Showing papers by "René L. Warren published in 2015"

LINKS: Scalable, alignment-free scaffolding of draft genomes with long reads

Abstract: Owing to the complexity of the assembly problem, we do not yet have complete genome sequences. The difficulty in assembling reads into finished genomes is exacerbated by sequence repeats and the inability of short reads to capture sufficient genomic information to resolve those problematic regions. In this regard, established and emerging long read technologies show great promise, but their current associated higher error rates typically require computational base correction and/or additional bioinformatics pre-processing before they can be of value. We present LINKS, the Long Interval Nucleotide K-mer Scaffolder algorithm, a method that makes use of the sequence properties of nanopore sequence data and other error-containing sequence data, to scaffold high-quality genome assemblies, without the need for read alignment or base correction. Here, we show how the contiguity of an ABySS Escherichia coli K-12 genome assembly can be increased greater than five-fold by the use of beta-released Oxford Nanopore Technologies Ltd. long reads and how LINKS leverages long-range information in Saccharomyces cerevisiae W303 nanopore reads to yield assemblies whose resulting contiguity and correctness are on par with or better than that of competing applications. We also present the re-scaffolding of the colossal white spruce (Picea glauca) draft assembly (PG29, 20 Gbp) and demonstrate how LINKS scales to larger genomes. This study highlights the present utility of nanopore reads for genome scaffolding in spite of their current limitations, which are expected to diminish as the nanopore sequencing technology advances. We expect LINKS to have broad utility in harnessing the potential of long reads in connecting high-quality sequences of small and large genome assembly drafts.

Improved white spruce (Picea glauca) genome assemblies and annotation of large gene families of conifer terpenoid and phenolic defense metabolism.

Abstract: White spruce (Picea glauca), a gymnosperm tree, has been established as one of the models for conifer genomics. We describe the draft genome assemblies of two white spruce genotypes, PG29 and WS77111, innovative tools for the assembly of very large genomes, and the conifer genomics resources developed in this process. The two white spruce genotypes originate from distant geographic regions of western (PG29) and eastern (WS77111) North America, and represent elite trees in two Canadian tree-breeding programs. We present an update (V3 and V4) for a previously reported PG29 V2 draft genome assembly and introduce a second white spruce genome assembly for genotype WS77111. Assemblies of the PG29 and WS77111 genomes confirm the reconstructed white spruce genome size in the 20 Gbp range, and show broad synteny. Using the PG29 V3 assembly and additional white spruce genomics and transcriptomics resources, we performed MAKER-P annotation and meticulous expert annotation of very large gene families of conifer defense metabolism, the terpene synthases and cytochrome P450s. We also comprehensively annotated the white spruce mevalonate, methylerythritol phosphate and phenylpropanoid pathways. These analyses highlighted the large extent of gene and pseudogene duplications in a conifer genome, in particular for genes of secondary (i.e. specialized) metabolism, and the potential for gain and loss of function for defense and adaptation.

Sealer: a scalable gap-closing application for finishing draft genomes

Abstract: Background While next-generation sequencing technologies have made sequencing genomes faster and more affordable, deciphering the complete genome sequence of an organism remains a significant bioinformatics challenge, especially for large genomes. Low sequence coverage, repetitive elements and short read length make de novo genome assembly difficult, often resulting in sequence and/or fragment “gaps” – uncharacterized nucleotide (N) stretches of unknown or estimated lengths. Some of these gaps can be closed by re-processing latent information in the raw reads. Even though there are several tools for closing gaps, they do not easily scale up to processing billion base pair genomes.

Activation of an endogenous retrovirus-associated long non-coding RNA in human adenocarcinoma

Abstract: Long non-coding RNAs (lncRNAs) are emerging as molecules that significantly impact many cellular processes and have been associated with almost every human cancer. Compared to protein-coding genes, lncRNA genes are often associated with transposable elements, particularly with endogenous retroviral elements (ERVs). ERVs can have potentially deleterious effects on genome structure and function, so these elements are typically silenced in normal somatic tissues, albeit with varying efficiency. The aberrant regulation of ERVs associated with lncRNAs (ERV-lncRNAs), coupled with the diverse range of lncRNA functions, creates significant potential for ERV-lncRNAs to impact cancer biology. We used RNA-seq analysis to identify and profile the expression of a novel lncRNA in six large cohorts, including over 7,500 samples from The Cancer Genome Atlas (TCGA). We identified the tumor-specific expression of a novel lncRNA that we have named Endogenous retroViral-associated ADenocarcinoma RNA or ‘EVADR’, by analyzing RNA-seq data derived from colorectal tumors and matched normal control tissues. Subsequent analysis of TCGA RNA-seq data revealed the striking association of EVADR with adenocarcinomas, which are tumors of glandular origin. Moderate to high levels of EVADR were detected in 25 to 53% of colon, rectal, lung, pancreas and stomach adenocarcinomas (mean = 30 to 144 FPKM), and EVADR expression correlated with decreased patient survival (Cox regression; hazard ratio = 1.47, 95% confidence interval = 1.06 to 2.04, P = 0.02). In tumor sites of non-glandular origin, EVADR expression was detectable at only very low levels and in less than 10% of patients. For EVADR, a MER48 ERV element provides an active promoter to drive its transcription. Genome-wide, MER48 insertions are associated with nine lncRNAs, but none of the MER48-associated lncRNAs other than EVADR were consistently expressed in adenocarcinomas, demonstrating the specific activation of EVADR. The sequence and structure of the EVADR locus is highly conserved among Old World monkeys and apes but not New World monkeys or prosimians, where the MER48 insertion is absent. Conservation of the EVADR locus suggests a functional role for this novel lncRNA in humans and our closest primate relatives. Our results describe the specific activation of a highly conserved ERV-lncRNA in numerous cancers of glandular origin, a finding with diagnostic, prognostic and therapeutic implications.

