Showing papers in "Molecular Neurobiology in 2002"

Hydrogen sulfide as a neuromodulator.

Abstract: Hydrogen sulfide (H2S) is a well-known toxic gas with the smell of rotten eggs. Since the first description of the toxicity of H2S in 1713, most studies about H2S have been devoted to its toxic effects. Recently, H2S has been proposed as a physiologically active messenger. Three groups discovered that the brain contains relatively high concentrations of endogenous H2S. This discovery accelerated the identification of an H2S-producing enzyme, cystathionine beta-synthase (CBS) in the brain. In addition to the well-known regulators for CBS, S-adenosyl-L-methionine (SAM) and pyridoxal-5'-phosphate, it was recently found that Ca2+/calmodulin-mediated pathways are involved in the regulation of CBS activity. H2S is produced in response to neuronal excitation, and alters hippocampal long-term potentiation (LTP), a synaptic model for memory. can also regulate the release of corticotropin-releasing hormone (CRH) from hypothalamus. Another H2S producing enzyme, cystathionine gamma-lyase (CSE), has been identified in smooth muscle, and H2S relaxes smooth muscle in synergy with nitric oxide (NO). Recent progress in the study of H2S as a novel neuromodulator/transmitter in the brain is briefly reviewed.

Calcium channels and channelopathies of the central nervous system.

Abstract: Several inherited human neurological disorders can be caused by mutations in genes encoding Ca2+ channel subunits. This review deals with known human and mouse calcium channelopathies of the central nervous system (CNS). The human diseases comprise: 1) a recessive retinal disorder, X-linked congenital stationary night blindness, associated with mutations in the CACNA1F gene, encoding alpha(1)1.4 subunits of L-type channels; and 2) a group of rare allelic autosomal dominant human neurological disorders including familial hemiplegic migraine, episodic ataxia type 2, and spinocerebellar ataxia type 6, all associated with mutations in the CACNA1A gene, encoding alpha(1)2.1 subunits of P/Q-type calcium channels. Mutations at the mouse orthologue of the CACNA1A gene cause a group of recessive neurological disorders, including the tottering, leaner, and rocker phenotypes with ataxia and absence epilepsy, and the rolling Nagoya phenotype with ataxia without seizures. Two other spontaneous mouse mutants with ataxia and absence epilepsy, lethargic and stargazer, have mutations in genes encoding a calcium channel auxiliary beta subunit and a putative calcium channel auxiliary gamma subunit. For each channelopathy, the review describes disease phenotype, channel genotype, and known functional consequences of the pathological mutations; in some cases, it also describes working hypothesis and/or speculations addressing the challenging question of how the alterations in channel function lead to selective cellular dysfunction and disease.

Acute neuronal injury, excitotoxicity, and the endocannabinoid system.

Abstract: The endocannabinoid system is a valuable target for drug discovery, because it is involved in the regulation of many cellular and physiological functions. The endocannabinoid system constitutes the endogenous lipids anandamide, 2-arachidonoylglycerol and noladin ether, and the cannabinoid CB1 and CB2 receptors as well as the proteins for their inactivation. It is thought that (endo)cannabinoid-based drugs may potentially be useful to reduce the effects of neurodegeneration. This paper reviews recent developments in the endocannabinoid system and its involvement in neuroprotection.

Functional diversity in neuronal voltage-gated calcium channels by alternative splicing of Ca(v)alpha1.

Abstract: Alternative splicing is a critical mechanism used extensively in the mammalian nervous system to increase the level of diversity that can be achieved by a set of genes. This review focuses on recent studies of voltage-gated calcium (Ca) channel Ca(v)alpha1 subunit splice isoforms in neurons. Voltage-gated Ca channels couple changes in neuronal activity to rapid changes in intracellular Ca levels that in turn regulate an astounding range of cellular processes. Only ten genes have been identified that encode Ca(v)alpha1 subunits, an insufficient number to account for the level of functional diversity among voltage-gated Ca channels. The consequences of regulated alternative splicing among the genes that comprise voltage-gated Ca channels permits specialization of channel function, optimizing Ca signaling in different regions of the brain and in different cellular compartments. Although the full extent of alternative splicing is not yet known for any of the major subtypes of voltage-gated Ca channels, it is already clear that it adds a rich layer of structural and functional diversity".

