Showing papers on "Cauliflower mosaic virus published in 2020"

Plant virus particles with various shapes as potential adjuvants.

Abstract: Plant viruses are biologically safe for mammals and can be successfully used as a carrier/platform to present foreign epitopes in the course of creating novel putative vaccines However, there is mounting evidence that plant viruses, their virus-like and structurally modified particles may also have an immunopotentiating effect on antigens not bound with their surface covalently Here, we present data on the adjuvant properties of plant viruses with various shapes (Tobacco mosaic virus, TMV; Potato virus X, PVX; Cauliflower mosaic virus, CaMV; Bean mild mosaic virus, BMMV) and structurally modified TMV spherical particles (SPs) We have analysed the effectiveness of immune response to individual model antigens (ovalbumin, OVA/hen egg lysozyme, HEL) and to OVA/HEL in compositions with plant viruses/SPs, and have shown that CaMV, TMV and SPs can effectively induce total IgG titers to model antigen Some intriguing data were obtained when analysing the immune response to the plant viruses/SPs themselves Strong immunity was induced to CaMV, BMMV and PVX, whereas TMV and SPs stimulated considerably lower self-IgG titers Our results provide new insights into the immunopotentiating properties of plant viruses and can be useful in devising adjuvants based on plant viruses

Single amino acid substitutions in the coat protein and RNA-dependent RNA polymerase alleviated the virulence of Cucumber green mottle mosaic virus and conferred cross protection against severe infection

Abstract: Cross protection is a promising alternate to control Cucumber green mottle mosaic virus (CGMMV) which is of increasing economic importance to cucurbit production worldwide. One major factor confronting the application of cross protection to control CGMMV is the scarcity of available mild mutants. The objective of this paper was to screen attenuated mutants of CGMMV and evaluate their potential in cross protection. An infectious cDNA clone of CGMMV, pCGMMV, was obtained by cloning intron-containing CGMMV genome to modified pCambia0390 vector with the Cauliflower mosaic virus 35S promoter. Five pCGMMV-derived mutants were obtained via site-directed mutagenesis and inoculated to Nicotiana benthamiana plants for symptom observation. The attenuated CGMMV mutants were evaluated for their efficiency in cross protection. The intron-containing clone pCGMMV induced similar disease symptoms and accumulated similar titres of virus in N. benthamiana plants as wild-type CGMMV. Mutations of aspartic acid at position 89 in the coat protein to alanine (D89A) or glutamic acid at position 1069 in the ORF1/2 read-through protein, in the RNA-dependent RNA polymerase domain to alanine (E1069A) alleviated the symptoms of pCGMMV in N. benthamiana plants significantly. In cross protection assay, the two mutants pCGMMV-CP-D89A and pCGMMV-RdRp-E1069A could prevent the superinfection of CGMMV, with protection efficiency of 91.7% and 100%, respectively. The intron-containing clone pCGMMV was stable and highly infectious. The D89 in the coat protein and E1069 in the RNA-dependent RNA polymerase played an important role in regulating the virulence of CGMMV. Mutants pCGMMV-CP-D89A and pCGMMV-RdRp-E1069A were of great potential in the control of CGMMV via cross protection.

Transgenic potato lines expressing CP4-EPSP synthase exhibit resistance against glyphosate

Abstract: Potato crops are particularly vulnerable to weed competition from emergence to canopy closure and are subject to significant yield loss. Glyphosate is broad spectrum herbicide used to control weeds worldwide. In order to incorporate glyphosate resistant trait in four potato cultivars (Lady Olympia, Desiree, Agria and Granola), an efficient, cost effective, reproducible and stable Agrobacterium-mediated genetic transformation protocol was performed using leaf and internodal explants. Agrobacterium strain LBA4404 harboring newly modified recombinant binary vector pCAMHE-EPSPS containing EPSP synthase gene under the control of Cauliflower mosaic virus 35S promoter was used to infect explants. The overall transformation efficiency was 26.4%. Of the 280 plants transferred to greenhouse, 74 plants were found to be PCR positive with gene of interest. GUS histochemical, Southern blot, RT-qPCR, lateral flow dipstick assays confirmed integration and expression of EPSPS in primary transformants. The putative transgenic plants developed from these cultivars possessed enhanced resistance to glyphosate applications in T0 and first tuber generation. These transgenic potato lines could be used as source of germplasm for an efficient potato breeding program. The article reports the development of potato transgenic lines with enhanced tolerance against glyphosate.

