracts if their incremental bends are in phase with the helical repeat of DNA ( ∼10.5 bp). We have produced a series of DNA polymers based upon a 2961 bp linearized plasmid DNA (pBluescript II SK-, Stratagene, La Jolla) which contain an insert of one, two, three, or four tandem copies, respectively, of the 173 bp sequence 5 ′-ATCCATCGACC(AAAAAACGGGCAAAAAACGGC) 7AAAAAAGCAGTGGAAGC-3′ (Figure 1). 9

Nucleation of DNA Condensation by Static Loops: Formation of DNA Toroids with Reduced Dimensions

We have used the atomic force microscope (AFM) to image the surfaces of intact bull, mouse and rat sperm chromatin and partially decondensed mouse sperm chromatin attached to coverglass. High resolution AFM imaging was performed in air and saline using uncoated, unfixed and unstained chromatin. Images of the surfaces of intact chromatin from all three species and of an AFM-dissected bull sperm nucleus have revealed that the DNA is organized into large nodular subunits, which vary in diameter between 50 and 100 nm. Other images of partially decondensed mouse sperm chromatin show that the nodules are arranged along thick fibers that loop out away from the nucleus upon decondensation. These fibers appear to stretch or unravel, generating narrow smooth fibers with thicknesses equivalent to a single DNA-protamine complex. High resolution AFM images of the nodular subunits suggest that they are discrete, clipsoid-shaped DNA packaging units possibly only one level of packaging above the protamine-DNA complex.

Atomic force microscopy of mammalian sperm chromatin

https://escholarship.org/content/qt8838z54b/qt8838z54b.pdf?t=p6lv8p

Rod Balhorn

Papers

Identification of bull protamine disulfides

Comparative High-Resolution Electrophoresis of Tumor Histones: Variation in Phosphorylation as a Function of Cell Replication Rate

Nucleation of DNA Condensation by Static Loops: Formation of DNA Toroids with Reduced Dimensions

Atomic force microscopy of mammalian sperm chromatin

Mechanism of DNA compaction by yeast mitochondrial protein Abf2p