Neurobiology of glaucomatous optic neuropathy: diverse cellular events in neurodegeneration and neuroprotection.

Abstract: Although glaucomatous optic nerve degeneration is a leading cause of worldwide blindness, neither the precise cellular mechanisms underlying neurodegeneration in glaucoma, nor effective strategies for neuroprotection are yet clear. This review focuses on diverse cellular events associated with glaucomatous neurodegeneration whose balance is critical for determination of ultimate cell fate. An improved understanding of the site of primary injury to optic nerve, the mediator pathways of apoptotic cell death and intrinsic protection mechanisms in retinal ganglion cells, the role of glial activation on the survival and death of retinal ganglion cell bodies and their axons, and the protective and destructive consequences of immune system involvement can facilitate development of effective neuroprotective strategies in glaucoma.

Regulation of GABAergic inhibition by serotonin signaling in prefrontal cortex: molecular mechanisms and functional implications.

Abstract: Serotonergic neurotransmission in prefrontal cortex (PFC) plays a key role in regulating emotion and cognition under normal and pathological conditios. Increasing evidence suggests that serotonin receptors are involved in the complex regulation of GABAergic inhibitory transmission in PFC. Activation of postsynaptic 5-HT2 receptors in PFC pyramidal neurons inhibits GABAA-receptor currents via phosphorylation of GABAA receptor γ2 subunits by RACK1-anchored PKC. In contrast, activation of postsynaptic 5-HT4 receptors produces an activity-dependent bi-directional regulation of GABA-evoked currents in PFC pyramidal neurons, which is mediated through phosphorylation of GABAA-receptor β subunits by anchored PKA. On the presynaptic side, GABAergic inhibition is regulated by 5-HT through the activation of 5-HT2, 5-HT1, and 5-HT3 receptors on GABAergic intereneurons. These data provide a molecular and cellular mechanism for serotonin to dynamically regulate synaptic transmission and neuronal excitability in the PFC network, which may underlie the actions of many antidepressant and antipsychotic drugs.

Mechanisms of GABAA receptor assembly and trafficking: implications for the modulation of inhibitory neurotransmission.

Abstract: Fast synaptic inhibition in the brain is largely mediated by ionotropic GABA receptors, which can be subdivided into GABAA and GABAC receptors based on pharmacological and molecular criteria. GABAA receptors are important therapeutic targets for a range of sedative, anxiolytic, and hypnotic agents and are implicated in several diseases including epilepsy, anxiety, depression, and substance abuse. In addition, modulating the efficacy of GABAergic neurotransmission may play a key role in neuronal plasticity. Recent studies have begun to reveal that the accumulation of ionotropic GABAA receptors at synapses is a highly regulated process that is facilitated by receptor-associated proteins and other cell-signaling molecules. This review focuses on recent experimental evidence detailing the mechanisms that control the assembly and transport of functional ionotropic GABAA receptors to cell surface sites, in addition to their stability at synaptic sites. These regulatory processes will be discussed within the context of the dynamic modulation of synaptic inhibition in the central nervous system (CNS).

Hypoxia signaling to genes: significance in Alzheimer's disease.