Engineering Plant Resistance to Tomato Yellow Leaf Curl Thailand Virus Using a Phloem-Specific Promoter Expressing Hairpin RNA.

Abstract: Transgenic approaches employing RNA interference (RNAi) strategies have been successfully applied to generate desired traits in plants; however, variations between RNAi transgenic siblings and the ability to quickly apply RNAi resistance to diverse cultivars remain challenging. In this study, we assessed the promoter activity of a cauliflower mosaic virus 35S promoter (35S) and a phloem-specific promoter derived from rice tungro bacilliform virus (RTBV) and their efficacy to drive RNAi against the endogenous glutamate-1-semialdehyde aminotransferase gene (GSA) that acts as a RNAi marker, through chlorophyll synthesis inhibition, and against tomato yellow leaf curl Thailand virus (TYLCTHV), a begomovirus (family Geminiviridae) reported to be the prevalent cause of tomato yellow leaf curl disease (TYLCD) in Taiwan. Transgenic Nicotiana benthamiana expressing hairpin RNA of GSA driven by either the 35S or RTBV promoter revealed that RTBV::hpGSA induced stronger silencing along the vein and more uniformed silencing phenotype among its siblings than 35S::hpGSA. Analysis of transgenic N. benthamiana, 35S::hpTYLCTHV, and RTBV::hpTYLCTHV revealed that, although 35S::hpTYLCTHV generated a higher abundance of small RNA than RTBV::hpTYLCTHV, RTBV::hpTYLCTHV transgenic plants conferred better TYLCTHV resistance than 35S::hpTYLCTHV. Grafting of wild-type (WT) scions to TYLCTHV RNAi rootstocks allowed transferable TYLCTHV resistance to the scion. A TYLCTHV-inoculation assay showed that noninfected WT scions were only observed when grafted to RTBV::hpTYLCTHV rootstocks but not 35S::hpTYLCTHV nor WT rootstocks. Together, our findings demonstrate an approach that may be widely applied to efficiently confer TYLCD resistance.

Comparative analysis of Constitutive and fiber-specific promoters under the expression pattern of Expansin gene in transgenic Cotton

Abstract: Promoters are specified segments of DNA that lead to the initiation of transcription of a specific gene. The designing of a gene cassette for plant transformation is significantly dependent upon the specificity of a promoter. Constitutive Cauliflower mosaic virus promoter, CaMV35S, due to its developmental role, is the most commonly used promoter in plant transformation. While Gossypium hirsutum (Gh) being fiber-specific promoter (GhSCFP) specifically activates transcription in seed coat and fiber associated genes. The Expansin genes are renowned for their versatile roles in plant growth. The overexpression of Expansin genes has been reported to enhance fiber length and fineness. Thus, in this study, a local Cotton variety was transformed with Expansin (CpEXPA1) gene, in the form of two separate cassettes, each with a different promoter, named as 35SEXPA1 and FSEXPA1 expressed under CaMV35S and GhSCFP promoters respectively. Integration and Spatiotemporal relative expression of the transgene were studied in an advanced generation. GhSCFP bearing transgene expression was significantly higher in Cotton fiber than other plant parts. While transgene with CaMV35S promoter was found to be continually expressing in all tissues but the expression was lower in fiber than that expressed under GhSCFP. The temporal expression profile was quite interesting with a gradual increasing pattern of both constructs from 1DPA (days post anthesis) to 18DPA and decreased expression from 24 to 30 DPA. Besides the relative expression of promoters, fiber cellulose quantification and fluorescence intensity were also observed. The study significantly compared the two most commonly used promoters and it is deduced from the results that the GhSCFP promoter could be used more efficiently in fiber when compared with CaMV35S which being constitutive in nature preferred for expression in all parts of the plant.