Sequencing of the human IG light chain loci from a hydatidiform mole BAC library reveals locus-specific signatures of genetic diversity

Abstract: Germline variation at immunoglobulin (IG) loci is critical for pathogen-mediated immunity, but establishing complete haplotype sequences in these regions has been problematic because of complex sequence architecture and diploid source DNA. We sequenced BAC clones from the effectively haploid human hydatidiform mole cell line, CHM1htert, across the light chain IG loci, kappa (IGK) and lambda (IGL), creating single haplotype representations of these regions. The IGL haplotype generated here is 1.25 Mb of contiguous sequence, including four novel IGLV alleles, one novel IGLC allele, and an 11.9-kb insertion. The CH17 IGK haplotype consists of two 644 kb proximal and 466 kb distal contigs separated by a large gap of unknown size; these assemblies added 49 kb of unique sequence extending into this gap. Our analysis also resulted in the characterization of seven novel IGKV alleles and a 16.7-kb region exhibiting signatures of interlocus sequence exchange between distal and proximal IGKV gene clusters. Genetic diversity in IGK/IGL was compared with that of the IG heavy chain (IGH) locus within the same haploid genome, revealing threefold (IGK) and sixfold (IGL) higher diversity in the IGH locus, potentially associated with increased levels of segmental duplication and the telomeric location of IGH.

Konnector v2.0: pseudo-long reads from paired-end sequencing data

Abstract: Reading the nucleotides from two ends of a DNA fragment is called paired-end tag (PET) sequencing. When the fragment length is longer than the combined read length, there remains a gap of unsequenced nucleotides between read pairs. If the target in such experiments is sequenced at a level to provide redundant coverage, it may be possible to bridge these gaps using bioinformatics methods. Konnector is a local de novo assembly tool that addresses this problem. Here we report on version 2.0 of our tool. Konnector uses a probabilistic and memory-efficient data structure called Bloom filter to represent a k-mer spectrum - all possible sequences of length k in an input file, such as the collection of reads in a PET sequencing experiment. It performs look-ups to this data structure to construct an implicit de Bruijn graph, which describes (k-1) base pair overlaps between adjacent k-mers. It traverses this graph to bridge the gap between a given pair of flanking sequences. Here we report the performance of Konnector v2.0 on simulated and experimental datasets, and compare it against other tools with similar functionality. We note that, representing k-mers with 1.5 bytes of memory on average, Konnector can scale to very large genomes. With our parallel implementation, it can also process over a billion bases on commodity hardware.

Spaced Seed Data Structures for De Novo Assembly

Abstract: De novo assembly of the genome of a species is essential in the absence of a reference genome sequence. Many scalable assembly algorithms use the de Bruijn graph (DBG) paradigm to reconstruct genomes, where a table of subsequences of a certain length is derived from the reads, and their overlaps are analyzed to assemble sequences. Despite longer subsequences unlocking longer genomic features for assembly, associated increase in compute resources limits the practicability of DBG over other assembly archetypes already designed for longer reads. Here, we revisit the DBG paradigm to adapt it to the changing sequencing technology landscape and introduce three data structure designs for spaced seeds in the form of paired subsequences. These data structures address memory and run time constraints imposed by longer reads. We observe that when a fixed distance separates seed pairs, it provides increased sequence specificity with increased gap length. Further, we note that Bloom filters would be suitable to implicitly store spaced seeds and be tolerant to sequencing errors. Building on this concept, we describe a data structure for tracking the frequencies of observed spaced seeds. These data structure designs will have applications in genome, transcriptome and metagenome assemblies, and read error correction.

LINKS: Scaffolding genome assemblies with kilobase-long nanopore reads

Abstract: Owing to the complexity of the assembly problem, we do not yet have complete genome sequences. The difficulty in assembling reads into finished genomes is exacerbated by sequence repeats and the inability of short reads to capture sufficient genomic information to resolve those problematic regions. Established and emerging long read technologies show great promise in this regard, but their current associated higher error rates typically require computational base correction and/or additional bioinformatics pre-processing before they could be of value. We present LINKS, the Long Interval Nucleotide K-mer Scaffolder algorithm, a solution that makes use of the information in error-rich long reads, without the need for read alignment or base correction. We show how the contiguity of an ABySS E. coli K-12 genome assembly could be increased over five-fold by the use of beta-released Oxford Nanopore Ltd. (ONT) long reads and how LINKS leverages long-range information in S. cerevisiae W303 ONT reads to yield an assembly with less than half the errors of competing applications. Re-scaffolding the colossal white spruce assembly draft (PG29, 20 Gbp) and how LINKS scales to larger genomes is also presented. We expect LINKS to have broad utility in harnessing the potential of long reads in connecting high-quality sequences of small and large genome assembly drafts.

Scaling ABySS to longer reads using spaced k -mers and Bloom filters

Abstract: AGATGTGCTGCCGCCTTGGACAGCGTTACTCTAATT Spaced seed k-mers AGATGTGC----------GACAGCGT GATGTGCT----------ACAGCGTT ATGTGCTG----------CAGCGTTA TGTGCTGC----------AGCGTTAC GTGCTGCC----------GCGTTACT TGCTGCCG----------CGTTACTC GCTGCCGC----------GTTACTCT CTGCCGCC----------TTACTCTA TGCCGCCT----------TACTCTAA GCCGCCTT----------ACTCTAAT CCGCCTTG----------CTCTAATT Scaling ABySS to longer reads using spaced k-mers and Bloom filters