Abstract: Aberrations in neural signaling, converging to and diverging from oxidative metabolism and blood supply, contribute to the initiation and maintenance of inflammatory responses, neuronal degeneration, and age-related cognitive decline in Alzheimer's disease (AD). Hypoxia/ischemia triggers phospholipase A2, leading to the accumulation of free arachidonic and docosahexaenoic acids (AA, DHA), as well as that of lysophospholipids. Some of these bioactive lipid messengers in turn give rise to several downstream lipid messengers, such as platelet-activating factor (PAF) and ecosanoids (prostaglandins and leukotrienes). Eicosanoid synthesis is highly regulated in hypoxia and in reperfusion subsequent to ischemia. As one of the consequences, mitochondrial function is disrupted and reactive oxygen species (ROS) both contribute to the expansion of cellular inflammatory responses and reduce the expression of genes required to maintain synaptic structure and function. On the other hand, pro-inflammatory genes are up-regulated. One of these, the inducible cyclooxygenase-2 (COX-2), along with oxygen-starved mitochondria, comprise the major sources of ROS in the brain during hypoxia, ischemia, and reperfusion. One outcome is a sustained metabolic stress that drives progressive dysfunction, apoptosis and/or necrosis, and brain cell death. How hypoxia modulates oxygen-sensitive gene expression is not well understood. Pro-inflammatory gene families that contribute to neurodegeneration are transiently activated in part by the heterodimeric oxygen-sensitive DNA-binding proteins nuclear factor for kappa B (NF-kappaB) and hypoxia-inducible factor-alpha (HIF-1alpha). Here the authors summarize current studies supporting the hypothesis that synaptically-derived lipid messengers play significant roles in ischemic stroke and that hypoxia is an important contributor to the onset and progression of AD neurodegeneration.

Neurobiology of nitrous oxide-induced antinociceptive effects.

Abstract: Nitrous oxide (N2O), or laughing gas, has been used for clinical anesthesia for more than a century and is still commonly used. While the anesthetic/hypnotic mechanisms of N2O remain largely unknown, the underlying mechanisms of its analgesic/antinociceptive effects have been elucidated during the last several decades. Evidence to date indicate that N2O induces opioid peptide release in the periaqueductal gray area of the midbrain leading to the activation of the descending inhibitory pathways, which results in modulation of the pain/nociceptive processing in the spinal cord. The types of opioid peptide induced by N2O and the subtypes of opioid receptors that mediate the antinociceptive effects of N2O appear to depend on various factors including the species and/or strain, the regions of the brain, and the paradigms of behavior testing used for the experiments. Among three types of descending inhibitory pathways, the descending noradrenergic inhibitory pathway seems to play the most prominent role. The specific elements involved are now being resolved.

Mechanisms underlying cytokine-mediated cell-fate regulation in the nervous system.

Abstract: Neurons, astrocytes, and oligodendrocytes, the three major cell types in the nervous system, are generated from common neural stem cells during development. Recent studies have provided evidence that neural stem cells are preserved in the adult brain, where, until recently, neurogenesis had not been considered to take place. The mechanisms that gOvern the fate of neural stem-cell determination have yet to be clarified. It is becoming apparent that soluble protein mediators referred to as cytokines play critical roles in cell-fate determination. For instance, bone morphogenetic proteins (BMPs) alter the fate of developing brain cells from a neurogenic differentiation to an astrocytic one. Different types of cytokines sometimes cooperate to modulate differentiation. For example, the interleukin-6 (IL-6) family cytokines and the BMP family cytokines act in synergy to elaborate astrocyte differentiation. In this review, we focus on recent progress that addresses the molecular mechanisms whereby cytokines regulate the fate of cells in neural lineages. We also discuss possible clinical applications of these findings to minimize the undesirable gliogenesis that occurs after neural stem-cell implantation and nerve injury.

Intracellular A-beta amyloid, A sign for worse things to come?