Obtaining Transgenic Potato Plants Expressing the Human Lactoferrin Gene and Analysis of Their Resistance to Phytopathogens

Abstract: The human lactoferrin gene was transferred into genomes of several potato (Solanum tuberosum) cultivars of Ukrainian breeding using the Agrobacterium-mediated transformation. The plasmid vector pBIN35LF carrying the human lactoferrin gene hLf controlled by the 35S cauliflower mosaic virus promoter (CaMV35S) and the octopine synthase terminator, as well as the selective marker neomycin phosphotransferase II gene (nptII) conferring the resistance to kanamycin, was used. As a result of selection, 44 lines of Vernisage, 26 lines of cv. Levada, 25 lines of cv. Svitanok Kyivskyi, and 16 lines of cv. Zarevo cultivars resistant to 100 mg/L of kanamycin were obtained. PCR and Western blot analyses were carried out for transformed lines with primers specific to the hLf gene and a monoclonal antibody against lactoferrin to confirm the transgenic nature of selected tomato plants and hLf gene expression. The selected transgenic potato lines were tested for resistance to bacterial and fungal phytopathogens. The disk diffusion assay revealed that the juice of transgenic potato lines possesses an antibacterial effect against phytopathogenic bacteria Ralstonia solanacearum (causing potato brown rot) and Clavibacter michiganensis subsp. sepedonicus (causing potato ring rot). The resistance of transgenic potato plants to late blight was investigated by in vitro infection of plants with the Phytophthora infestans isolate. As a result, it was found that the obtained transgenic potato lines have enhanced resistance to P. infestans as compared to the control. Thus, the obtained data show that the transfer of the hLf gene into the potato genome enhances potato’s resistance to bacterial and fungal pathogens.

Suppression of Arabidopsis Mediator Subunit-Encoding MED18 Confers Broad Resistance Against DNA and RNA Viruses While MED25 Is Required for Virus Defense.

Abstract: Mediator subunits play key roles in numerous physiological pathways and developmental processes in plants. Arabidopsis Mediator subunits, MED18 and MED25, have previously been shown to modulate disease resistance against fungal and bacterial pathogens through their role in jasmonic acid (JA) signaling. In this study, Arabidopsis mutant plants of the two Mediator subunits, med18 and med25, were tested against three ssRNA viruses and one dsDNA virus belonging to four different families: Turnip mosaic virus (TuMV), Cauliflower mosaic virus (CaMV), Alternanthera mosaic virus (AltMV), and Cucumber mosaic virus (CMV). Although both subunits are utilized in JA signaling, they occupy different positions (Head and Tail domain, respectively) in the Mediator complex and their absence affected virus infection differently. Arabidopsis med18 plants displayed increased resistance to RNA viral infection and a trend against the DNA virus, while med25 mutants displayed increased susceptibility to all viruses tested at 2 and 14 days post inoculations. Defense marker gene expression profiling of mock- and virus-inoculated plants showed that med18 and med25 mutants exhibited an upregulated SA pathway upon virus infection at 2 dpi for all viruses tested. JA signaling was also suppressed in med18 plants after virus infection, independent of which virus infected the plants. The upregulation of SA signaling and suppression of JA signaling in med18 may have led to more targeted oxidative burst and programmed cell death to control viruses. However, the susceptibility exhibited by med25 mutants suggests that other factors, such as a weakened RNAi pathway, might play a role in the observed susceptibility. We conclude that MED18 and MED25 have clear and opposite effects on accumulation of plant viruses. MED18 is required for normal virus infection, while MED25 is important for defense against virus infection. Results from this study provide a better understanding of the role of Mediator subunits during plant-virus interactions, viral disease progression and strategies to develop virus resistant plants.