Abstract: In this review the authors discuss the possible neuropathological role of intracellular amyloid-β accumulation in Alzheimer’s disease (AD) pathology. There is abundant evidence that at early stages of the disease, prior to Aβ amyloid plaque formation, Aβ peptides accumulate intraneuronally in the cerebral cortex and the hippocampus. The experimental evidence would indicate that intracellular amyloid-β could originate both by intracellular biosynthesis and also from the uptake of amyloidogenic peptides from the extracellular milieu. Herein the aspects of the possible impact of intracellular amyloid-β in human AD pathology are discussed, as well as recent observations from a rat transgenic model with a phenotype of intracellular accumulation of Aβ fragments in neurons of the hippocampus and cortex, without plaque formation. In this model, the intracellular amyloid-β phenotype is accompanied by increased MAPK/ERK activity and tau hyperphosphorylation. Finally, the authors discuss the hypothesis that, prior to plaque formation, intracellular Aβ accumulation induces biochemical and pathological changes in the brain at the cellular level priming neurons to further cytotoxic attack of extracellular amyloidogenic peptides.

Clustering of nicotinic acetylcholine receptors: from the neuromuscular junction to interneuronal synapses.

Abstract: Fast and accurate synaptic transmission requires high-density accumulation of neurotransmitter receptors in the postsynaptic membrane. During development of the neuromuscular junction, clustering of acetylcholine receptors (AChR) is one of the first signs of postsynaptic specialization and is induced by nerve-released agrin. Recent studies have revealed that different mechanisms regulate assembly vs stabilization of AChR clusters and of the postsynaptic apparatus. MuSK, a receptor tyrosine kinase and component of the agrin receptor, and rapsyn, an AChR-associated anchoring protein, play crucial roles in the postsynaptic assembly. Once formed, AChR clusters and the postsynaptic membrane are stabilized by components of the dystrophin/utrophin glycoprotein complex, some of which also direct aspects of synaptic maturation such as formation of postjunctional folds. Nicotinic receptors are also expressed across the peripheral and central nervous system (PNS/CNS). These receptors are localized not only at the pre- but also at the postsynaptic sites where they carry out major synaptic transmission. In neurons, they are found as clusters at synaptic or extrasynaptic sites, suggesting that different mechanisms might underlie this specific localization of nicotinic receptors. This review summarizes the current knowledge about formation and stabilization of the postsynaptic apparatus at the neuromuscular junction and extends this to explore the synaptic structures of interneuronal cholinergic synapses.

Circadian clock system in the pineal gland

Abstract: The pineal gland is a neuroendocrine organ that functions as a central circadian oscillator in a variety of nonmammalian vertebrates. In many cases, the pineal gland retains photic input and endocrinal-output pathways both linked tightly to the oscillator. This contrasts well with the mammalian pineal gland equipped only with the output of melatonin production that is subject to neuronal regulation by central circadian oscillator located in the suprachiasmatic nucleus (SCN) of the hypothalamus. Molecular studies on animal clock genes were performed first in Drosophila and later developed in rodents. More recently, clock genes such as Per, Cry, Clock, and Bmal have been found in a variety of vertebrate clock structures including the avian pineal gland. The profiles of the temporal change of the clock gene expression in the avian pineal gland are more similar to those in the mammalian SCN rather than to those in the mammalian pineal gland. Avian pineal gland and mammalian SCN seem to share a fundamental molecular framework of the clock oscillator composed of a transcription/translation-based autoregulatory feedback loop. The circadian time-keeping mechanism also requires several post-translational events, such as protein translocation and degradation processes, in which protein phosphorylation plays a very important role for the stable 24-h cycling of the oscillator and/or the photic-input pathway for entrainment of the clock.

Roles of the complement system in human neurodegenerative disorders: pro-inflammatory and tissue remodeling activities.

Abstract: Complement is an important component of the innate immune response with the capacity to recognize and clear infectious challenges that invade the CNS through a damaged blood brain barrier. For instance, the membrane attack complex is involved in cytotoxic and cytolytic activities while other smaller fragments lead to cell activation (chemotaxis) and phagocytosis of the intruders. It is noteworthy that there is a growing body of evidence that uncontrolled complement biosynthesis and activation in the CNS can contribute to exacerbate the neuronal loss in several neurodegenerative disorders. We provide here an insightful review of the double-edged sword activities of the local innate complement system in the CNS and discuss further the potential therapeutic avenues of delivering complement inhibitors to control brain inflammation.