Insights obtained using different modules of the cotton uceA1.7 promoter

Abstract: The structure of the cotton uceA1.7 promoter and its modules was analyzed; the potential of their key sequences has been confirmed in different tissues, proving to be a good candidate for the development of new biotechnological tools. Transcriptional promoters are among the primary genetic engineering elements used to control genes of interest (GOIs) associated with agronomic traits. Cotton uceA1.7 was previously characterized as a constitutive promoter with activity higher than that of the constitutive promoter from the Cauliflower mosaic virus (CaMV) 35S gene in various plant tissues. In this study, we generated Arabidopsis thaliana homozygous events stably overexpressing the gfp reporter gene driven by different modules of the uceA1.7 promoter. The expression level of the reporter gene in different plant tissues and the transcriptional stability of these modules was determined compared to its full-length promoter and the 35S promoter. The full-length uceA1.7 promoter exhibited higher activity in different plant tissues compared to the 35S promoter. Two modules of the promoter produced a low and unstable transcription level compared to the other promoters. The other two modules rich in cis-regulatory elements showed similar activity levels to full-length uceA1.7 and 35S promoters but were less stable. This result suggests the location of a minimal portion of the promoter that is required to initiate transcription properly (the core promoter). Additionally, the full-length uceA1.7 promoter containing the 5′-untranslated region (UTR) is essential for higher transcriptional stability in various plant tissues. These findings confirm the potential use of the full-length uceA1.7 promoter for the development of new biotechnological tools (NBTs) to achieve higher expression levels of GOIs in, for example, the root or flower bud for the efficient control of phytonematodes and pest-insects, respectively, in important crops.

A Synthetic Strong and Constitutive Promoter Derived from the Stellaria media pro-SmAMP1 and pro-SmAMP2 Promoters for Effective Transgene Expression in Plants.

Abstract: Synthetic promoters are vital for genetic engineering-based strategies for crop improvement, but effective methodologies for their creation and systematic testing are lacking. We report here on the comparative analysis of the promoters pro-SmAMP1 and pro-SmAMP2 from Stellaria media ANTIMICROBIAL PEPTIDE1 (AMP1) and ANTIMICROBIAL PEPTIDE2 (AMP2). These promoters are more effective than the well-known Cauliflower mosaic virus 35S promoter. Although these promoters share about 94% identity, the pro-SmAMP1 promoter demonstrated stronger transient expression of a reporter gene in Agrobacterium infiltration of Nicotiana benthamiana leaves, while the pro-SmAMP2 promoter was more effective for the selection of transgenic tobacco (Nicotiana tabacum) cells when driving a selectable marker. Using the cap analysis of gene expression method, we detected no differences in the structure of the transcription start sites for either promoter in transgenic plants. For both promoters, we used fine-scale deletion analysis to identify 160 bp-long sequences that retain the unique properties of each promoter. With the use of chimeric promoters and directed mutagenesis, we demonstrated that the superiority of the pro-SmAMP1 promoter for Agrobacterium-mediated infiltration is caused by the proline-inducible ACTCAT cis-element strictly positioned relative to the TATA box in the core promoter. Surprisingly, the ACTCAT cis-element not only activated but also suppressed the efficiency of the pro-SmAMP1 promoter under proline stress. The absence of the ACTCAT cis-element and CAANNNNATC motif (negative regulator) in the pro-SmAMP2 promoter provided a more constitutive gene expression profile and better selection of transgenic cells on selective medium. We created a new synthetic promoter that enjoys high effectiveness both in transient expression and in selection of transgenic cells. Intact promoters with differing properties and high degrees of sequence identity may thus be used as a basis for the creation of new synthetic promoters for precise and coordinated gene expression.

In Vivo Gene Silencing of Potato Virus X by Small Interference RNAs in Transgenic Potato

Abstract: RNA silencing is an important antiviral mechanism in plants. Small interfering RNAs (siRNA) or short hairpin RNAs (shRNA) are key stimulators for RNA silencing by acting as executors of viral restriction. Here, we have utilized RNAi technology to suppress potato virus X (PVX) in a transgenic potato cultivar. A stable shRNA of 107 bp directed against a conserved region in the coat protein (CP) gene of PVX was designed with stem and loop sequences derived from a microRNA (miR403; an active regulatory miRNA in potato). The shRNA transgene was directionally cloned in a plant binary vector under the influence of the cauliflower mosaic virus 35S (CaMV35S) constitutive promoter. The pre-shRNA construct was introduced into the potato cultivar Sante through Agrobacterium and transgene insertion was confirmed by testing using PCR (polymerase chain reaction). Upon artificial inoculation of transgenic and non-transgenic potato lines with PVX, variable resistance was revealed through qRT-PCR among the transgenic potato lines. Compared to non-transgenic potato plants, the transgenic potato lines—D5, P3, P9, P14, P21, S11 and S21—showed undetectable levels of CP-PVX mRNA. However, the transgenic lines D4 and P16 exhibited 70% and 75%, respectively, reducing mRNA expression of CP-PVX. The transgenic potato lines remained healthy, with no detectable disease symptoms as compared to the control plants which showed chlorosis and mosaic symptoms. Hence, the expression of virus specific shRNAs is a novel, effective and predictable approach to engineer resistance against PVX in transgenic plants.

Targeted Transgene Expression in Rice Using a Callus Strong Promoter for Selectable Marker Gene Control.

Abstract: Precise expression of a transgene in the desired manner is important for plant genetic engineering and gene function deciphering, but it is a challenge to obtain specific transgene expression free from the interference of the constitutive promoters used to express the selectable marker gene, such as the Cauliflower mosaic virus (CaMV) 35S promoter. So, the solutions to avoid these inappropriate regulations are largely demanded. In this study, we report the characterization of a callus strong promoter (CSP1) in rice and its application for accurate transgene expression. Our results indicate that the high expression of the CSP1 promoter in the callus enables efficient selection of hygromycin equivalent to that provided by the CaMV 35S promoter, whereas its expression in other tissues is low. To evaluate possible leaky effects, the expression of a β-glucuronidase reporter driven by six specific promoters involving hormone signaling, pathogen response, cell fate determination, and proliferation was observed in transgenic rice plants generated by CSP1-mediated selection. Distinct β-glucuronidase expression was found consistently in most of the transgenic lines obtained for each promoter. In addition, we applied these specific marker lines to investigate the root cellular responses to exogenous cytokinin and auxin treatment. The results reveal that the root growth inhibition by cytokinin was differently regulated at high and low concentrations. In summary, we have established the feasibility of using callus-specific promoter-dependent selection to mitigate the transgene misexpression in rice. By enabling efficient transformation, rice plants with reliable transgene expression will be easily acquired for broad applications.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Abstract: An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

Cauliflower Mosaic Virus TAV, a Plant Virus Protein That Functions like Ribonuclease H1 and is Cytotoxic to Glioma Cells.

Abstract: Recent comparisons between plant and animal viruses reveal many common principles that underlie how all viruses express their genetic material, amplify their genomes, and link virion assembly with replication. Cauliflower mosaic virus (CaMV) is not infectious for human beings. Here, we show that CaMV transactivator/viroplasmin protein (TAV) shares sequence similarity with and behaves like the human ribonuclease H1 (RNase H1) in reducing DNA/RNA hybrids detected with S9.6 antibody in HEK293T cells. We showed that TAV is clearly expressed in the cytosol and in the nuclei of transiently transfected human cells, similar to its distribution in plants. TAV also showed remarkable cytotoxic effects in U251 human glioma cells in vitro. These characteristics pave the way for future analysis on the use of the plant virus protein TAV, as an alternative to human RNAse H1 during gene therapy in human cells.

Impact of Cauliflower mosaic virus infection on morphological parameters of radish plants

Abstract: Brassicaceae are among the most economically important crops in the world. Radish (Raphanus sativus L.) belongs to the family Brassicaceae, and is an economically important root crop grown worldwide. Brassica vegetables are highly susceptible to viral diseases. Cauliflower mosaic virus (CaMV), the type member of the genus Caulimovirus, is one of the most severe and destructive viral disease that causes serious damage and economic losses across the members of the Brassicaceae family. The virus systemically infects host plants and produces severe symptoms. Infection with virus reduces radish plant vigour and subsequent root size. Trials were conducted in climate chamber and controlled greenhouse to assess the effect of CaMV infection on growth and yield attributes of radish. Plant-root height (7.6-7.5%), leaf length (19.8%), leaf width (23.4%), stalk length (21.1%), plant-root fresh mass (32.2-8.1%), and plant-root dry mass (38.1-9.5%) were significantly lower in infected plants after eight weeks of virus infection as compared to healthy plants. It has been determined the negative effect of CaMV infection in growth, yield and the morphological attributes of radish in the current study. Please cite this paper as follows: Şevik, M. A. (2020). Impact of Cauliflower mosaic virus Infection on Morphological Parameters of Radish Plants. Alinteri Journal of Agriculture Sciences, 35(1): 27-29. doi: 10.47059/alinteri/V35I2/AJAS20071