The role of astroglia on the survival of dopamine neurons

Abstract: Glial cells play a key role in the function of dopamine (DA) neurons and regulate their differentiation, morphology, physiological and pharmacological properties, survival, and resistance to different models of DA lesion. Several studies suggest that glial cells may be important in the pathogenesis of Parkinson’s disease (PD), a common neurodegenerative disorder characterized by degeneration of the nigrostriatal DA system. In this disease the role of glia could be due to the excessive production of toxic products such as nitric oxide (NO) or cytokines characteristic of inflammatory process, or related to a defective release of neuroprotective agents, such as small antioxidants with free radical scavenging properties or peptidic neurotrophic factors.

A short history of LIM domains (1993-2002): from protein interaction to degradation.

Abstract: The LIM domain is a cysteine-rich zinc-finger motif found in a large family of proteins. In LIM-homeodomain (LIM-hd) transcription factors and LIM-only (LMO) factors, the LIM domains are responsible for key interactions with co-activators, co-repressors, competitors, and other transcription factors, and are therefore of considerable importance for the regulation of associated transcriptional activity. In this review, the authors describe the progressive discoveries of NLI/Ldb/CLIM, LMO and RLIM, and discuss how the field was very recently updated by the finding that LIM-hd transcriptional activity is controlled by regulated degradation of cofactors and LIM-hd themselves.

Tau function and dysfunction in neurons: its role in neurodegenerative disorders.

Abstract: Alzheimer's disease (AD) is the most usual neurodegenerative disorder leading to dementia in the aged human population. It is characterized by the presence of two main brain pathological hallmarks: senile plaques and neurofibrillary tangles (NFTs). NFTs are composed of fibrillar polymers of the abnormally phosphorylated cytoskeletal protein tau.

Contribution of the spared primary afferent neurons to the pathomechanisms of neuropathic pain

Abstract: Neuropathic pain is caused by nervous-system lesions. Early studies on the pathomechanisms of this abnormal pain state have focused on the directly injured fibers and neurons. Here, we present recently accumulating data about the contribution of the primary afferent neurons spared from direct injury to the pathomechanisms of neuropathic pain. The phenotypic changes in the spared neurons are similar to those in the neurons in peripheral inflammation models, as opposed to those in the directly injured neurons. Electrophysiological changes and behavioral data also favor the contribution of the spared neurons. These attractive targets of study will give us new approaches for understanding the abnormal pain.

Glutamate receptor genes: susceptibility factors in schizophrenia and depressive disorders?

Abstract: Schizophrenia, depression, and bipolar disorder are three major neuropsychiatric disorders that are among the leading causes of disability and have enormous economic impacts on our society. Although several neurotransmitter systems have been suggested to play a role in their etiology, we still have not identified any gene or molecular mechanism that might lead to genetic susceptibility for or protection against these neuropsychiatric disorders. The glutamatergic receptor system, and in particular the N-methyl-D-aspartate (NMDA) receptor complex, has long been implicated in their etiology. I review the current molecular evidence that supports a critical role for the glutamatergic receptor system in schizophrenia and the potential involvement of this receptor system in depression and bipolar disorder. It is likely that mutations in glutamate receptor genes might alter the risk of developing one of these disorders. Potential future research directions designed to identify these mutations and to elucidate their effect on mental health will be discussed.

Molecular modulation of expression of prion protein by heat shock.

Abstract: Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPC to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of −680 bp (HSE1; GGAACTATTCTTGACATTGCT), and −1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Secretin as a neuropeptide.