An Efficient Agrobacterium-Mediated Genetic Transformation Using Embryonic Axis in Cotton (Gossypium hirsutum L.)

Abstract: Agrobacterium-mediated genetic transformation approach allows for introducing novel genes in cotton (Gossypium hirsutum L.). Development of efficient regeneration and transformation protocol is very important for recalcitrant plants like cotton. In the present study, five-day-old germinated mature embryo parts especially embryonic axis, hypocotyl and plumule of cotton ‘Lashata’ were wounded and inoculated with A. tumefaciens strain GV2260 harbouring plasmid p35S-GUS-INT. The binary plasmid p35S-GUS-INT contains neomycin phosphotransferase II (NPTII) gene driven by nopaline synthase (NOS) promoter and β-glucuronidase (GUS) gene controlled by cauliflower mosaic virus (CaMV) 35S promoter. After inoculation, explants were co-cultivated in liquid and agar-solidified MS medium for 48 h in dark condition. Agar-solidified co-cultivation medium increased transformation frequency as compared to liquid medium. The putative primary transformants were confirmed with histochemical GUS assay, PCR and RT-PCR. However, comparing the three culture explant, the embryonic axis explants had significant difference with embryonic hypocotyl and plumule explants in terms of number and percentage (%) of GUS, PCR and RT-PCR positive plant. The total transformation efficiency was recorded as 3% with varying GUS expression levels.

Comparison of gfp Gene Expression Levels after Agrobacterium-Mediated Transient Transformation of Nicotiana rustica L. by Constructs with Different Promoter Sequences

Abstract: Promoters are key elements regulating gene expression levels, therefore their selection is an important step in genetic engineering research. The reporter gene gfp, which encodes green fluorescent protein (GFP), was transiently expressed in leaf tissues of Aztec tobacco Nicotiana rustica L. Compared to other species of the Nicotiana genus, Aztec tobacco has a large potential for expression of heterologous proteins, a large vegetative biomass, can be easily infiltrated, and is unpretentious in cultivation. Six genetic constructs were used with different promoter sequences: the 35S promoter of Cauliflower Mosaic Virus (35S CaMV), the double-enhanced 35S promoter (D35S CaMV), promoters of the RbcS1B and RbcS2B genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) isolated from Arabidopsis thaliana (L.) Heynh., and promoters of the LHB1B1 and LHB1B2 genes from A. thaliana encoding chlorophyll a/b binding proteins. The gfp gene expression was detected visually, spectrofluorimetrically, and by protein content (Bradford assay) on the seventh day after infiltration. The highest level of expression was observed using the double-enhanced 35S promoter (D35S CaMV) and the lowest using the LHB1B1 gene promoter.

Studying the effect of tissue-specific expression of the K1 gene encoding LysM-receptor-like kinase on the development of symbiosis in peas

Abstract: To study the role of pea LysM receptor-like kinase K1 in the coordination of the infection process, starting in epidermis and nodule organogenesis in the root cortex of plants, during the development of rhizobium-legume symbiosis, the genetic constructs in which K1 gene was cloned under the control of tissue-specific promoter pLeEXT1 of tomato Lycopersicon esculentum extensin gene and the constitutive promoter of cauliflower mosaic virus (CaMV35S, cauliflower mosaic virus 35S) were obtained. During the transformation of the Nod- mutant line, the k1-1, with two types of constructs, the restoration of nodule formation was observed, which indicated the possible participation of K1 in the control not only early, but also later stages of symbiosis development in pea.