Abstract: The role of secretin as a classical hormone in the gastrointestinal system is well-established. The recent debate on the use of secretin as a potential therapeutic treatment for autistic patients urges a better understanding of the neuroactive functions of secretin. Indeed, there is an increasing body of evidence pointing to the direction that, in addition to other peptides in the secretin/glucagon superfamily, secretin is also a neuropeptide. The purpose of this review is to discuss the recent data for supporting the neurocrine roles of secretin in rodents. By in situ hybridization and immunostaining, secretin was found to be expressed in distinct neuronal populations within the cerebellum and cerebral cortex, whereas the receptor transcript was found throughout the brain. In the rat cerebellum, secretin functions as a retrograde messenger to facilitate GABA transmission, indicating that it can modulate motor and other functions. In summary, the recent data support strongly the neuropeptide role of secretin, although the secretin-autism link remains to be clarified in the future.

Reelin signaling and Cdk5 in the control of neuronal positioning

Abstract: Neuronal positioning is important for higher brain function because it is the architectural basis of the formation of precise synaptic circuits. Analysis of neurological mutant mice has led to dramatic progress in the identification and characterization of molecules important for neuronal positioning in the developing mammalian brain. Among these molecules, identification of signal pathways mediated by Reelin and Cdk5 kinase has provided a conceptual framework for exploring the molecular mechanisms underlying proper neuronal positioning in the developing mammalian brain. Recent evidence has implicated synergism between Reelin signaling and Cdk5 in contributing to the proper positioning of selective neuronal populations.

Molecular aspects of vertebrate retinal development

Abstract: The formation of retina from neural plate has been mapped extensively by anatomical and molecular methods. The major cascades of transcription factor expression have been identified, and deficits resulting from transcription factor knockouts are well characterized. There is extensive cross-regulation, both positive and negative, at the transcriptional level between transcription factors and this is vital in the formation of neural compartments. Many transcription factors are important at both early stages of optic cup formation and later stages of terminal differentiation of retinal cell types. The transcription factor cascades can be regulated by extrinsic factors, and some of the intracellular signaling pathways whereby this is achieved have been identified. Defining the quantitative interactions between regulatory molecules will be the next step in understanding this excellent model of vertebrate central nervous system (CNS) development.

Microarray technology and its application on nicotine research.

Abstract: Since its development, microarray technique has revolutionized almost all fields of biomedical research by enabling high-throughput gene expression profiling Using cDNA microarrays, thousands of genes from various organisms have been examined with respect to differentiation/development, disease diagnosis, and drug discovery Nevertheless, research on nicotine using cDNA microarrays has been rather limited Therefore, it is our intention in this article to report the findings of our cDNA microarray study on nicotine We first present an overview of the microarray technology, particularly focusing on the factors related to microarray design and analysis Second, we provide a detailed description of several newly identified biological pathways in our laboratory, such as phosphatidylinositol signaling and calcium homeostasis, which are involved in response to chronic nicotine administration Additionally, we illustrate how comparisons between microarray studies help identify candidate genes that potentially may explain the observed inverse association between smoking and schizophrenia Lastly, given the early stage of microarray research on nicotine, we elaborate on the need for an efficient analysis of genetic networks to further enhance our understanding of the mechanisms involved in nicotine abuse and addiction

Molecular constituents of the node of ranvier

Abstract: The interaction between neurons and glial cells that results in myelin formation represents one of the most remarkable intercellular events in development. This is especially evident at the primary functional site within this structure, the node of Ranvier. Recent experiments have revealed a surprising level of complexity within this zone, with several components, including ion channels, sequestered with a very high degree of precision and sharply demarcated borders. We discuss the current state of knowledge of the cellular and molecular mechanisms responsible for the formation and maintenance of the node. In normal axons, Na+ channels are present at high density within the nodal gap, and voltage-dependent K+ channels are sequestered on the internodal side of the paranode—a region known as the juxtaparanode. Modifying the expression of certain surface adhesion molecules that have been recently identified, markedly alters this pattern. There is a special emphasis on contactin, a protein with multiple roles in the nervous system. In central nervous system (CNS) myelinated fibers, contactin is localized within both the nodal gap and paranodes, and appears to have unique functions in each zone. New experiments on contactin-null mutant mice help to define these mechanisms.

Calcium and retinal function

Abstract: We survey the primary roles of calcium in retinal function, including photoreceptor transduction, transmitter release by different classes of retinal neuron, calcium-mediated regulation of gap-junctional conductance, activation of certain voltage-gated channels for K+ and Cl-, and modulation of postsynaptic potentials in retinal ganglion cells. We discuss three mechanisms for changing [Ca2+]i, which include flux through voltage-gated calcium channels, through ligand-gated channels, and by release from stores. The neuromodulatory pathways affecting each of these routes of entry are considered. The many neuromodulatory mechanisms in which calcium is a player are described and their effects upon retinal function discussed.

Alphaviral vectors for gene transfer into neurons.

Abstract: Alphaviruses are small, enveloped positive-strand RNA viruses that have been successfully transformed into expression vectors in the case of Semliki Forest virus (SFV), Sindbis virus (SIN), and Venezuelan equine encephalitis virus. Compared to other viral vectors, their advantages are easy and fast generation of recombinant viral particles, rapid onset, and high-level transgene expression. When applied to neuronal tissue, SFV and SIN vectors possess the additional advantage of efficiently and preferentially transducing neurons rather than non-neuronal cells. This article gives an overview of the biology of SFV and SIN, their generation into expression vectors, and their application in neurobiology, with particular emphasis on the transduction of hippocampal neurons. In addition, it describes the more recent development of alphaviral vectors with decreased or absent cytotoxicity and lowered transgene expression, temperature-controllable gene expression, and altered host-cell specificity in the central nervous system (CNS). Finally, the review evaluates the use of SFV and SIN vectors in hippocampal tissue cultures vs recombinant lentivirus, adenovirus type 5, adeno-associated virus type 2, and measles virus.

Neuregulin signaling via erbB receptor assemblies in the nervous system.

Abstract: Neuregulins (NRG) play important roles in the development, maintenance, and repair of the nervous system, with influences on neuronal migration, synaptogenesis, receptor subunit composition, and the proliferation/survival of oligodendrocytes and Schwann cells. However, the precise detail of how the NRGs signal through ErbB receptors, particularly at central synapses, is incomplete. The receptor kinase domain provides sites for association with adaptor proteins. In addition, evidence from recent reports suggests that ErbB2/4 receptors, through their C-terminal amino acids, can form specific associations with scaffolding proteins. The existence of such assemblies expands the range of signaling cascades available to the NRGs.

The neurobiology of apolipoproteins in psychiatric disorders.

Abstract: A genetic contribution to the transmission of psychiatric disorders has been established and it is now accepted that several genes confer susceptibility to schizophrenia, and similar disorders, giving rise to a complex polygenic mode of inheritance. With the high-throughput molecular profiling techniques available, apolipoproteins have emerged as being important factors in psychiatric disorders. This review will focus on three apolipoproteins that have recently been shown to be elevated in neuropsychiatric disorders: apoD, apoE, and apoL. Furthermore, the authors discuss the role of apoD in the pathology and pharmacotherapy of schizophrenia and bipolar disorder.

The other half of Hebb: K+ channels and the regulation of neuronal excitability in the hippocampus.

Abstract: Historically, much attention has focused on the mechanisms of activity-dependent plasticity since the description of long-term potentiation by Bliss and Lomo in the early 1970s, while extrasynaptic changes have received much less interest. However, recent work has concentrated on the role of back-propagating action potentials in hippocampal dendrites in synaptic plasticity. In this review, we focus on the modulation of back-propagating action potentials by K+ currents in the dendrites of hippocampal cells. We described the primary K+-channel subunits and their interacting subunits that most likely contribute to these currents, and how these sites can be regulated by phosphorylation and other mechanisms. In conclusion, we provide a model for an alternative form of coincidence detection through K+ channels in the hippocampus.